Application of CsC3 'H gene in increasing contents of rutin, hesperidin and / or didymoside in citrus pomelo peel

By overexpressing the CsC3'H gene in citrus, constructing an overexpression vector, and introducing it into citrus plants, the problem of low levels of rutin, hesperidin, and lemon balm in citrus peel was solved, resulting in a significant increase in the composition of citrus peel and an acceleration of the breeding process.

CN120905285AActive Publication Date: 2025-11-07GERMPLASM INNOVATION GRAND SCIENCE CENTER OF WESTERN CHINA (CHONGQING) SCIENCE CITY +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511146445.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-15
Publication Date
2025-11-07
Estimated Expiration
2045-08-15

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively increase the content of naringin, hesperidin and lemon balm glycoside in citrus peel, thus affecting the comprehensive utilization rate of citrus and the breeding process.

Method used

By overexpressing the CsC3'H gene in citrus, and utilizing the CDS sequence and encoded protein sequence of the CsC3'H gene, an overexpression vector was constructed and introduced into citrus plants to enhance the synthesis of rutin, hesperidin, and lemon balm glycoside in citrus peel.

Benefits of technology

It significantly increased the content of naringin, hesperidin and lemon balm glycoside in citrus peel, with a maximum increase of 69.38%, which accelerated the breeding process of functional citrus varieties and reduced the breeding workload.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905285A_ABST
    Figure CN120905285A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene engineering, and discloses an application of a CsC3 'H gene in increasing the content of rutin, hesperidin and / or didymoside in citrus shaddock peel, the CDS sequence of the CsC3' H gene is shown as SEQ ID NO.1, and the protein sequence coded by the CsC3 'H gene is shown as SEQ ID NO.2. The invention further discloses a preparation method of the CsC3' H gene for improving the content of rutin, hesperidin and / or didymoside in citrus shaddock peel. According to the application disclosed by the invention, the CsC3 'H gene is found to be positively correlated with the contents of rutin, hesperidin and / or didymoside in citrus peel for the first time, and in an experiment, the highest value of citrus of which the CsC3' H gene overexpression vector is transformed is 69.38% higher than that of citrus of which an empty vector is transformed; therefore, the CsC3 'H gene can be used as a candidate gene for breeding a new citrus variety with high naringin, hesperidin and / or didymoside content, and has important significance in breeding a new functional citrus variety by adopting a genetic engineering method, accelerating the breeding process, reducing the breeding workload and improving the comprehensive utilization rate of citrus.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of genetic engineering, and particularly relates to application of a CsC3'H gene in increasing content of narirutin, hesperidin and / or luteolin in citrus. BACKGROUND

[0002] Citrus is the largest fruit in China, and the cultivation area and yield of which are the largest in the world. Citrus fruits contain rich nutritional functional components and bioactive secondary metabolites, which not only endow them with unique flavors and health values, but also have significant effects on oxidation resistance, inflammation resistance and cancer resistance. At present, it is known that the substances with important effects of inflammation resistance, oxidation resistance and tumor resistance contained in citrus include phenolic acids, flavonoids, carotenoids, essential oils, limonin and synephrine.

[0003] Narirutin, hesperidin, luteolin and sweet orange flavonoids are typical flavanone glycosides compounds, and have significant biological activities, including: 1) plant stress resistance defense, which can resist the invasion of pathogens (bacteria and fungi) and pests; 2) oxidation resistance and light protection, which can remove intracellular reactive oxygen species (ROS) and excessive free radicals and reduce oxidative damage; 3) inflammation resistance, which shows anti-inflammatory activity by inhibiting pro-inflammatory cytokines and reducing leukocyte infiltration; 4) cardiovascular protection, researches show that the intake of narirutin and hesperidin in diet can effectively reduce the risk of cardiovascular disease death in adults; 5) anti-cancer and anti-tumor, researches show that the intake of narirutin and hesperidin in diet can reduce the incidence risk of breast cancer, lung cancer, colon cancer, prostate cancer and pancreatic cancer; 6) metabolism regulation and anti-obesity: regulating intestinal flora balance, inhibiting the growth of pathogenic bacteria, promoting the proliferation of probiotics (such as bifidobacteria) and improving intestinal barrier function.

