Application of CsCHS gene in breeding of new citrus variety
By overexpressing the CsCHS gene, the content of vincain-2, rutin, hesperidin, lemon balm glycoside, and sweet orange flavonoids in citrus peel was increased, solving the problem of low content of citrus components in existing technologies and realizing efficient breeding and comprehensive utilization of new citrus varieties.
Patent Information
- Application Number
- CN202511146448.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-15
- Publication Date
- 2025-11-07
AI Technical Summary
Existing technologies are insufficient to effectively increase the content of vincain-2, rutin, hesperidin, lemon balm glycoside, and sweet orange flavonoids in citrus peel, thus affecting the comprehensive utilization rate and functional development of citrus.
By overexpressing the CsCHS gene, the content of vincain-2, rutin, hesperidin, lemon balm glycoside and/or sweet orange flavonoids in citrus peel was increased, and new citrus varieties with high content were bred using genetic engineering methods.
The expression level of the CsCHS gene is positively correlated with the content of the above-mentioned components in citrus. Overexpression vectors can significantly increase the content of these components in citrus peel, up to 46.7%, thereby accelerating the breeding process and improving the comprehensive utilization rate of citrus.
Smart Images

Figure CN120905286A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of genetic engineering, and particularly relates to application of CsCHS gene in citrus new variety breeding. BACKGROUND
[0002] Citrus is one of the fruit species with large cultivation area and high yield in China. Citrus fruits contain rich nutritional functional components and biologically active secondary metabolites, which not only endow them with unique flavor and health value, but also have significant effects on oxidation resistance, inflammation resistance and cancer resistance. It is known that the substances with important effects such as anti-inflammatory, antioxidant and anti-tumor in citrus include phenolic acids, flavonoids, carotenoids, essential oils, limonin and synephrine.
[0003] Vicenin belongs to flavonoid glycosides, and naringin, hesperidin, melilotoside and sweet orange flavone are typical flavanone glycosides compounds, which have significant biological activities, including: 1) plant stress resistance, which can resist the invasion of pathogenic bacteria and fungi and pests; 2) antioxidant and light protection, which can scavenge intracellular reactive oxygen species (ROS) and excessive free radicals and reduce oxidative damage; 3) anti-inflammatory, which shows anti-inflammatory activity by inhibiting pro-inflammatory cytokines and reducing leukocyte infiltration; 4) cardiovascular protection, studies have shown that the intake of naringin and hesperidin in diet can effectively reduce the risk of cardiovascular disease death in adults; 5) anti-cancer and anti-tumor, studies have shown that the intake of naringin and hesperidin in diet can reduce the risk of breast cancer, lung cancer, colon cancer, prostate cancer and pancreatic cancer; 6) metabolic regulation and anti-obesity: regulating the balance of intestinal flora, inhibiting the growth of pathogenic bacteria, promoting the proliferation of probiotics such as bifidobacteria, and improving the intestinal barrier function.
[0004] Vicenin, naringin, hesperidin, melilotoside and sweet orange flavone are widely distributed in various vegetables and fruits and are used in food processing to reduce the use of synthetic chemicals, improve human health, excavate key enzymes of their biosynthetic pathways and clarify their molecular mechanisms of function, which can provide a theoretical basis for functional citrus molecular breeding with high vicenin, naringin, hesperidin, melilotoside and sweet orange flavone content, and has important significance for improving the comprehensive utilization rate of citrus. SUMMARY
[0005] To solve the above technical problems, the application provides the application of CsCHS gene in citrus new variety breeding, and the content of Vicitexin-2, Rutin, Hesperidin, Melilotoside and / or Tangeritin in citrus peel is improved by overexpressing CsCHS gene, which indicates that CsCHS gene can be used as a candidate gene for breeding citrus new variety with high content of Vicitexin-2, Rutin, Hesperidin, Melilotoside and / or Tangeritin, and functional citrus new variety is bred by using genetic engineering method.
[0006] To achieve the above object, the application provides the application of CsCHS gene in citrus new variety breeding, and the CDS sequence of the CsCHS gene is shown as SEQ ID NO. 1.
[0007] Preferably, the content of Vicitexin-2, Rutin, Hesperidin, Melilotoside and / or Tangeritin in citrus peel is improved by overexpressing CsCHS gene, and citrus new variety with high content of Vicitexin-2, Rutin, Hesperidin, Melilotoside and / or Tangeritin is obtained.
[0008] The application further provides an overexpression vector containing CsCHS gene, and the CDS sequence of the CsCHS gene is shown as SEQ ID NO. 1.
