Application of CsCOMT1 gene in breeding of new citrus variety

Abstract

The invention discloses application of a CsCOMT1 gene in breeding of a new citrus variety, belongs to the technical field of genetic engineering, and particularly relates to application of the CsCOMT1 gene in breeding of the new citrus variety, and the CDS sequence of the CsCOMT1 gene is shown as SE Q ID NO.1. The CsCOMT1 gene is over-expressed, so that the content of vicenin-2, narirutin, hesperidin, didymin, sweet orange flavone and / or nobiletin in the citrus peel is increased, and the CsCOMT1 gene can be used as a candidate gene for breeding a new citrus variety with the content of vicenin-2, narirutin, hesperidin, didymin, sweet orange flavone and / or nobiletin; a new functional citrus variety is cultivated by adopting a genetic engineering method.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to application of CsCOMT1 gene in citrus new variety breeding. BACKGROUND

[0002] Citrus is one of the fruit species with large cultivation area and high yield in China. Citrus fruits contain rich nutritional functional components and bioactive secondary metabolites, which not only endow them with unique flavor and health value, but also have significant effects on antioxidant, anti-inflammatory and anticancer. It is known that the substances with important effects of anti-inflammatory, antioxidant and anti-tumor in citrus include phenolic acids, flavonoids, carotenoids, essential oils, limonin and synephrine, etc.

[0003] Vicenin belongs to flavonoid glycosides, naringin, hesperidin and melilotoside are typical flavanone glycosides, and nobiletin and sweet orange flavone belong to polymethoxyflavones, which have significant biological activities, including: 1) plant stress resistance, which can resist pathogenic bacteria, fungi and pests; 2) antioxidant and photoprotection, which can scavenge intracellular reactive oxygen species (ROS) and excessive free radicals and reduce oxidative damage; 3) anti-inflammatory, which can exhibit anti-inflammatory activity by inhibiting pro-inflammatory cytokines and reducing leukocyte infiltration; 4) cardiovascular protection, studies have shown that the intake of naringin and hesperidin in diet can effectively reduce the risk of cardiovascular disease death in adults; 5) anticancer and antitumor, studies have shown that the intake of naringin and hesperidin in diet can reduce the risk of breast cancer, lung cancer, colon cancer, prostate cancer and pancreatic cancer; 6) metabolic regulation and anti-obesity: regulating intestinal flora balance, inhibiting the growth of pathogenic bacteria, promoting the proliferation of probiotics such as bifidobacteria, and improving intestinal barrier function.

[0004] Vicenin, naringin, hesperidin, melilotoside, nobiletin and sweet orange flavone are widely distributed in various vegetables and fruits and are used in food processing to reduce the use of synthetic chemicals, improve human health, excavate key enzymes of their biosynthetic pathways and clarify their molecular mechanisms of function, which can provide a theoretical basis for functional citrus molecular breeding with high vicenin, naringin, hesperidin, melilotoside, nobiletin and sweet orange flavone content, and have important significance for improving the comprehensive utilization rate of citrus. SUMMARY

[0005] To solve the above technical problems, the application provides the application of CsCOMT1 gene in citrus new variety breeding, and the content of Vicitexin-2, Rutin, Hesperidin, Melilotoside, Tangeritin and / or Nobiletin in citrus peel is increased by overexpressing CsCOMT1 gene, so that the CsCOMT1 gene can be used as a candidate gene for breeding citrus new varieties with high content of Vicitexin-2, Rutin, Hesperidin, Melilotoside, Tangeritin and / or Nobiletin, and functional citrus new varieties are bred by using genetic engineering method.

[0006] To achieve the above object, the application provides the application of CsCOMT1 gene in citrus new variety breeding, and the CDS sequence of the CsCOMT1 gene is shown in SEQ ID NO. 1.

[0007] Preferably, the content of Vicitexin-2, Rutin, Hesperidin, Melilotoside, Tangeritin and / or Nobiletin in citrus peel is increased by overexpressing CsCOMT1 gene, and citrus new varieties with high content of Vicitexin-2, Rutin, Hesperidin, Melilotoside, Tangeritin and / or Nobiletin are obtained.