[0004] Narirutin, hesperidin and / or luteolin are widely distributed in various vegetables and fruits, and are used in food processing to reduce the use of synthetic chemicals, improve human health, excavate key enzymes of the biosynthetic pathway and clarify the molecular mechanism of the function, which can provide a theoretical basis for functional citrus molecular breeding with high narirutin, hesperidin and / or luteolin content, and has important significance for improving the comprehensive utilization rate of citrus. SUMMARY

[0005] The application aims to provide application of a CsC3'H gene in increasing content of narirutin, hesperidin and / or luteolin in citrus, so as to provide a candidate gene related to synthesis of narirutin, hesperidin and / or luteolin, and contribute to the cultivation of functional citrus new varieties by using the method of genetic engineering, acceleration of the breeding process and reduction of the breeding workload.

[0006] In order to achieve the above-mentioned purpose, the application provides application of a CsC3'H gene in increasing contents of naringin, hesperidin and / or jaceosidin in citrus peels, wherein a CDS sequence of the CsC3'H gene is shown as SEQ ID NO. 1, and a protein sequence encoded by the CsC3'H gene is shown as SEQ ID NO. 2.

[0007] Further, the CsC3'H gene is overexpressed in the citrus to increase contents of naringin, hesperidin and / or jaceosidin in the citrus peels.

[0008] Further, the expression amount of the CsC3'H gene is positively correlated with the contents of naringin, hesperidin and / or jaceosidin in the citrus peels.

[0009] Still further, the application also provides application of the CsC3'H gene in breeding of citrus varieties, wherein the CDS sequence of the CsC3'H gene is shown as SEQ ID NO. 1, and the protein sequence encoded by the CsC3'H gene is shown as SEQ ID NO. 2; and the breeding of the citrus varieties is breeding of the citrus varieties with increased contents of naringin, hesperidin and / or jaceosidin in peels.

[0010] The application also provides a plant overexpression vector containing the CsC3'H gene, wherein the CDS sequence of the CsC3'H gene is shown as SEQ ID NO. 1, and the protein sequence encoded by the CsC3'H gene is shown as SEQ ID NO. 2.

[0011] Still further, the application also provides application of the plant overexpression vector containing the CsC3'H gene in breeding of the citrus.

[0012] Still further, the application also provides a method for breeding citrus plants with increased contents of naringin, hesperidin and / or jaceosidin in peels, wherein the CsC3'H gene or the plant overexpression vector containing the CsC3'H gene is introduced into the citrus plants, the CsC3'H gene is overexpressed in the citrus plants, and the citrus plants with increased contents of naringin, hesperidin and / or jaceosidin are bred;

[0013] The CDS sequence of the CsC3'H gene is shown as SEQ ID NO. 1, and the protein sequence encoded by the CsC3'H gene is shown as SEQ ID NO. 2.

[0014] Therefore, the application provides the CsC3'H gene in the application of increasing contents of naringin, hesperidin and / or jaceosidin in citrus peels, which has the advantages and positive effects that:

[0015] (1) The application first discovers that the expression amount of CsC3'H gene is positively correlated with the content of naringin, hesperidin and / or jaceosidin in citrus, the higher the expression amount of CsC3'H gene is, the higher the content of naringin, hesperidin and / or jaceosidin in citrus is, and the citrus transiently transformed with CsC3'H gene overexpression vector in the experiment can be 69.38% higher than that of the citrus transformed with empty vector.

[0016] (2) The CsC3'H gene can be used as a candidate gene for breeding new citrus varieties with high naringin, hesperidin and / or jaceosidin content, and has important significance for cultivating functional new citrus varieties by genetic engineering, accelerating breeding process, reducing breeding workload and improving comprehensive utilization rate of citrus.