[0009] The application further provides a recombinant strain containing the vector for overexpressing CsCHS gene, and the CDS sequence of the CsCHS gene is shown as SEQ ID NO. 1.
[0010] The application further provides the application of the overexpression vector or the recombinant strain in citrus new variety breeding, and the content of Vicitexin-2, Rutin, Hesperidin, Melilotoside and / or Tangeritin in citrus peel is improved by overexpressing CsCHS gene, and citrus new variety with high content of Vicitexin-2, Rutin, Hesperidin, Melilotoside and / or Tangeritin is obtained.
[0011] The application further provides a breeding method of citrus new variety with high content of Vicitexin-2, Rutin, Hesperidin, Melilotoside and / or Tangeritin, which comprises the following steps: amplifying the CDS sequence of CsCHS gene, constructing the overexpression vector of CsCHS gene, transforming Agrobacterium, and infecting citrus fruit to obtain citrus new variety.
[0012] The CDS sequence of the CsCHS gene is shown as SEQ ID NO. 1.
[0013] The application also provides application of the CsCHS gene in breeding of a new citrus variety with high content of rutin, and the CDS sequence of the CsCHS gene is shown as SEQ ID NO. 1; the content of rutin in the citrus peel is increased by overexpressing the CsCHS gene, and the new citrus variety with high content of rutin is obtained.
[0014] The application also provides application of the CsCHS gene in breeding of a new citrus variety with high content of rutin, and the CDS sequence of the CsCHS gene is shown as SEQ ID NO. 1; the content of rutin in the citrus peel is increased by overexpressing the CsCHS gene, and the new citrus variety with high content of rutin is obtained.
[0015] The application also provides application of the CsCHS gene in breeding of a new citrus variety with high content of rutin, and the CDS sequence of the CsCHS gene is shown as SEQ ID NO. 1; the content of rutin in the citrus peel is increased by overexpressing the CsCHS gene, and the new citrus variety with high content of rutin is obtained.
[0016] The application also provides application of the CsCHS gene in breeding of a new citrus variety with high content of rutin, and the CDS sequence of the CsCHS gene is shown as SEQ ID NO. 1; the content of rutin in the citrus peel is increased by overexpressing the CsCHS gene, and the new citrus variety with high content of rutin is obtained.
[0017] Compared with the prior art, the application has the following advantages and technical effects:
[0018] The application provides application of the CsCHS gene in breeding of a new citrus variety, and the specific technical effects are as follows:
[0019] (1) The application first finds that the expression amount of the CsCHS gene is positively correlated with the contents of vitexin-2, naringin, hesperidin, rutin and / or sweet orange flavone in the citrus, the higher the expression amount of the CsCHS gene is, the higher the contents of vitexin-2, naringin, hesperidin, rutin and / or sweet orange flavone in the citrus peel are, and the citrus transiently transformed with the CsCHS gene overexpression vector is 46.7% higher than the citrus transformed with the empty vector in the experiment;
[0020] (2) The CsCHS gene can be used as a candidate gene for breeding of a new citrus variety with high content of vitexin-2, naringin, hesperidin, rutin and / or sweet orange flavone, and has important significance for cultivating a functional new citrus variety by using a genetic engineering method, accelerating the breeding process, reducing the breeding workload and improving the comprehensive utilization rate of the citrus. BRIEF DESCRIPTION OF DRAWINGS
[0021] In order to make the technical solutions in the embodiments of the present application or the prior art clearer, the accompanying drawings needed in the embodiments will be briefly introduced below. Obviously, the accompanying drawings in the following description only need to be some embodiments of the present application, and other drawings can be obtained by those skilled in the art without any creative effort.
