Application of CsFLS1 gene in breeding of new citrus variety
By overexpressing the CsFLS1 gene in citrus fruits, the hesperidin content was increased, solving the problem of increasing hesperidin content in citrus fruits and achieving efficient breeding and improved health value.
Patent Information
- Application Number
- CN202511146443.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-15
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2045-08-15
AI Technical Summary
In existing technologies, it is difficult to effectively control the increase in hesperidin content in citrus fruits, which affects their bioactivity and health value.
By overexpressing the CsFLS1 gene, the content of hesperidin in citrus peel was increased, and a new citrus variety with high hesperidin content was bred using genetic engineering methods.
It can significantly increase the content of hesperidin in citrus peel, up to 1.41%, accelerate the breeding process, reduce the breeding workload, and improve the comprehensive utilization rate of citrus.
Smart Images

Figure CN120905283A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of genetic engineering, and particularly relates to application of a CsFLS1 gene in breeding of new citrus varieties. BACKGROUND
[0002] Citrus is one of the fruit species with large cultivation area and high yield in China. Citrus fruits contain rich nutritional functional components and bioactive secondary metabolites, which not only endow them with unique flavor and health value, but also have significant effects on oxidation resistance, inflammation resistance and cancer resistance. It is known that the substances with important effects such as anti-inflammatory, antioxidant and anti-tumor in citrus include phenolic acids, flavonoids, carotenoids, essential oils, limonin and synephrine, etc.
[0003] Hesperidin is a typical flavanone glycoside compound with significant biological activity, including: 1) plant stress defense, which can resist the invasion of pathogenic bacteria, fungi and pests; 2) antioxidant and photoprotection, which can scavenge intracellular reactive oxygen species (ROS) and excessive free radicals and reduce oxidative damage; 3) anti-inflammatory, which shows anti-inflammatory activity by inhibiting pro-inflammatory cytokines and reducing leukocyte infiltration; 4) cardiovascular protection, studies have shown that the intake of naringin and hesperidin in diet can effectively reduce the risk of cardiovascular disease mortality in adults; 5) anticancer and antitumor, studies have shown that the intake of naringin and hesperidin in diet can reduce the risk of breast cancer, lung cancer, colon cancer, prostate cancer and pancreatic cancer; 6) metabolic regulation and anti-obesity: regulating the balance of intestinal flora, inhibiting the growth of pathogenic bacteria, promoting the proliferation of probiotics such as bifidobacteria, and improving the intestinal barrier function.
[0004] Hesperidin is widely distributed in various vegetables and fruits and is used in food processing to reduce the use of synthetic chemicals, improve human health, and excavate the key enzymes of its biosynthetic pathway and clarify the molecular mechanism of its function, which can provide a theoretical basis for functional citrus molecular breeding with high hesperidin content and has important significance for improving the comprehensive utilization rate of citrus. SUMMARY
[0005] To solve the above technical problems, the application provides application of a CsFLS1 gene in breeding of new citrus varieties, which improves the content of hesperidin in citrus peel by overexpressing the CsFLS1 gene, and suggests that the CsFLS1 gene can be used as a candidate gene related to synthesis of hesperidin, thereby contributing to the breeding of functional new citrus varieties by using genetic engineering method, accelerating the breeding process and reducing the workload of breeding.
[0006] To achieve the above purpose, the application provides application of a CsFLS1 gene in breeding of new citrus varieties, wherein the CDS sequence of the CsFLS1 gene is shown as SEQ ID NO. 1.
[0007] Preferably, the content of hesperidin in the citrus peel is improved by overexpressing the CsFLS1 gene, and a new citrus variety with high content of hesperidin is obtained.
[0008] The application further provides an overexpression vector containing the CsFLS1 gene, wherein the CDS sequence of the CsFLS1 gene is shown as SEQ ID NO. 1.
[0009] The application further provides a recombinant strain containing the CsFLS1 gene, wherein the CDS sequence of the CsFLS1 gene is shown as SEQ ID NO. 1.
[0010] The application further provides application of the overexpression vector or the recombinant strain in breeding of a new citrus variety, wherein the content of hesperidin in the citrus peel is improved by overexpressing the CsFLS1 gene, and a new citrus variety with high content of hesperidin is obtained.