[0008] The application further provides an overexpression vector containing CsCOMT1 gene, and the CDS sequence of the CsCOMT1 gene is shown in SEQ ID NO. 1.

[0009] The application further provides a recombinant strain containing the vector for overexpressing CsCOMT1 gene, and the CDS sequence of the CsCOMT1 gene is shown in SEQ ID NO. 1.

[0010] The application further provides the application of the overexpression vector or the recombinant strain in citrus new variety breeding, and the content of Vicitexin-2, Rutin, Hesperidin, Melilotoside, Tangeritin and / or Nobiletin in citrus peel is increased by overexpressing CsCOMT1 gene, and citrus new varieties with high content of Vicitexin-2, Rutin, Hesperidin, Melilotoside, Tangeritin and / or Nobiletin are obtained.

[0011] The application further provides a breeding method of citrus new varieties with high content of Vicitexin-2, Rutin, Hesperidin, Melilotoside, Tangeritin and / or Nobiletin, which comprises the following steps: amplifying the CDS sequence of CsCOMT1 gene, constructing an overexpression vector of CsCOMT1 gene, transforming Agrobacterium, infecting citrus fruits, and obtaining citrus new varieties; and the CDS sequence of the CsCOMT1 gene is shown in SEQ ID NO. 1.

[0012] The application also provides application of the CsCOMT1 gene in breeding of a new citrus variety with high content of naringin-2, and the CDS sequence of the CsCOMT1 gene is shown as SEQ ID NO. 1; the content of naringin-2 in the citrus peel is increased by overexpression of the CsCOMT1 gene, and the new citrus variety with high content of naringin-2 is obtained.

[0013] The application also provides application of the CsCOMT1 gene in breeding of a new citrus variety with high content of naringin-2, and the CDS sequence of the CsCOMT1 gene is shown as SEQ ID NO. 1; the content of naringin-2 in the citrus peel is increased by overexpression of the CsCOMT1 gene, and the new citrus variety with high content of naringin-2 is obtained.

[0014] The application also provides application of the CsCOMT1 gene in breeding of a new citrus variety with high content of naringin-2, and the CDS sequence of the CsCOMT1 gene is shown as SEQ ID NO. 1; the content of naringin-2 in the citrus peel is increased by overexpression of the CsCOMT1 gene, and the new citrus variety with high content of naringin-2 is obtained.

[0015] The application also provides application of the CsCOMT1 gene in breeding of a new citrus variety with high content of naringin-2, and the CDS sequence of the CsCOMT1 gene is shown as SEQ ID NO. 1; the content of naringin-2 in the citrus peel is increased by overexpression of the CsCOMT1 gene, and the new citrus variety with high content of naringin-2 is obtained.

[0016] Compared with the prior art, the application has the following advantages and technical effects:

[0017] The application provides application of the CsCOMT1 gene in breeding of a new citrus variety, and the specific technical effects are as follows:

[0018] (1) The application first finds that the expression amount of the CsCOMT1 gene is positively correlated with the content of naringin-2, naringin, hesperidin, sweet orange flavone and / or citramarin in the citrus, the higher the expression amount of the CsCOMT1 gene is, the higher the content of naringin-2, naringin, hesperidin, sweet orange flavone and / or citramarin in the citrus peel is, and the citrus transiently transformed with the CsCOMT1 gene overexpression vector is 36.8% higher than the citrus transformed with the empty vector in the experiment;

[0019] (2) The CsCOMT1 gene can be used as a candidate gene for breeding of a new citrus variety with high content of naringin-2, naringin, hesperidin, sweet orange flavone and / or citramarin, and has important significance for cultivating a functional new citrus variety by using a genetic engineering method, accelerating the breeding process, reducing the breeding workload and improving the comprehensive utilization rate of the citrus. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 The diagram shows the structure of the CsCOMT1 gene in Late Orange, where A represents the chromosomal location of the CsCOMT1 gene, B represents the structure of the CsCOMT1 gene, and C represents the conserved domain of the CsCOMT1 gene.

[0022] Figure 2 The image shows the agarose gel electrophoresis results of the amplified CsCOMT1 gene CDS sequence. In the figure, M represents Marker and CDS represents the CsCOMT1 gene CDS sequence.