[0022] Figure 1 FIG. 1 is a structural diagram of the CsCHS gene of the late Valencia orange, wherein A is the chromosomal localization of the CsCHS gene, B is the structure of the CsCHS gene, and C is the conserved domain of the CsCHS gene;
[0023] Figure 2 FIG. 2 is an agarose gel electrophoresis result diagram of the CDS sequence of the CsCHS gene, wherein M represents Marker, and CDS represents the CDS sequence of the CsCHS gene;
[0024] Figure 3 FIG. 3 is a structural diagram of the overexpression vector pLGNe-CsCHS of the CsCHS gene;
[0025] Figure 4 FIG. 4 is a photograph of the late Valencia orange fruit of the experimental group and the control group on the day of transient transformation and after 5 days of culture, wherein A is a photograph of the late Valencia orange fruit of the control group and the experimental group on the day of transient transformation, B is a photograph of the late Valencia orange fruit of the control group and the experimental group after 5 days of culture, and C is a photograph of part of the samples when total RNA of the late Valencia orange fruit of the control group and the experimental group after 5 days of culture is extracted, wherein pLGNe represents the control group, and pLGNe-CsCHS-1, pLGNe-CsCHS-2 and pLGNe-CsCHS-3 represent the experimental group;
[0026] Figure 5 FIG. 5 is the expression amount of the CsCHS gene in the fruit peel of the injection area of the late Valencia orange of the experimental group and the control group after 5 days of culture, wherein pLGNe represents the control group, pLGNe-CsCHS-1, pLGNe-CsCHS-2 and pLGNe-CsCHS-3 represent the experimental group, and P<0.0001 represents the significant difference analysis;
[0027] Figure 6 FIG. 6 is a result diagram of the content detection of Vp-2, rutacultin, hesperidin, jaceosidin and sweet orange flavonoids in the fruit peel of the injection area of the late Valencia orange of the experimental group and the control group after 5 days of culture, wherein A is a result diagram of the content detection of Vp-2, B is a result diagram of the content detection of rutacultin, C is a result diagram of the content detection of hesperidin, D is a result diagram of the content detection of jaceosidin, and E is a result diagram of the content detection of sweet orange flavonoids, wherein pLGNe represents the control group, pLGNe-CsCHS-1, pLGNe-CsCHS-2 and pLGNe-CsCHS-3 represent the experimental group, P<0.0001 and P<0.0002 represent the significant difference analysis.
[0028] Figure 7 Structural formula of Vicenin-2, Rutin, Hesperidin, Melilotoside and Tangeritin, wherein A is Vicenin-2, B is Rutin, C is Hesperidin, D is Melilotoside, and E is Tangeritin. DETAILED DESCRIPTION
[0029] The following detailed description of various example embodiments of the application is not to be considered limiting of the scope or spirit of the application, but rather as a description of certain aspects, features and embodiments of the application.
[0030] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. Additionally, the use of "including", "comprising", "having" and "with" are not intended to be limiting of the application. It is to be understood that the specific numerical ranges recited herein are meant to be specific examples only and are not intended to be limiting of the application. Each minimum and maximum numerical limit that is set forth in any statement of a range is included in the range itself, and each intermediate range that falls between the recited ranges is also included in the range. The upper and lower limits of these smaller ranges can independently be included or excluded in the range.
[0031] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict between the present specification and any document incorporated by reference, the present specification will control.
[0032] Various modifications and changes can be made to the specific embodiments of the application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples presented herein. The description and examples are illustrative of the application and are not intended to limit the scope of the application.
[0033] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having" and the like are open-ended and do not exclude additional elements or steps.
[0034] Source of the materials used in the present application: Late Jin Orange is a late-maturing Jin Orange elite line developed from common Jin Orange by the Institute of Citrus, Chinese Academy of Agricultural Sciences, and the variety approval number is YuShen Citrus 2011001.
[0035] Example 1
[0036] I. Bioinformatics analysis of CsCHS gene
[0037] The structure of the CsCHS gene of the late Valencia orange is as shown in Figure 1 The CsCHS gene of the late Valencia orange is located between 6186119bp and 6187901bp of chromosome 3 of the late Valencia orange, with a chromosome version number of Citrus sinensis v3.0, contains 1 intron and 2 exons, and encodes 396 amino acids. The CDS sequence of the CsCHS gene is shown as SEQ ID NO. 1.
[0038]
[0039] II. Cloning of CDS sequence of CsCHS gene
[0040] 1. RNA extraction and cDNA synthesis:
[0041] Total RNA was extracted from leaves of Citrus sinensis cv. Valencia by using plant total RNA extraction kit (Aidley, CAT: RN09). The quality of the obtained RNA was verified by agarose gel electrophoresis, and the concentration of the obtained RNA was determined by using a concentration meter. Then, cDNA was synthesized by using reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT: RR036A) according to the attached instructions.