[0011] The application further provides a breeding method of a new citrus variety with high content of hesperidin, comprising the following steps: amplifying the CDS sequence of the CsFLS1 gene, constructing an overexpression vector of the CsFLS1 gene, transforming Agrobacterium, and infecting the citrus fruit to obtain the new citrus variety; and the CDS sequence of the CsFLS1 gene is shown as SEQ ID NO. 1.
[0012] The application further provides application of the CsFLS1 gene in breeding of a new citrus variety with high content of hesperidin, wherein the CDS sequence of the CsFLS1 gene is shown as SEQ ID NO. 1; the content of hesperidin in the citrus peel is improved by overexpressing the CsFLS1 gene, and a new citrus variety with high content of hesperidin is obtained.
[0013] Compared with the prior art, the application has the following advantages and technical effects:
[0014] The application provides application of the CsFLS1 gene in breeding of a new citrus variety, and the specific technical effects are as follows:
[0015] (1) The application first finds that the expression amount of the CsFLS1 gene is positively correlated with the content of hesperidin in the citrus, and the higher the expression amount of the CsFLS1 gene, the higher the content of hesperidin in the citrus peel; in the experiment, the content of hesperidin in the citrus transiently transformed with the CsFLS1 gene overexpression vector is 1.41% higher than that in the citrus transformed with the empty vector;
[0016] (2) The CsFLS1 gene can be used as a candidate gene for breeding of a new citrus variety with high content of hesperidin, and has important significance for cultivating functional new citrus varieties by using a genetic engineering method, accelerating the breeding process, reducing the workload of breeding, and improving the comprehensive utilization rate of the citrus. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1 The diagram shows the structure of the CsFLS1 gene in Late Orange, where A represents the chromosomal location of the CsFLS1 gene, B represents the structure of the CsFLS1 gene, and C represents the conserved domain of the CsFLS1 gene.
[0019] Figure 2 The image shows the agarose gel electrophoresis results of the amplified CsFLS1 gene CDS sequence. In the figure, M represents Marker and CDS represents the CsFLS1 gene CDS sequence.
[0020] Figure 3 The structure of the CsFLS1 gene overexpression vector pLGNe-CsFLS1 is shown.
[0021] Figure 4 The images show photos of Late Orange fruits from the experimental and control groups on the day of instantaneous transformation and after 5 days of cultivation. In the images, A is a photo of Late Orange fruits from the control and experimental groups on the day of instantaneous transformation, B is a photo of Late Orange fruits from the control and experimental groups after 5 days of cultivation, and C is a partial sample photo of Late Orange fruits from the control and experimental groups after 5 days of cultivation when total RNA was extracted. In the figures, pLGNe represents the control group, and pLGNeCsFLS1-1, pLGNeCsFLS1-2, and pLGNeCsFLS1-3 represent the experimental group.
[0022] Figure 5 The expression levels of the CsFLS1 gene in the peel of the late-maturing oranges injected with the test fruit after 5 days of culture in the experimental and control groups are shown in the figure. pLGNe represents the control group, and pLGNe-CsFLS1-1, pLGNe-CsFLS1-2 and pLGNe-CsFLS1-3 represent the experimental group. P < 0.0001 indicates significant difference.
[0023] Figure 6 The figure shows the results of hesperidin content detection in the peel of the late-maturing orange after 5 days of cultivation in the experimental and control groups. In the figure, pLGNe represents the control group, and pLGNe-CsFLS1-1, pLGNe-CsFLS1-2 and pLGNe-CsFLS1-3 represent the experimental group. P < 0.0001 indicates significant difference.
[0024] Figure 7is a structural formula of hesperidin. DETAILED DESCRIPTION
[0025] Various exemplary embodiments of the present application will now be described in detail, which should be considered to be merely illustrative in nature and are not to be considered as limiting the scope of the present application, and are understood to be within the scope of the present application, with some aspects, features and embodiments of the present application being described in more detail.