[0023] Figure 3 The structure of the CsCOMT1 gene overexpression vector pLGNe-CsCOMT1 is shown.

[0024] Figure 4 The images show photos of Late Orange fruits from the experimental and control groups on the day of instantaneous transformation and after 5 days of cultivation. In the images, A is a photo of Late Orange fruits from the control and experimental groups on the day of instantaneous transformation, B is a photo of Late Orange fruits from the control and experimental groups after 5 days of cultivation, and C is a partial sample photo of Late Orange fruits from the control and experimental groups after 5 days of cultivation when total RNA was extracted. In the figures, pLGNe represents the control group, and pLGNeCsCOMT1-1, pLGNeCsCOMT1-2, and pLGNeCsCOMT1-3 represent the experimental group.

[0025] Figure 5 The expression levels of the CsCOMT1 gene in the peel of the late-maturing oranges injected with 5 days of culture were shown in the figure. pLGNe represents the control group, pLGNe-CsCOMT1-1, pLGNe-CsCOMT1-2 and pLGNe-CsCOMT1-3 represent the experimental group, and P = 0.0002, P = 0.0003 and P = 0.0007 represent the significance of the differences.

[0026] Figure 6The content detection results of Vitisin-2, Rutin, Hesperidin, Melilotoside, Sweet Orange Flavonoid and Chuanpigin in the fruit peel of the injection area of the late Jin orange after 5 days of culture for the experimental group and the control group are shown in the figure, wherein A is the content detection result of Vitisin-2, B is the content detection result of Rutin, C is the content detection result of Hesperidin, D is the content detection result of Melilotoside, E is the content detection result of Sweet Orange Flavonoid, and F is the content detection result of Chuanpigin, pLGNe in the figure represents the control group, pLGNe-CsCOMT1-1, pLGNe-CsCOMT1-2 and pLGNe-CsCOMT1-3 represent the experimental group, and P < 0.0001 represents the significant difference analysis;

[0027] Figure 7 The structural formula of Vitisin-2, Rutin, Hesperidin, Melilotoside, Sweet Orange Flavonoid and Chuanpigin is shown in the figure, wherein A is Vitisin-2, B is Rutin, C is Hesperidin, D is Melilotoside, E is Sweet Orange Flavonoid, and F is Chuanpigin. DETAILED DESCRIPTION

[0028] The various exemplary embodiments of the present application will now be described in detail, which should not be considered as limiting the present application, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the present application.

[0029] It should be understood that the terms described in the present application are only for describing the specific embodiments, and are not used to limit the present application. In addition, for the numerical range in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intermediate value in the stated range and any other stated value or intermediate value in the stated range is also included in the present application. The upper limit and the lower limit of these smaller ranges can be independently included or excluded from the range.

[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application pertains. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are concerned. In the case of conflict, the content of this specification will control.

[0031] Various modifications and changes can be made to the specific embodiments of the present application described in the specification without departing from the scope or spirit of the present application, which will be apparent to those skilled in the art. Other embodiments resulting from the specification of the present application will be apparent to those skilled in the art. The specification and examples of the present application are only exemplary.

[0032] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0033] The source of the materials used in this invention: the late-maturing Jincheng orange is a superior late-maturing Jincheng orange strain selected from the common Jincheng orange by the Citrus Research Institute of the Chinese Academy of Agricultural Sciences. The variety approval number is Yu Shen Citrus 2011001.

[0034] Example 1

[0035] I. Bioinformatics analysis of the CsCOMT1 gene.

[0036] The structure of the CsCOMT1 gene in Late Orange is as follows: Figure 1 As shown, the CsCOMT1 gene is located between 29880537bp and 29882648bp on chromosome 8 of Citrus sinensis, chromosome version number Citrus sinensis v3.0, containing 4 introns and 5 exons, encoding 248 amino acids. The CDS sequence of the CsCOMT1 gene is shown in SEQ ID NO.1.

