Application of CsCOMT2 gene in breeding of new citrus variety
By overexpressing the CsCOMT2 gene in citrus, the content of vincain-2, rutin, hesperidin, and lemon balm glycosides was increased, solving the problem of low component content in citrus breeding and achieving efficient breeding of new citrus varieties.
Patent Information
- Application Number
- CN202511146455.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-15
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2045-08-15
AI Technical Summary
Existing technologies are insufficient to effectively increase the content of vesenazoline-2, rutin, hesperidin and lemon balm in citrus peel, thus limiting the comprehensive utilization rate of citrus and the progress of functional breeding.
By overexpressing the CsCOMT2 gene, an overexpression vector was constructed using genetic engineering methods and transformed into Agrobacterium tumefaciens to infect citrus fruits, thereby increasing the content of vincain-2, rutin, hesperidin and/or lemon balm glycoside in citrus peel.
It significantly increases the content of vincain-2, rutin, hesperidin and lemon balm in citrus peel, up to 51.7%, accelerating the breeding process and improving the comprehensive utilization rate of citrus.
Smart Images

Figure CN120905289A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of genetic engineering, and particularly relates to application of CsCOMT2 gene in citrus new variety breeding. BACKGROUND
[0002] Citrus is one of the fruit species with large cultivation area and high yield in China. Citrus fruits contain rich nutritional functional components and bioactive secondary metabolites, which not only endow them with unique flavor and health value, but also have significant effects on oxidation resistance, inflammation resistance and cancer resistance. It is known that the substances with important effects such as anti-inflammatory, antioxidant and anti-tumor in citrus include phenolic acids, flavonoids, carotenoids, essential oils, limonin and synephrine.
[0003] Vicenin belongs to flavonoid glycosides in flavonoids, naringin, hesperidin and melilotoside are typical flavanone glycosides compounds, which have significant biological activities, including: 1) plant stress resistance, which can resist the invasion of pathogens such as bacteria and fungi and pests; 2) antioxidant and light protection, which can scavenge intracellular reactive oxygen species (ROS) and excessive free radicals and reduce oxidative damage; 3) anti-inflammatory, which shows anti-inflammatory activity by inhibiting pro-inflammatory cytokines and reducing leukocyte infiltration; 4) cardiovascular protection, studies have shown that the intake of naringin and hesperidin in diet can effectively reduce the risk of cardiovascular disease death in adults; 5) anticancer and antitumor, studies have shown that the intake of naringin and hesperidin in diet can reduce the risk of breast cancer, lung cancer, colon cancer, prostate cancer and pancreatic cancer; 6) metabolic regulation and anti-obesity: regulating intestinal flora balance, inhibiting the growth of pathogenic bacteria, promoting the proliferation of probiotics such as bifidobacteria, and improving intestinal barrier function.
[0004] Vicenin, naringin, hesperidin and melilotoside are widely distributed in various vegetables and fruits and are used in food processing to reduce the use of synthetic chemicals, improve human health, excavate key enzymes in their biosynthetic pathways and clarify their molecular mechanisms of function, which can provide a theoretical basis for functional citrus molecular breeding with high vicenin, naringin, hesperidin and melilotoside content and have important significance for improving the comprehensive utilization rate of citrus. SUMMARY
[0005] To solve the above technical problems, the application provides the application of the CsCOMT2 gene in citrus new variety breeding, and the content of Vitisin-2, Rutin, Hesperidin and / or Melilotoside in citrus peel is increased by overexpressing the CsCOMT2 gene, so that the CsCOMT2 gene can be used as a candidate gene for breeding citrus new varieties with high Vitisin-2, Rutin, Hesperidin and / or Melilotoside content, and functional citrus new varieties are bred by using a genetic engineering method.
[0006] To achieve the above object, the application provides the application of the CsCOMT2 gene in citrus new variety breeding, and the CDS sequence of the CsCOMT2 gene is shown in SEQ ID NO. 1.