[0026] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, for a range of values of a parameter, unless otherwise stated, each intervening value of the parameter is also specifically included within the scope of the present application. The intervening values of the parameter are combined with a stated value of the parameter in range form. These are only exemplary of the various preferred embodiments and are not intended to be limiting on the scope of the application. Other embodiments can be apparent to those of skill in the art from consideration of the specification and can be practiced without departing from the spirit or scope of the application.
[0027] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All patents, patent applications, publications, and descriptions mentioned herein are incorporated by reference to the extent allowed by law for disclosure and description of methods and / or materials related to the cited document. In the case of conflict between the specifications of any incorporated document and the specification of this application, the specification of this application shall control.
[0028] Various modifications and variations can be made to the specific embodiments of the application described herein without departing from the spirit or scope of the application. Other implementations of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary and are not intended to be limiting of the application. Other embodiments can be apparent to those of skill in the art from consideration of the specification and can be practiced without departing from the spirit or scope of the application.
[0029] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having" and the like are open-ended and do not exclude additional, unrecited elements or method steps.
[0030] The source of the material used in the present application: the late Jin orange is derived from a late-maturing Jin orange elite line selected and obtained by the Citrus Research Institute of Chinese Academy of Agricultural Sciences, and the variety approval number is YuShen Citrus 2011001.
[0031] Example 1
[0032] I. Bioinformatics analysis of CsFLS1 gene
[0033] The structure of the CsFLS1 gene of the late Jin orange is as shown in Figure 1As shown, located between 24370946bp to 24374011bp of chromosome of late kiyomi orange No. 1, the chromosome version number is Citrus sinensis v3.0, containing 3 exons, encoding 336 amino acids. The CDS sequence of CsFLS1 gene is shown as SEQ ID NO. 1.
[0034] The CDS sequence of CsFLS1 gene is as shown in SEQ ID NO. 1: ATGGAGGTGGAGAGGGTCCAAGCCATTGCTTCCTTATCCCATTCGAATGGCACGATTCCAGCAGAGTTCATAAGACCCGAAAAGGAACAGCCAGCAAGCACAACGTACCACGGCCCCGCTCCTGAAATCCCCACGATCGATCTCGACGACCCCGTTCAAGACAGACTCGCACGTTCCATCGCTGAAGCCAGCCGGGAGTGGGGGATTTTCCAGGTTACAAACCACGGGATCCCTAGTGACCTCATCTGTAAACTGCAAGCCGTCGGAAAAGAATTTTTCGAGCTCCCTCAGGAAGAGAAAGAAGTGTATTCGCGTCCGGCCGATGCAAAAGACGTGCAAGGATACGGCACCAAGTTACAGAAAGAAGTCGAAGGAAAGAAATCTTGGGTTGATCATCTCTTCCACAGGGTTTGGCCTCCGTCTTCTATCAACTACCGCTTCTGGCCCAACAACCCTCCTTCTTACCGAGCGGTGAATGAGGAGTACGCAAAGTACATGAGGGAGGTGGTGGATAAGTTGTTTACGTATCTTTCGTTGGGACTGGGTGTCGAAGGAGGTGTTTTGAAAGAAGCAGCGGGAGGAGACGACATTGAGTACATGCTCAAGATTAATTATTATCCGCCATGCCCACGTCCTGATCTTGCTCTTGGAGTGGTGGCCCACACTGATCTTTCTGCCCTCACCGTTCTTGTTCCCAATGAAGTTCCTGGTCTGCAAGTCTTTAAGGACGACCGTTGGATCGATGCCAAGTACATCCCCAACGCTCTCGTCATCCACATCGGGGACCAGATCGAGATTCTGAGCAATGGCAAGTACAAAGCTGTGCTGCATAGAACCACTGTTAGCAAGGACAAGACGAGAATGTCGTGGCCAGTTTTCTTGGAGCCACCTGCGGATACGGTGGTGGGTCCCCTTCCTCAGCTGGTTGACGATGAAAATCCTCCAAAGTACAAGGCCAAGAAGTTCAAGGATTACAGTTACTGTAAACTTAACAAACTTCCTCAGTAG.