[0017] The technical solutions of the application will be further described in detail below by means of the drawings and examples. BRIEF DESCRIPTION OF DRAWINGS

[0018] In order to more clearly illustrate the technical solutions of the embodiments of the application, the drawings needed to be used in the description of the embodiments of the application will be briefly introduced as follows. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can also be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0019] Figure 1 The bioinformatics analysis results of CsC3'H gene in Example 1 of the application are shown in the table, wherein A is the chromosomal localization of CsC3'H gene in late Jin orange, and bp is base; B is the structure of CsC3'H gene in late Jin orange, and Exon1-3 is exon; C is the conserved domain of CsC3'H gene in late Jin orange, and aa is amino acid;

[0020] Figure 2 The electrophoresis map of PCR amplification product of coding sequence of CsC3'H gene cloned in Example 2 of the application is shown in the figure, wherein CDS represents the coding sequence of CsC3'H gene, and M represents DNA molecular weight standard;

[0021] Figure 3 The structure diagram of CsC3'H gene overexpression vector in Example 3 of the application is shown in the figure, wherein GUS:NPTII represents β-glucuronidase gene; P 35S represents plant constitutive promoter derived from cauliflower mosaic virus; T NOS represents opine synthase gene terminator;

[0022] Figure 4Photos of fruits of Example 4 of the present application on the day of transient transformation and 5 days after the transient transformation, wherein A is the photo of fruits on the day of transient transformation; B is the photo of fruits 5 days after the transient transformation; C is the photo of part of samples when total RNA is extracted;

[0023] Figure 5 Results of relative expression amount analysis of CsC3'H gene in Example 4 of the present application;

[0024] Figure 6 Results of content detection of narirutin, hesperidin and / or jaceosidin in the fruit peel of transiently transformed late-kumquat in Example 5 of the present application, wherein A is the content of narirutin; B is the content of hesperidin; C is the content of jaceosidin. DETAILED DESCRIPTION

[0025] The technical solutions of the present application are further described below by means of the accompanying drawings and examples.

[0026] In order to make the purpose, technical solutions and advantages of the present application more clear, thorough and complete, the technical solutions of the present application are described clearly and completely by means of the accompanying drawings and examples. The following detailed description is the description of examples, which aims to provide further detailed description of the present application. Unless otherwise specified, all technical terms used in the present application have the same meaning as generally understood by those skilled in the art to which the present application belongs.

[0027] The instrument equipment and reagent materials used in the examples are obtained through commercial channels; the method steps not described in detail in the examples are conventional technical means in the art.

[0028] Late-kumquat is a late-maturing kumquat elite line selected from common kumquat by the Citrus Research Institute of Chinese Academy of Agricultural Sciences during the early 1980s to 2010. The variety approval number is YuShen Citrus 2011001.

[0029] Example 1: Bioinformatics analysis of CsC3'H gene of late-kumquat

[0030] The structure of CsC3'H gene is shown in Figure 1 , which is located between 3,752,127 bp and 3,756,838 bp of chromosome 1 of late-kumquat, contains 3 exons, and encodes 509 amino acids. The CDS sequence of CsC3'H gene is shown in SEQ ID NO. 1:

[0031] SEQ ID NO. 1:

[0032]

[0033] The CsC3'H protein sequence is shown as SEQ ID NO. 2.

[0034] SEQ ID NO. 2:

[0035] MALPLIPLSIIFIILAYKLYQRLRFNLPPGPRPLPIVGNLYDIKPVRFRCFAEWAQQYGPVISVWFGSTLNVIVSNTELAREVLKEHDQQLADRHRSRSAAKFSRDGKDLIWADYGPHYVKVRKVCTLELFTPKRLEALRPIREDEVTAMVESIFKDCTDPQNYGKSVLVKKYLGAVAFNNITRLAFGKRFVNSEDVMDEQGKEFKAIVANGLKLGASLAMAEHIPWLRWMFPLEEGAFAKHGERRDRLTRAIMEEHTLARQKSGGTKQHFVDALLTLQEKYDLSEDTIIGLLWDMITAGMDTTAISTEWGMAELIKNPRVQQKAQEELDRVIGFERVMTETDFSNLPYLQAVAKEALRLHPPTPLMLPHRANANVKIGGYDVPKGSNIHVNVWAVARDPAVWKDPLEFRPERFFEEDVDMKGHDFRLLPFGAGRRVCPGAQLGINLVTSMLGHLLHHFAWAPPEGVKPEEIDMSENPGLVTYMKTPLQAVPTPRLPSHLYKRVAADM.