[0037] CDS sequence of CsCOMT1 gene SEQ ID NO. 1: ATGGCGTCCAACGCAGAAGATCAACAAAACCAACAAGGCAGACACCAGGAAGTTGGTCACAAGAGCCTGCTCCAATCCGATGCCCTCTACCAGTATATTCTTGAAACCAGTGTGTACCCAAGAGAGCCTGAATCAATGAAGGAGCTTAGAGAATTGACTGCCAAACATCCATGGAACATTATGACAACGTCGGCAGACGAAGGGCAGTTCTTGAACATGCTGTTGAAGCTGGTCAATGCAAAGAACACAATGGAGATTGGAGTCTACACAGGCTACTCTCTTTTGGCCACTGCCCTTGCCCTTCCTGATGACGGCAAGATTTTGGCCATGGACATCAACAGAGAAAATTATGAATTGGGGCTGCCAGTTATCCAAAAAGCTGGTGTTGCTCACAAGATTGACTTCAGAGAAGGCCCTGCCCTGCCTGTTCTTGACCTGCTGATCCAAGATGAGAAGAACCATGGGTCCTTTGACTTCATATTTGTGGACGCTGATAAGGACAACTACCTAAACTACCACAAGAGGTTGATTGAGTTGGTGAAGGTTGGAGGGGTGATCGGGTACGACAACACCCTATGGAACGGATCCGTCGTGGCACCACCTGATGCTCCCCTTAGGAAGTACGTTAGGTATTACCGAGACTTCGTCTTGGAGCTCAACAAGGCCCTTGCTGCTGACCCCAGGATTGAAATCTGCATGCTCCCCGTTGGCGATGGAGTCACTATCTGCCGTCGGATCAAGTGA.

[0038] II. Cloning CDS sequence of CsCOMT1 gene

[0039] 1. RNA extraction and cDNA synthesis:

[0040] Total RNA of Citrus sinensis leaves was extracted using a total RNA extraction kit (Aidley, CAT: RN09), and the quality of the obtained RNA was verified by agarose gel electrophoresis. The concentration of the obtained RNA was determined using a concentration meter. Then, cDNA was synthesized using a reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT: RR036A) according to the attached instructions.

[0041] 2. Amplification of the CDS sequence of the CsCOMT1 gene:

[0042] The primer OE-CsCOMT1-F (SEQ ID NO. 2), OE-CsCOMT1-R (SEQ ID NO. 3) and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q) were used to amplify the obtained cDNA of Citrus sinensis as a template, and the amplification system was prepared according to the attached instructions of high-fidelity enzyme PrimeSTAR Max DNA Polymerase. The PCR amplification program was as follows: 98°C, 5 min; 98°C, 30 s, 56°C, 30 s, 72°C, 1.5 min, 35 cycles; 72°C, 10 min. The CDS sequence of the CsCOMT1 gene was amplified to obtain a DNA fragment with a length of 753 bp (CDS sequence 744 bp-terminator 3 bp + enzyme cutting sites before and after a total of 12 bp).

[0043] The nucleotide sequence of the primer OE-CsCOMT1-F is SEQ ID NO. 2: GGTACCATGGCGTCCAACGCAGAAG.

[0044] The nucleotide sequence of the primer OE-CsCOMT1-R is SEQ ID NO. 3: GAATTCCTTGATCCGACGGCAGATAGTG.

[0045] The results of agarose gel electrophoresis are shown in Figure 2 The size of the amplified fragment is consistent with the expected results. Under the ultraviolet lamp, the agarose gel block containing the target fragment was cut off using a clean blade, and the DNA fragment was recovered using a kit (BioFlux, CAT: BSC02M1). Part of the recovered product was sent to the company for sequencing, and the sequencing results were analyzed by comparison to determine that the obtained DNA fragment was the CDS sequence of the CsCOMT1 gene of Citrus sinensis (SEQ ID NO. 1).

[0046] III. Construction of the overexpression vector of the CsCOMT1 gene and transformation of Agrobacterium.

[0047] 1. Construction of the overexpression vector of the CsCOMT1 gene:

[0048] The obtained recovered DNA fragment, i.e. the CDS sequence of the CsCOMT1 gene of the late-kumquat, was digested with restriction enzymes Kpnl and EcoRI (Thermo Fisher) and then recovered by gel, and then linked at 16°C for 12h. The enzyme digestion system and reaction conditions were prepared according to the attached instructions. The linkage used T4 DNA Ligase kit (Promega, CAT: M1801), and the linkage system and reaction conditions were prepared according to the attached instructions of T4 DNA Ligase kit.