[0035] II. Cloning of the CDS sequence of CsFLS1 gene
[0036] 1. RNA extraction and cDNA synthesis:
[0037] Total RNA was extracted from the leaves of Citrus sinensis cv. Valencia using a plant total RNA extraction kit (Aidley, CAT: RN09). The quality of the obtained RNA was verified by agarose gel electrophoresis, and the concentration of the obtained RNA was determined using a concentration meter. Then, cDNA was synthesized using the reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT: RR036A) according to the attached instructions.
[0038] 2. Amplification of the CDS sequence of CsFLS1 gene:
[0039] The primers OE-CsFLS1-F (SEQ ID NO. 2), OE-CsFLS1-R (SEQ ID NO. 3), and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q) were used to amplify the obtained cDNA of Citrus sinensis cv. Valencia as the template, and the amplification system was prepared according to the attached instructions of high-fidelity enzyme PrimeSTAR Max DNA Polymerase. The PCR amplification program was as follows: 98°C for 5 min; 98°C for 30 s, 56°C for 30 s, 72°C for 1.5 min, 35 cycles; 72°C for 10 min. The CDS sequence of CsFLS1 gene was amplified, and the fragment length was 1017 bp (CDS sequence 1008 bp - terminator 3 bp + enzyme cutting sites before and after a total of 12 bp).
[0040] Nucleotide sequence of primer OE-CsFLS1-F SEQ ID NO. 2: GGTACCATGGAGGTGGAGAGGGTCC A.
[0041] Nucleotide sequence of primer OE-CsFLS1-R SEQ ID NO. 3: GAATTCCTGAGGAAGTTTGTTAAGTTTACAGTAACTG.
[0042] The results of agarose gel electrophoresis are shown in Figure 2 The size of the amplified fragment was consistent with the expected results. Under the ultraviolet lamp, the agarose gel block containing the target fragment was cut off using a clean blade, and the DNA fragment was recovered using the kit (BioFlux, CAT: BSC02M1). Part of the recovered product was sent to the company for sequencing, and the sequencing results were analyzed by comparison to determine that the obtained DNA fragment was the CDS sequence of CsFLS1 gene of Citrus sinensis (SEQ ID NO. 1).
[0043] III. Construct an overexpression vector for the CsFLS1 gene and transform it into Agrobacterium.
[0044] 1. Constructing an overexpression vector for the CsFLS1 gene:
[0045] The recovered DNA fragments, namely the CDS sequence of the CsFLS1 gene of Late Orange and the overexpression vector pLGNe, were digested with restriction endonucleases KpnⅠ and EcoRI (ThermoFisher) and then recovered by gel extraction. The fragments were ligated at 16℃ for 12 h. The digestion system and reaction conditions were prepared according to the attached instructions. The ligation was performed using the T4 DNA Ligase kit (Promega, CAT: M1801). The ligation system and reaction conditions were prepared according to the instructions attached to the T4 DNA Ligase kit.
[0046] The obtained ligation product was transformed into *E. coli* DH5α using the method described in the instruction manual accompanying the *E. coli* DH5α (purchased from Weidi Biotechnology). Plasmids from positive clones were extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the overexpression vector pLGNe-CsFLS1 of the CsFLS1 gene.
[0047] like Figure 3 The image shows the structure of the CsFLS1 gene overexpression vector pLGNe-CsFLS1.
[0048] 2. Transformation of Agrobacterium tumefaciens with an overexpression vector of the CsFLS1 gene:
[0049] The obtained overexpression vector pLGNe-CsFLS1 was introduced into Agrobacterium tumefaciens EHA105 by heat shock method, and the specific steps were as follows: 2 mL centrifuge tube containing frozen Agrobacterium competent cells EHA105 (50 μL) was thawed on ice; 2 μL overexpression vector plasmid was added to the competent cells, and the mixture was mixed by blowing and then placed on ice for 5 min, frozen in liquid nitrogen for 5 min, incubated at 37°C for 5 min, and placed on ice for 5 min. Then 800 μL LB liquid medium was added to the 2 mL centrifuge tube, mixed by blowing with a pipette, and cultured at 260 r / min and 28°C for 2 h. After the time, the bacterial solution was centrifuged at 6000 r / min for 1 min, the supernatant was discarded, and the bacterial body was resuspended with 50 μL LB liquid medium. After resuspension, it was spread on LB solid medium containing 50 mg / L kanamycin, and cultured at 28°C for 2 d. After the bacterial colonies grew, the colonies were picked and PCR verified using primers ID-CsFLS1-F (SEQ ID NO. 4) and ID-CsFLS1-R (SEQ ID NO. 5) and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q). The amplification system was prepared according to the instructions of high-fidelity enzyme PrimeSTAR Max DNA Polymerase, and the PCR amplification conditions were as follows: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.