[0042] 2. Amplification of CDS sequence of CsCHS gene
[0043] The primer OE-CsCHS-F (SEQ ID NO. 2), the primer OE-CsCHS-R (SEQ ID NO. 3) and the high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q) were used to amplify the CDS sequence of CsCHS gene, with the obtained cDNA of Citrus sinensis cv. Valencia as the template. The amplification system was prepared according to the attached instructions of the high-fidelity enzyme PrimeSTAR Max DNA Polymerase, and the PCR amplification program was as follows: 98°C, 5 min; 98°C, 30 s, 56°C, 30 s, 72°C, 1.5 min, 35 cycles; 72°C, 10 min. The DNA fragment of the CDS sequence of CsCHS gene was obtained by amplification, and the length of the fragment was 1197 bp (CDS sequence 1188 bp - terminator 3 bp + 12 bp of enzyme cutting sites before and after).
[0044] Nucleotide sequence of primer OE-CsCHS-F SEQ ID NO. 2: GGTACCATGGAGAAAGTTAAAGATGGGAAGAAC.
[0045] Nucleotide sequence of primer OE-CsCHS-R SEQ ID NO. 3: GAATTCGGCTGTAACAGTAGGGAA GGG.
[0046] The results of agarose gel electrophoresis are shown in Figure 2 The size of the amplified fragment was consistent with the expectation. Under the ultraviolet lamp, the agarose gel block containing the target fragment was cut off by using a clean blade, and the DNA fragment was recovered by using a kit (BioFlux, CAT: BSC02M1). Part of the recovered product was sent to a company for sequencing, and the sequencing results were analyzed by comparison. It was determined that the obtained DNA fragment was the CDS sequence of CsCHS gene of Citrus sinensis (SEQ ID NO. 1).
[0047] III. Constructing the overexpression vector of CsCHS gene and transforming Agrobacterium.
[0048] 1. Constructing the overexpression vector of CsCHS gene:
[0049] The obtained recovered DNA fragment is the CDS sequence of the CsCHS gene of the late-kumquat and the overexpression vector pLGNe is double enzyme cut by restriction endonuclease Kpn I and Eco R I (Thermo Fisher) and then gel recovery is performed, and the enzyme cutting system and reaction conditions are prepared according to the attached instructions, and the connection adopts T4 DNA Ligase kit (Promega, CAT: M1801), and the connection system and reaction conditions are prepared according to the attached instructions of T4 DNA Ligase kit.
[0050] The obtained connection product is transformed into Escherichia coli DH5a, and the transformation method adopts the method recorded in the attached instructions of Escherichia coli DH5a (purchased from Weidi Biology). The plasmid of the positive clone is extracted by using the plasmid extraction kit (Omega, CAT: D6942) to obtain the overexpression vector pLGNe-CsCHS of the CsCHS gene.
[0051] As shown in Figure 3 , it is the structure of the overexpression vector pLGNe-CsCHS of the CsCHS gene.
[0052] 2. Transforming Agrobacterium with the overexpression vector of CsCHS gene:
[0053] The obtained overexpression vector pLGNe-CsCHS was introduced into Agrobacterium tumefaciens EHA105 by heat shock method, and the specific steps were as follows: 2 mL centrifuge tube containing frozen Agrobacterium competent cells EHA105 (50 μL) was thawed on ice; 2 μL overexpression vector plasmid was added to the competent cells, and the mixture was mixed by blowing and then placed on ice for 5 min, frozen in liquid nitrogen for 5 min, incubated at 37℃ for 5 min, and placed on ice for 5 min. Then 800 μL LB liquid medium was added to the 2 mL centrifuge tube, mixed by blowing with a pipette, and cultured at 260 r / min, 28℃ on a shaking table for 2 h. After the time, the bacterial solution was centrifuged at 6000 r / min for 1 min, the supernatant was discarded, and the bacterial body was resuspended with 50 μL LB liquid medium. After resuspension, it was spread on LB solid medium containing 50 mg / L kanamycin, and cultured at 28℃ in the dark for 2 days; after the bacterial colonies grew, the colonies were picked and PCR verification was performed on single colonies using primers ID-CsCHS-F (SEQ ID NO. 4), primer ID-CsCHS-R (SEQ ID NO. 5) and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q). The amplification system was prepared according to the instructions of high-fidelity enzyme PrimeSTAR Max DNA Polymerase, and the PCR amplification conditions were as follows: 94℃ for 3 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ for 10 min.
[0054] The nucleotide sequence of primer ID-CsCHS-F is SEQ ID NO. 4: TCGTTGAAGATGCCTCTGCCGACAG.
[0055] The nucleotide sequence of primer ID-CsCHS-R is SEQ ID NO. 5: GGCTGTAACAGTAGGGAAGGGAAAGC.
[0056] The PCR amplification product was subjected to agarose gel electrophoresis, and the colonies with correct band size were positive clones containing the overexpression vector pLGNe-CsCHS.