[0007] Preferably, the content of Vitisin-2, Rutin, Hesperidin and / or Melilotoside in citrus peel is increased by overexpressing the CsCOMT2 gene, and citrus new varieties with high Vitisin-2, Rutin, Hesperidin and / or Melilotoside content are obtained.
[0008] The application further provides an overexpression vector containing the CsCOMT2 gene, and the CDS sequence of the CsCOMT2 gene is shown in SEQ ID NO. 1.
[0009] The application further provides a recombinant strain containing the vector for overexpressing the CsCOMT2 gene, and the CDS sequence of the CsCOMT2 gene is shown in SEQ ID NO. 1.
[0010] The application further provides the application of the overexpression vector or the recombinant strain in citrus new variety breeding, and the content of Vitisin-2, Rutin, Hesperidin and / or Melilotoside in citrus peel is increased by overexpressing the CsCOMT2 gene in the overexpression vector or the recombinant strain, so that citrus new varieties with high Vitisin-2, Rutin, Hesperidin and / or Melilotoside content are obtained.
[0011] The application further provides a breeding method of citrus new varieties with high Vitisin-2, Rutin, Hesperidin and / or Melilotoside content, which comprises the following steps: amplifying the CDS sequence of the CsCOMT2 gene, constructing an overexpression vector of the CsCOMT2 gene, transforming Agrobacterium, infecting citrus fruits, and obtaining citrus new varieties; and the CDS sequence of the CsCOMT2 gene is shown in SEQ ID NO. 1.
[0012] The application also provides application of the CsCOMT2 gene in breeding of a new citrus variety with high content of rutin, and the CDS sequence of the CsCOMT2 gene is shown as SEQ ID NO. 1; the content of rutin in the citrus peel is increased by overexpressing the CsCOMT2 gene, and the new citrus variety with high content of rutin is obtained.
[0013] The application also provides application of the CsCOMT2 gene in breeding of a new citrus variety with high content of rutin, and the CDS sequence of the CsCOMT2 gene is shown as SEQ ID NO. 1; the content of rutin in the citrus peel is increased by overexpressing the CsCOMT2 gene, and the new citrus variety with high content of rutin is obtained.
[0014] The application also provides application of the CsCOMT2 gene in breeding of a new citrus variety with high content of rutin, and the CDS sequence of the CsCOMT2 gene is shown as SEQ ID NO. 1; the content of rutin in the citrus peel is increased by overexpressing the CsCOMT2 gene, and the new citrus variety with high content of rutin is obtained.
[0015] The application also provides application of the CsCOMT2 gene in breeding of a new citrus variety with high content of rutin, and the CDS sequence of the CsCOMT2 gene is shown as SEQ ID NO. 1; the content of rutin in the citrus peel is increased by overexpressing the CsCOMT2 gene, and the new citrus variety with high content of rutin is obtained.
[0016] Compared with the prior art, the application has the following advantages and technical effects:
[0017] The application provides application of the CsCOMT2 gene in breeding of a new citrus variety, and the specific technical effects are as follows:
[0018] (1) The application first finds that the expression amount of the CsCOMT2 gene is positively correlated with the contents of vitexin-2, rutin, hesperidin and / or tricin in the citrus, the higher the expression amount of the CsCOMT2 gene is, the higher the contents of vitexin-2, rutin, hesperidin and / or tricin in the citrus peel are, and the citrus transiently transformed with the CsCOMT2 gene overexpression vector is 51.7% higher than the citrus transformed with the empty vector in the experiment;
[0019] (2) The CsCOMT2 gene can be used as a candidate gene for breeding of a new citrus variety with high content of vitexin-2, rutin, hesperidin and / or tricin, and has important significance for cultivating a functional new citrus variety by using a genetic engineering method, accelerating the breeding process, reducing the breeding workload and improving the comprehensive utilization rate of the citrus. BRIEF DESCRIPTION OF DRAWINGS
[0020] In order to make the technical solutions in the embodiments of the present application or the prior art clearer, the accompanying drawings needed in the embodiments will be briefly introduced below. Obviously, the accompanying drawings in the following description only need to be some embodiments of the present application, and other drawings can be obtained by those skilled in the art without any creative effort on the basis of these drawings.