[0050] Nucleotide sequence of primer ID-CsFLS1-F SEQ ID NO. 4: TCGTTGAAGATGCCTCTGCCGACAG.
[0051] Nucleotide sequence of primer ID-CsFLS1-R SEQ ID NO. 5: CTGAGGAAGTTTGTTAAGTTTACAGTAACTG.
[0052] The PCR amplification product was subjected to agarose gel electrophoresis, and the colony with correct band size was the positive clone containing the overexpression vector pLGNe-CsFLS1.
[0053] Four, transient transformation of the overexpression vector pLGNe-CsFLS1 of CsFLS1 gene
[0054] 1. Agrobacterium infection:
[0055] Select the late Jin orange fruit with consistent growth state, in the clean bench, with volume concentration of 75% ethanol solution disinfection standby; 500 μL containing pLGNe and pLGNe-CsFLS1 plasmid of Agrobacterium liquid was added to 50 mL liquid LB medium (containing 50 mg / L kanamycin) respectively, and cultured at 28℃, 200 r / min to OD 600 =0.5. Centrifugal precipitation was taken, and the Agrobacterium was resuspended with 1 / 2MS liquid medium, then four injection points were randomly selected on the diagonal line of the equatorial surface of the disinfected late Jin orange fruit, and marked, and 1 mL of the Agrobacterium resuspension liquid containing pLGNe-CsFLS1 plasmid was injected into the late Jin orange peel, 1 mL per area, recorded as the experimental group. The late Jin orange injected with the same method and the same amount of Agrobacterium resuspension liquid containing pLGNe plasmid was used as the control group. The experimental group and the control group were repeated three times respectively, and the late Jin orange fruit injected with the Agrobacterium resuspension liquid was placed in a 28℃ incubator for dark culture for 5d.
[0056] As Figure 4 shown, the photos of the late Jin orange fruit transient transformation of the experimental group and the control group on the same day and after 5d culture, Figure 4 A is the photo of the late Jin orange fruit of the control group (pLGNe) and the experimental group (pLGNe-CsFLS1-1, pLGNe-CsFLS1-2 and pLGNe-CsFLS1-3) on the same day of transient transformation, Figure 4 B is the photo of the late Jin orange fruit of the control group (pLGNe) and the experimental group (pLGNe-CsFLS1-1, pLGNe-CsFLS1-2 and pLGNe-CsFLS1-3) after 5d culture, Figure 4 C is the photo of part of the samples when extracting total RNA.
[0057] 2, qRT-PCR analysis of the transiently transformed late Jin orange fruit:
[0058] The total RNA of the injected area of the late Jin orange fruit of the experimental group and the control group cultured in a 28℃ incubator for 5d in the dark was extracted (Aidley, CAT No: RN09), and the cDNA was synthesized using the reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT: RR036A), and the expression amount of the target gene was detected by qRT-PCR. The detection primer was primer RT-CsFLS1-F (SEQ ID NO. 6) and primer RT-CsFLS1-R (SEQ ID NO. 7).
[0059] The qRT-PCR reaction conditions were 95℃ for 3min, 94℃ for 10s; 56℃ for 10s, 72℃ for 10s, 40 cycles; 72℃ for 10min.
[0060] Nucleotide sequence of primer RT-CsFLS1-F SEQ ID NO. 6: CAGCAAGCACAACGTACCAC.
[0061] Nucleotide sequence of primer RT-CsFLS1-R SEQ ID NO. 7: CTGGAAAATCCCCCACTCCC.