[0057] Four, transient transformation of the overexpression vector pLGNe-CsCHS of CsCHS gene
[0058] 1. Agrobacterium infection:
[0059] Select late-kumquat fruits with consistent growth state, sterilize with 75% ethanol aqueous solution in a clean bench; 500 μL Agrobacterium liquid containing pLGNe and pLGNe-CsCHS plasmid was added to 50 mL liquid LB medium (containing 50 mg / L kanamycin), and cultured at 28℃, 200 r / min until OD600 = 0.5. The precipitate was collected by centrifugation, and the Agrobacterium was resuspended in 1 / 2MS liquid medium. Then, four injection points were randomly selected on the diagonal line of the equatorial surface of the disinfected Citrus sinensis fruit, and marked. The Agrobacterium containing the pLGNe-CsCHS plasmid was injected into the fruit peel using a 1 mL syringe, 1 mL per region, and recorded as the experimental group. The same method was used to inject the same amount of Agrobacterium containing the pLGNe plasmid into the fruit peel of the control group. The experimental group and the control group were each repeated three times, and the Agrobacterium-injected fruit was placed in a 28°C incubator in the dark for 5 days.
[0060] As shown in FIG. 1, the photographs of the experimental group and the control group of Citrus sinensis fruit were taken on the day of transient transformation and after 5 days of culture, Figure 4 Figure 4 FIG. 1A shows the photographs of the control group (pLGNe) and the experimental group (pLGNe-CsCHS-1, pLGNe-CsCHS-2, and pLGNe-CsCHS-3) of Citrus sinensis fruit on the day of transient transformation, Figure 4 Figure 4 FIG. 1B shows the photographs of the control group (pLGNe) and the experimental group (pLGNe-CsCHS-1, pLGNe-CsCHS-2, and pLGNe-CsCHS-3) of Citrus sinensis fruit after 5 days of culture,
[0061] 2. qRT-PCR analysis of the transiently transformed Citrus sinensis fruit:
[0062] The total RNA of the injected region of the fruit of the experimental group and the control group was extracted after 5 days of culture in a 28°C incubator in the dark (Aidley, CAT No: RN09). The cDNA was synthesized using the reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT: RR036A), and the expression level of the target gene was detected by qRT-PCR. The detection primers were primer RT-CsCHS-F (SEQ ID NO. 6) and primer RT-CsCHS-R (SEQ ID NO. 7).
[0063] The qRT-PCR reaction conditions were as follows: 95°C for 3 min, 94°C for 10 s, 56°C for 10 s, 72°C for 10 s, 40 cycles, and 72°C for 10 min.
[0064] The nucleotide sequence of primer RT-CsCHS-F is SEQ ID NO. 6: GGCCTCAACCCATCTGTCAA.
[0065] The nucleotide sequence of primer RT-CsCHS-R is SEQ ID NO. 7: AGCATACGACTAGAACGCGG.
[0066] Using 2 -△△Ct The relative expression of CsCHS gene in the experimental group and the control group was calculated: the sample of the control group was defined as the reference factor, and the expression level of CsCHS was 1, and then the relative expression of the sample in the experimental group was calculated2 -△△Ct .
[0067] The results are shown in Figure 5 The expression of CsCHS gene in the experimental group (pLGNe-CsCHS-1, pLGNe-CsCHS-2 and pLGNe-CsCHS-3) was significantly higher than that in the control group (pLGNe), and the highest was more than 6 times of the control.
[0068] V. Determination of the contents of Vincetoxin-2, Rutin, Hesperidin, Melilotoside and Sweet Orange Flavonoid in the fruits of the experimental group and the control group.
[0069] The contents of Vincetoxin-2, Rutin, Hesperidin, Melilotoside and Sweet Orange Flavonoid in the fruit peels of the experimental group and the control group after 5 days of culture in a 28℃ incubator in the dark were determined by UPLC-MS, and the results are shown in Figure 7 A, Figure 7 B, Figure 7 C, Figure 7 D and Figure 7 E.
[0070] The results are shown in Figure 6 A, Figure 6 B, Figure 6 C, Figure 6 D and Figure 6 E. Compared with the fruits of the control group transiently transformed with pLGNe, the contents of Vincetoxin-2, Rutin, Hesperidin, Melilotoside and Sweet Orange Flavonoid in the fruit peels of the fruits of the experimental group transiently transformed with pLGNe-CsCHS were increased by 3.48%~21.11%, 12.01%~46.74%, 9.30%~11.60%, 16.51%~41.71% and 17.30%~25.77%, respectively, indicating that the transient overexpression of CsCHS gene can significantly increase the contents of Vincetoxin-2, Rutin, Hesperidin, Melilotoside and Sweet Orange Flavonoid in the fruits of the late Jin orange.