[0049] The obtained linkage product was transformed into E. coli DH5a, and the transformation method used the method recorded in the attached instructions of E. coli DH5a (purchased from Vige Bio). The plasmid of the positive clone was extracted by using a plasmid extraction kit (Omega, CAT: D6942), and then the overexpression vector pLGNe-CsCOMT1 of the CsCOMT1 gene was obtained.

[0050] As shown in FIG. 1, it is the structure of the overexpression vector pLGNe-CsCOMT1 of the CsCOMT1 gene. Figure 3

[0051] 2. Transformation of the overexpression vector of the CsCOMT1 gene into Agrobacterium:

[0052] ​The obtained overexpression vector pLGNe-CsCOMT1 was introduced into Agrobacterium tumefaciens EHA105 by heat shock method, and the specific steps were as follows: 2 mL centrifuge tube containing frozen Agrobacterium competent cells EHA105 (50 μL) was thawed on ice; 2 μL overexpression vector plasmid was added to the competent cells, and the mixture was mixed by blowing and then placed on ice for 5 min, frozen in liquid nitrogen for 5 min, incubated at 37°C for 5 min, and placed on ice for 5 min. Then 800 μL of LB liquid medium was added to the 2 mL centrifuge tube, mixed by blowing with a pipette, and incubated at 260 r / min and 28°C for 2 h. After the time, the bacterial solution was centrifuged at 6000 r / min for 1 min, the supernatant was discarded, and the bacterial body was resuspended with 50 μL of LB liquid medium. After resuspension, it was spread on LB solid medium containing 50 mg / L kanamycin and incubated at 28°C for 2 days. After the bacterial colonies grew, the colonies were picked and subjected to PCR verification using primers ID-CsCOMT1-F (SEQ ID NO. 4) and ID-CsCOMT1-R (SEQ ID NO. 5) and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q). The amplification system was prepared according to the instructions of high-fidelity enzyme PrimeSTAR Max DNA Polymerase, and the PCR amplification conditions were as follows: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0053] Nucleotide sequence of primer ID-CsCOMT1-F SEQ ID NO. 4: TCGTTGAAGATGCCTCTGCCGACAG.

[0054] Nucleotide sequence of primer ID-CsCOMT1-R SEQ ID NO. 5: CTTGATCCGACGGCAGATAGTG.

[0055] The PCR amplification product was subjected to agarose gel electrophoresis, and the colony with correct band size was the positive clone containing the overexpression vector pLGNe-CsCOMT1.

[0056] Four, transient transformation of CsCOMT1 gene overexpression vector pLGNe-CsCOMT1.

[0057] 1. Agrobacterium infection:

[0058] Select the late Jin orange fruit with consistent growth state, and sterilize with 75% ethanol solution in the clean bench. Add 500 μL of Agrobacterium containing pLGNe and pLGNe-CsCOMT1 plasmid into 50 mL of LB liquid medium (containing 50 mg / L kanamycin) and culture at 28°C, 200 r / min until OD 600 = 0.5. Centrifuge to collect the precipitate, resuspend the Agrobacterium in 1 / 2MS liquid medium, and then randomly select four injection points on the diagonal of the equatorial surface of the sterilized late Jin orange fruit and mark them. Inject 1 mL of Agrobacterium containing pLGNe-CsCOMT1 plasmid into the peel of the late Jin orange fruit using a 1 mL syringe, and inject 1 mL of Agrobacterium containing pLGNe plasmid into the peel of the late Jin orange fruit as a control group. The experimental group and the control group were repeated three times, and the late Jin orange fruits injected with Agrobacterium were placed in a 28°C incubator for dark culture for 5 days.

[0059] As shown in Figure 4 , the photos of the late Jin orange fruits of the experimental group and the control group after transient transformation and 5 days of culture, Figure 4 A is the photo of the late Jin orange fruits of the control group (pLGNe) and the experimental group (pLGNe-CsCOMT1-1, pLGNe-CsCOMT1-2 and pLGNe-CsCOMT1-3) on the day of transient transformation, Figure 4 B is the photo of the late Jin orange fruits of the control group (pLGNe) and the experimental group (pLGNe-CsCOMT1-1, pLGNe-CsCOMT1-2 and pLGNe-CsCOMT1-3) after 5 days of culture, Figure 4 C is the photo of some samples during total RNA extraction.