[0036] Cloning of the coding sequence of the CsC3'H gene of Citrus sinensis cv. Valencia

[0037] 2.1 RNA extraction and cDNA synthesis:

[0038] Total RNA was extracted from leaves of Citrus sinensis cv. Valencia using a plant total RNA extraction kit (Aidlab, CAT: RN09), and the quality of the obtained RNA was verified by agarose gel electrophoresis. The concentration of the obtained RNA was determined using a concentration meter. Then, cDNA was synthesized using a reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT: RR036A) according to the attached instructions.

[0039] 2.2 Amplification of the CsC3'H coding sequence:

[0040] Using the primer OE-CsC3'H-F (the sequence is shown in SEQ ID NO. 3), OE-CsC3'H-R (the sequence is shown in SEQ ID NO. 4) and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q), 2.1 of the obtained cDNA of Citrus sinensis as a template, the amplification system was configured according to the instructions attached to high-fidelity enzyme PrimeSTAR Max DNA Polymerase, and the PCR amplification program was as follows: 98°C, 5 min; 98°C, 30 s, 56°C, 30 s, 72°C, 1.5 min, 35 cycles; 72°C extension for 10 min. The DNA fragment of CsC3'H coding sequence was amplified, and the length of the fragment was 1536 bp (CDS sequence 1527 bp-terminator 3 bp + 12 bp of enzyme cutting sites before and after a total of 12 bases).

[0041] The results of agarose gel electrophoresis are shown in Figure 2 The size of the amplified fragment is as expected. Under the ultraviolet lamp, the agarose gel block containing the target fragment was cut off with a clean knife, and the DNA fragment was recovered using the kit (BioFlux, CAT: BSC02M1). Part of the recovered product was sent to the company for sequencing, and the sequencing results were analyzed by comparison to determine that the obtained DNA fragment was the CsC3'H gene coding sequence of Citrus sinensis (SEQ ID NO. 1).

[0042] SEQ ID NO. 3: GGTACCATGGCTCTCCCACTCATCCC;

[0043] SEQ ID NO. 4: GAATTCCATATCAGCGGCCACACG.

[0044] Example 3: Construction of CsC3'H overexpression vector and transformation of Agrobacterium

[0045] 3.1 Construction of CsC3'H overexpression vector:

[0046] The recovered DNA fragment obtained in Example 2 and the overexpression vector pLGNe were double-digested with restriction endonuclease Kpn I and Eco R I (Thermo Fisher) and then gel-recovered and connected at 16°C overnight. The enzyme digestion system and reaction conditions were performed according to the attached instructions (configuration). The ligation was performed using T4 DNA Ligase kit (Promega, CAT: M1801), and the ligation system and reaction conditions were performed according to the attached instructions of T4 DNA Ligase kit (configuration).

[0047] The obtained ligation product was transformed into E. coli DH5a, and the transformation method was performed according to the method described in the attached instructions of E. coli DH5a. The plasmid of the positive clone was extracted by using a plasmid extraction kit (Omega, CAT: D6942), and the overexpression vector pLGNe-CsC3'H of CsC3'H was obtained, and the vector structure is shown in Figure 3 .