[0062] The relative expression amount of CsFLS1 gene in the experimental group and the control group is calculated by the method 2 -△△Ct The relative expression amount of CsFLS1 gene in the experimental group and the control group is calculated by the method 2 -△△Ct , and the relative expression amount is the multiple of the relative reference factor gene expression.
[0063] As shown in the results, Figure 5 the expression amount of CsFLS1 gene in the experimental group (pLGNe-CsFLS1-1, pLGNe-CsFLS1-2 and pLGNe-CsFLS1-3) is significantly higher than that in the control group, and the highest is more than 8 times of the control.
[0064] V. Determining the content of hesperidin in fruits of the experimental group and the control group.
[0065] The content of hesperidin in fruits of the experimental group and the control group after 5d culture in a 28℃ incubator in the dark is determined by UPLC-MS, and the specific steps are as follows:
[0066] As shown in the results, Figure 6 compared with the fruits of the control group transiently transformed with pLGNe, the content of hesperidin in the pericarp of the fruits transiently transformed with pLGNe-CsFLS1 is increased by 1.09% to 1.41%, which indicates that the transient overexpression of CsFLS1 gene can significantly increase the content of hesperidin in the fruits of late Jin orange. Figure 7 As shown in the results,
[0067] In summary, the present application first finds that the expression amount of CsFLS1 gene is positively correlated with the content of hesperidin in citrus, and the higher the expression amount of CsFLS1 gene is, the higher the content of hesperidin in citrus peel is, and in the experiment, the content of hesperidin in the citrus transiently transformed with the overexpression vector of CsFLS1 gene is the highest, which is 1.41% higher than that of the citrus transformed with the empty vector; CsFLS1 gene can be used as a candidate gene for breeding new varieties of citrus with high content of hesperidin, and it has important significance for cultivating functional new varieties of citrus by genetic engineering, accelerating the breeding process, reducing the workload of breeding and improving the comprehensive utilization rate of citrus.
[0068] The above described embodiments are only to illustrate the preferred modes of the present application, and are not intended to limit the scope of the present application. Any modification and improvement made by those skilled in the art to the technical solutions of the present application without departing from the design spirit of the present application shall fall within the protection scope of the present application as defined by the claims.
Claims
1. Application of CsFLS1 gene in breeding of new citrus varieties, characterized in that, The CDS sequence of the CsFLS1 gene is shown as SEQ ID NO.
1.
2. Use according to claim 1, characterized in that, The CsFLS1 gene is overexpressed to improve the content of hesperidin in citrus peel, and a new citrus variety with high hesperidin content is obtained.
3. An overexpression vector, characterized by, The overexpression vector contains the CsFLS1 gene, and the CDS sequence of the CsFLS1 gene is shown as SEQ ID NO.
1.
4. A recombinant bacterial strain, characterized in that, The recombinant strain contains the CsFLS1 gene, and the CDS sequence of the CsFLS1 gene is shown as SEQ ID NO.
1.
5. The use of the overexpression vector of claim 3 or the recombinant strain of claim 4 in the breeding of new citrus varieties, characterized in that, The overexpression vector or the recombinant strain overexpresses the CsFLS1 gene to improve the content of hesperidin in citrus peel, and a new citrus variety with high hesperidin content is obtained.
6. A method for breeding a new citrus variety having high content of hesperidin, characterized in that, The method comprises the following steps: The CDS sequence of the CsFLS1 gene is amplified, the overexpression vector of the CsFLS1 gene is constructed, the agrobacterium is transformed, the citrus fruit is infected, and a new citrus variety is obtained. The CDS sequence of the CsFLS1 gene is shown as SEQ ID NO.
1.
7. Application of CsFLS1 gene in breeding of new citrus varieties with high hesperidin content, characterized in that, The CDS sequence of the CsFLS1 gene is shown as SEQ ID NO. 1; the CsFLS1 gene is overexpressed to improve the content of hesperidin in citrus peel, and a new citrus variety with high hesperidin content is obtained.
Citation Information
Patent Citations
Alpha-L-rhamnosidase mutant enzyme, gene and expression preparation method
CN113088528A