[0071] In summary, the application firstly finds that the expression amount of CsCHS gene is positively correlated with the contents of Vp-2, Rutin, Hesperidin, Luteolin and Sweet Orange Flavonoid in citrus, the higher the expression amount of CsCHS gene is, the higher the contents of Vp-2, Rutin, Hesperidin, Luteolin and Sweet Orange Flavonoid in citrus peel are, the highest content of citrus transiently transformed with CsCHS gene overexpression vector is 46.7% higher than that of citrus transformed with empty vector; CsCHS gene can be used as a candidate gene for breeding new citrus varieties with high contents of Vp-2, Rutin, Hesperidin, Luteolin and Sweet Orange Flavonoid, which has important significance for cultivating functional new citrus varieties by genetic engineering, accelerating breeding process, reducing breeding workload and improving comprehensive utilization rate of citrus.
[0072] The above-described embodiments are only used to describe the preferred modes of the application, and do not limit the scope of the application, and various modifications and improvements to the technical solutions of the application made by those skilled in the art without departing from the design spirit of the application shall fall within the protection scope of the application defined by the claims.
Claims
1. The application of CsCHS gene in breeding of new citrus varieties, characterized in that, The CDS sequence of the CsCHS gene is shown as SEQ ID NO.
1.
2. Use according to claim 1, characterized in that, The CsCHS gene is overexpressed to improve the content of vitamin C, naringin, hesperidin, rutin and / or sweet orange flavonoids in the citrus peel, and a new citrus variety with high content of vitamin C, naringin, hesperidin, rutin and / or sweet orange flavonoids is obtained.
3. An overexpression vector, characterized by, The overexpression vector contains the CsCHS gene, and the CDS sequence of the CsCHS gene is shown as SEQ ID NO.
1.
4. A recombinant bacterial strain, characterized in that, The recombinant strain contains the vector for overexpressing the CsCHS gene, and the CDS sequence of the CsCHS gene is shown as SEQ ID NO.
1.
5. The use of the overexpression vector of claim 3 or the recombinant strain of claim 4 in the breeding of new citrus varieties, characterized in that, The overexpression vector or the recombinant strain overexpresses the CsCHS gene to improve the content of vitamin C, naringin, hesperidin, rutin and / or sweet orange flavonoids in the citrus peel, and a new citrus variety with high content of vitamin C, naringin, hesperidin, rutin and / or sweet orange flavonoids is obtained.
6. A method for breeding a new citrus variety with high content of gossypetin-2, nobiletin, tangeritin, melilotoside and / or sweet orange flavones, characterized in that, The method comprises the following steps: amplifying the CDS sequence of the CsCHS gene, constructing an overexpression vector of the CsCHS gene, transforming Agrobacterium, and infecting citrus fruits to obtain a new citrus variety; The CDS sequence of the CsCHS gene is shown as SEQ ID NO.
1.
7. Application of CsCHS gene in breeding of new citrus varieties with high content of pericomin, characterized in that, The CDS sequence of the CsCHS gene is shown as SEQ ID NO. 1; the CsCHS gene is overexpressed to improve the content of rutin in the citrus peel, and a new citrus variety with high content of rutin is obtained.
8. Application of CsCHS gene in breeding of new citrus varieties with high naringin content, characterized in that, The CDS sequence of the CsCHS gene is shown as SEQ ID NO. 1; The CsCHS gene is overexpressed to improve the content of naringin in the citrus peel, and a new citrus variety with high content of naringin is obtained.
9. Use of CsCHS gene in breeding of new citrus varieties with high flavonoid content, characterized in that, The CDS sequence of the CsCHS gene is shown as SEQ ID NO. 1; The CsCHS gene is overexpressed to improve the content of sweet orange flavonoids in the citrus peel, and a new citrus variety with high content of sweet orange flavonoids is obtained.
10. Use of CsCHS gene for increasing the content of Vitisin-2, Narirutin, Hesperidin, Melilotoside and Sweet Orange Flavonoid in citrus pericarp, characterized in that, The CDS sequence of the CsCHS gene is shown as SEQ ID NO. 1; the CsCHS gene is overexpressed to improve the content of vitamin C, naringin, hesperidin, rutin and / or sweet orange flavonoids in the citrus peel.