[0048] 3.2 Transformation of CsC3'H overexpression vector into Agrobacterium:

[0049] The obtained overexpression vector pLGNe-CsC3'H was introduced into Agrobacterium tumefaciens EHA105 by heat shock method, and the specific steps were as follows:

[0050] The Agrobacterium competent cells EHA105 (50 μL) stored in a 2 mL centrifuge tube were thawed on ice in advance; 2 μL of the overexpression vector plasmid was added to the competent cells, and the mixture was mixed by blowing and then placed on ice for 5 min, frozen in liquid nitrogen for 5 min, incubated at 37°C for 5 min, and placed on ice for 5 min. Then 800 μL of LB liquid medium was added to the 2 mL centrifuge tube, mixed by blowing with a pipette, and cultured at 260 r / min and 28°C for 2 h. After the time, the bacterial solution was centrifuged at 6000 r / min for 1 min, the supernatant was discarded, and the bacterial body was resuspended with 50 μL of LB liquid medium. After resuspension, it was plated on LB solid medium containing 50 mg / L kanamycin, and incubated at 28°C for 2 days. After the bacterial colonies grew, the colonies were picked and subjected to PCR verification using primers ID-CsC3'H-F (sequence shown in SEQ ID NO. 5) and ID-CsC3'H-R (sequence shown in SEQ ID NO. 6) and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q). The amplification system was configured according to the attached instructions of high-fidelity enzyme PrimeSTAR Max DNA Polymerase, and the PCR amplification conditions were as follows: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0051] The PCR amplification product was subjected to agarose gel electrophoresis, and the colony with correct band size was the positive clone containing the overexpression vector pLGNe-CsC3'H.

[0052] SEQ ID NO. 5: TCGTTGAAGATGCCTCTGCCGACAG;

[0053] SEQ ID NO. 6: CATATCAGCGGCCACACG.

[0054] Example 4: Transient conversion of the CsC3'H overexpression vector pLGNe-CsC3'H

[0055] 4.1 Agrobacterium infection:

[0056] Select late-ripening orange fruits of uniform growth and sterilize them with 75% alcohol in a clean bench for later use. Add 500 μL of Agrobacterium tumefaciens containing pLGNe and pLGNe-CsC3'H plasmids to 50 mL of liquid LB medium (containing 50 mg / L kanamycin) and incubate at 28℃ and 200 rpm until OD500. 600 =0.5. Centrifuge and collect the precipitate. Resuspend Agrobacterium in 1 / 2 MS liquid medium. Then, randomly select four injection points on the diagonal of the equatorial plane of the sterilized Late Jin Orange fruit and mark them. Inject the Agrobacterium resuspension containing pLGNe-CsC3'H plasmid into the peel of the Late Jin Orange using a 1 mL syringe. Inject 1 mL into each area, and record them as the experimental group (pLGNe-CsC3'H-1, pLGNe-CsC3'H-2, pLGNe-CsC3'H-3). The Late Jin Orange fruit injected with the same method and the same amount of Agrobacterium resuspension containing pLGNe plasmid is the control group (pLGNe). The experimental group and the control group are repeated three times. The Late Jin Orange fruit injected with Agrobacterium resuspension are placed in a 28℃ incubator and incubated in the dark for 5 days. The fruit photos on the day of transient transformation and after 5 days of incubation are shown below. Figure 4 As shown.

[0057] 4.2 qRT-PCR analysis of transiently transformed late-ripening orange fruits:

[0058] Total RNA (Adelai, CAT No: RN09) was extracted from the peel of the injected area of ​​*Citrus reticulata* var. *mairei* (Citrus reticulata) cultured in the dark at 28℃ for 5 days in section 4.1. cDNA was synthesized using the PrimeScript RT Master Mix reverse transcription kit (TaKaRa, CAT: RR036A), and the expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsC3'HF (SEQ ID NO.7) and RT-CsC3'HR (SEQ ID NO.8). Two... -△△Ct The relative expression level of the CsC3'H gene in the experimental and control groups of late-ripening oranges was calculated as follows: the control group sample was defined as the reference factor, i.e., its CsC3'H expression level was 1. Then, the fold increase in gene expression in the experimental group sample relative to the reference factor was calculated as 2. -△△Ct , which is its relative expression level. The results are as follows: Figure 5 As shown, the expression level of the CsC3'H gene in the experimental group was significantly higher than that in the control group, with the highest level being more than 8 times that of the control.

[0059] qRT-PCR reaction condition: 95℃ 3min, 94℃ 10s; 56℃ 10s, 72℃ 10s, 40 cycles; 72℃ 10min.