[0060] 2. qRT-PCR analysis of the transiently transformed late Jin orange fruits:

[0061] Total RNA was extracted from the injected areas of the late Jin orange fruits cultured in a 28°C incubator for 5 days in the dark (Aidley, CAT No: RN09), and cDNA was synthesized using the reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsCOMT1-F (SEQ ID NO. 6) and RT-CsCOMT1-R (SEQ ID NO. 7).

[0062] The qRT-PCR reaction conditions were as follows: 95°C for 3 min, 94°C for 10 s, 56°C for 10 s, 72°C for 10 s, 40 cycles, and 72°C for 10 min.

[0063] The nucleotide sequence of the primer is RT-CsCOMT1-F, SEQ ID NO.6:GCCTGTTCTTGACCTGCTGA.

[0064] The nucleotide sequence of the primer RT-CsCOMT1-R is SEQ ID NO.7:CGATCACCCCTCCAACCTTC.

[0065] Use 2 -△△Ct The relative expression levels of the CsCOMT1 gene in the experimental and control groups of Late Jin oranges were calculated as follows: the control group sample was defined as the reference factor, i.e., its CsCOMT1 expression level was 1. Then, the fold increase in gene expression in the experimental group sample relative to the reference factor was calculated as 2. -△△Ct , which is its relative expression level.

[0066] The results are as follows Figure 5 As shown, the expression level of CsCOMT1 gene in the experimental groups (pLGNe-CsCOMT1-1, pLGNe-CsCOMT1-2 and pLGNe-CsCOMT1-3) was significantly higher than that in the control group (pLGNe), with the highest level being more than 8 times that of the control group.

[0067] V. Determine the content of veselene-2, rutin, hesperidin, lemon balm glycoside, sweet orange flavonoids and tangerin in the fruits of the experimental group and the control group.

[0068] The contents of vincain-2, rutin, hesperidin, lemon balm glycoside, sweet orange flavonoids and tangerin in the fruit peel of the experimental group and the control group after 5 days of dark incubation at 28℃ were determined by UPLC-MS.

[0069] Statistical results are as follows Figure 6 China A Figure 6 B, Figure 6 C, Figure 6 D, Figure 6 China E and Figure 6 As shown in Figure F, compared with the control group fruits transiently transformed with pLGNe, the contents of vincastatin-2, rutin, hesperidin, lemon balm glycoside, sweet orange flavonoids, and quercetin in the peel of the experimental groups pLGNe-CsCOMT1-1, pLGNe-CsCOMT1-2, and pLGNe-CsCOMT1-3 fruits transiently transformed with pLGNe-CsCOMT1 increased by 16.06%–22.16%, 20.98%–24.20%, 5.11%–7.32%, 24.86%–36.84%, 16.78%–25.09%, and 5.49%–9.27%, respectively. This indicates that transient overexpression of the CsCOMT1 gene can significantly increase the contents of vincastatin-2, rutin, hesperidin, lemon balm glycoside, sweet orange flavonoids, and quercetin in the fruit of the late-maturing orange. Figure 7Medicines A, Figure 7 Medicines B, Figure 7 Medicines C, Figure 7 Medicines D, Figure 7 Medicines E and Figure 7 Medicines F are structural formulas of Vescin-2, Rutin, Hesperidin, Melilotoside, Sweet Orange Flavonoid and Chuanpigenin.