[0060] SEQ ID NO. 7: TAATGGGCTGAAGCTTGGGG;

[0061] SEQ ID NO. 8: GCTCGAGTAAGACGGTCTCG.

[0062] Example 5: Determination of contents of narirutin, hesperidin and / or luteolin in fruits

[0063] The contents of narirutin, hesperidin and / or luteolin in the peels of the fruits of the experimental group and the control group after transient transformation for 5 days were determined by UPLC-MS. The statistical results are shown in Table 2. Figure 6 As shown in Table 2, compared with the control fruits of transient transformation pLGNe, the contents of narirutin, hesperidin and / or luteolin in the peels of the fruits of transient transformation pLGNe-CsC3'H increased by 66.34%-69.38%, 9.36%-9.49% and 44.95%-46.89% respectively, indicating that transient overexpression of CsC3'H gene can significantly increase the contents of narirutin, hesperidin and / or luteolin in the fruits of late-jasmine orange.

[0064] Therefore, it is firstly found in the present application that the expression amount of CsC3'H gene is positively correlated with the contents of narirutin, hesperidin and / or luteolin in citrus, and the higher the expression amount of CsC3'H gene is, the higher the contents of narirutin, hesperidin and / or luteolin in the peel of citrus are. In the experiment, the highest content of the fruits of citrus transiently transformed with CsC3'H gene overexpression vector is 69.38% higher than that of the fruits of citrus transformed with empty vector. CsC3'H gene can be used as a candidate gene for breeding new varieties of citrus with high contents of narirutin, hesperidin and / or luteolin, and has important significance for cultivating functional new varieties of citrus by genetic engineering, accelerating the breeding process, reducing the workload of breeding and improving the comprehensive utilization rate of citrus.

[0065] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application but not to limit it. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can still be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present application.

Claims

1. Application of CsC3'H gene in improving content of narirutin, hesperidin and / or icariin, characterized in that: The CDS sequence of the CsC3'H gene is shown as SEQ ID NO. 1, and the protein sequence encoded by the CsC3'H gene is shown as SEQ ID NO.

2.

2. The use of the CsC3'H gene according to claim 1 for increasing the content of narirutin, hesperidin and / or luteolin in citrus, characterized in that: The CsC3'H gene is overexpressed in citrus to increase the content of naringin, hesperidin and / or jaceosidin in the citrus peel.

3. The use of the CsC3'H gene according to claim 1 for increasing the content of narirutin, hesperidin and / or luteolin in citrus, characterized in that: The expression amount of the CsC3'H gene is positively correlated with the content of naringin, hesperidin and / or jaceosidin in the citrus peel.

4. Use of the CsC3'H gene in the breeding of citrus varieties, characterized in that: The CDS sequence of the CsC3'H gene is shown as SEQ ID NO. 1, and the protein sequence encoded by the CsC3'H gene is shown as SEQ ID NO.

2.

5. A plant overexpression vector comprising a CsC3'H gene, characterized by: The CDS sequence of the CsC3'H gene is shown as SEQ ID NO. 1, and the protein sequence encoded by the CsC3'H gene is shown as SEQ ID NO.

2.

6. Application of the plant overexpression vector containing the CsC3'H gene according to claim 5 in citrus breeding.

7. A method for breeding citrus fruits with an increased content of naringin, hesperidin and / or jaceosidin in the fruit peel, characterized in that: The CsC3'H gene or the plant overexpression vector containing the CsC3'H gene is introduced into a citrus plant to overexpress the CsC3'H gene in the citrus plant, and a citrus plant with increased content of naringin, hesperidin and / or jaceosidin is obtained through cultivation. The CDS sequence of the CsC3'H gene is shown as SEQ ID NO. 1, and the protein sequence encoded by the CsC3'H gene is shown as SEQ ID NO. 2.

Citation Information

Patent Citations

  • Gene combination for synthesizing natural active substance of sandalwood and application of gene combination

    CN118291500A

  • Two citrus geranyl geranyl diphosphate synthetase coding genes and application thereof

    CN120060296A