[0070] In summary, the present application first discovers that the expression amount of CsCOMT1 gene is positively correlated with the contents of Vescin-2, Rutin, Hesperidin, Melilotoside, Sweet Orange Flavonoid and Chuanpigenin in citrus, the higher the expression amount of CsCOMT1 gene is, the higher the contents of Vescin-2, Rutin, Hesperidin, Melilotoside, Sweet Orange Flavonoid and Chuanpigenin in citrus peel are, the citrus transiently transformed with CsCOMT1 gene overexpression vector in the experiment is 36.8% higher than that of the citrus transformed with empty vector; CsCOMT1 gene can be used as a candidate gene for breeding new citrus varieties with high contents of Vescin-2, Rutin, Hesperidin, Melilotoside, Sweet Orange Flavonoid and Chuanpigenin, which has important significance for cultivating functional new citrus varieties by using genetic engineering method, speeding up the breeding process, reducing the workload of breeding and improving the comprehensive utilization rate of citrus.

[0071] The above-described embodiments are merely preferred modes of the present application, and do not limit the scope of the present application, and various modifications and improvements to the technical solutions of the present application made by those skilled in the art without departing from the design spirit of the present application shall fall within the protection scope of the present application defined by the claims.

Claims

1. Application of CsCOMT1 gene in breeding of new citrus varieties, characterized in that, The CDS sequence of the CsCOMT1 gene is shown as SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, The content of the Vescin-2, Rutin, Hesperidin, Melilotoside, Sweet Orange Flavonoid and / or Kaempferol in the citrus peel is improved by overexpressing the CsCOMT1 gene, and a new citrus variety with high content of Vescin-2, Rutin, Hesperidin, Melilotoside, Sweet Orange Flavonoid and / or Kaempferol is obtained.

3. An overexpression vector, characterized by, The overexpression vector contains the CsCOMT1 gene, and the CDS sequence of the CsCOMT1 gene is shown as SEQ ID NO.

1.

4. A recombinant bacterial strain, characterized in that, The recombinant strain contains the vector for overexpressing the CsCOMT1 gene, and the CDS sequence of the CsCOMT1 gene is shown as SEQ ID NO.

1.

5. The use of the overexpression vector of claim 3 or the recombinant strain of claim 4 in the breeding of new citrus varieties, characterized in that, The overexpression vector or the recombinant strain improves the content of Vescin-2, Rutin, Hesperidin, Melilotoside, Sweet Orange Flavonoid and / or Kaempferol in the citrus peel by overexpressing the CsCOMT1 gene, and a new citrus variety with high content of Vescin-2, Rutin, Hesperidin, Melilotoside, Sweet Orange Flavonoid and / or Kaempferol is obtained.

6. A method for breeding a new citrus variety with high content of gossypitrin-2, narirutin, hesperidin, melilotoside, sweet orange flavonoids and / or kaempferitrin, characterized in that, The method comprises the following steps: amplifying the CDS sequence of the CsCOMT1 gene, constructing the overexpression vector of the CsCOMT1 gene, transforming Agrobacterium, and infecting the citrus fruit to obtain a new citrus variety; The CDS sequence of the CsCOMT1 gene is shown as SEQ ID NO.

1.

7. Application of CsCOMT1 gene in breeding of new citrus varieties with high content of homoeriodictyol-2, characterized in that, The CDS sequence of the CsCOMT1 gene is shown as SEQ ID NO. 1; the content of Vescin-2 in the citrus peel is improved by overexpressing the CsCOMT1 gene, and a new citrus variety with high content of Vescin-2 is obtained.

8. Application of CsCOMT1 gene in breeding of new citrus varieties with high naringin content, characterized in that, The CDS sequence of the CsCOMT1 gene is shown as SEQ ID NO. 1; the content of Rutin in the citrus peel is improved by overexpressing the CsCOMT1 gene, and a new citrus variety with high content of Rutin is obtained.

9. Application of CsCOMT1 gene in breeding of new citrus varieties with high content of pericomin, characterized in that, The CDS sequence of the CsCOMT1 gene is shown as SEQ ID NO. 1; the content of Melilotoside in the citrus peel is improved by overexpressing the CsCOMT1 gene, and a new citrus variety with high content of Melilotoside is obtained.

10. Application of CsCOMT1 gene in increasing contents of Vitisin-2, nobiletin, hesperidin and jaceosidin in citrus pericarp, characterized in that, The CDS sequence of the CsCOMT1 gene is shown as SEQ ID NO. 1; the content of Vescin-2, Rutin, Hesperidin and Melilotoside in the citrus peel is improved by overexpressing the CsCOMT1 gene.

Images