[0021] Figure 1 Figure 4 is a structural diagram of the CsCOMT2 gene of the late Valencia orange, wherein A is the chromosomal localization of the CsCOMT2 gene, B is the structure of the CsCOMT2 gene, and C is the conserved domain of the CsCOMT2 gene;
[0022] Figure 2 Figure 5 is a result diagram of agarose gel electrophoresis of the amplified CDS sequence of the CsCOMT2 gene, wherein M represents Marker, and CDS represents the CDS sequence of the CsCOMT2 gene;
[0023] Figure 3 Figure 6 is a structural diagram of the overexpression vector pLGNe-CsCOMT2 of the CsCOMT2 gene;
[0024] Figure 4 Figure 7 is a photograph of the late Valencia orange fruit of the experimental group and the control group on the day of transient transformation and after 5 days of culture, wherein A is a photograph of the late Valencia orange fruit of the control group and the experimental group on the day of transient transformation, B is a photograph of the late Valencia orange fruit of the control group and the experimental group after 5 days of culture, and C is a photograph of part of the samples when total RNA was extracted from the late Valencia orange fruit of the control group and the experimental group after 5 days of culture, wherein pLGNe represents the control group, and pLGNe-CsCOMT2-1, pLGNe-CsCOMT2-2 and pLGNe-CsCOMT2-3 represent the experimental group;
[0025] Figure 5 Figure 8 is the expression amount of the CsCOMT2 gene in the fruit peel of the injection area of the late Valencia orange of the experimental group and the control group after 5 days of culture, wherein pLGNe represents the control group, pLGNe-CsCOMT2-1, pLGNe-CsCOMT2-2 and pLGNe-CsCOMT2-3 represent the experimental group, and P<0.0001 represents the significant difference analysis;
[0026] Figure 6The content detection results of Vitisin-2, Rutin, Hesperidin and Melilotoside in the fruit peel of the injection area of the late Jin orange after 5 days of culture for the experimental group and the control group are shown in the figure, wherein A is the content detection result of Vitisin-2, B is the content detection result of Rutin, C is the content detection result of Hesperidin, and D is the content detection result of Melilotoside, pLGNe in the figure represents the control group, pLGNe-CsCOMT2-1, pLGNe-CsCOMT2-2 and pLGNe-CsCOMT2-3 represent the experimental group, and P<0.0001 and P<0.0002 represent significant difference analysis;
[0027] Figure 7 The structural formulas of Vitisin-2, Rutin, Hesperidin and Melilotoside are shown in the figure, wherein A is Vitisin-2, B is Rutin, C is Hesperidin, and D is Melilotoside. DETAILED DESCRIPTION
[0028] The various exemplary embodiments of the present application will now be described in detail, which should not be considered as limiting the present application, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the present application.
[0029] It should be understood that the terms described in the present application are only for describing the specific embodiments, and are not used to limit the present application. In addition, for the numerical range in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intermediate value in the stated range and any other stated value or intermediate value in the stated range is also included in the present application. The upper limit and the lower limit of these smaller ranges can be independently included or excluded from the range.
[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application pertains. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In the case of conflict between any document incorporated by reference and the present specification, the present specification controls.
[0031] Many modifications and variations of the present application specification can be made without departing from the scope or spirit of the present application, which will be apparent to those skilled in the art. Other embodiments resulting from the present specification will be apparent to those skilled in the art. The present specification and examples are only exemplary.
[0032] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0033] The source of the materials used in this invention: the late-maturing Jincheng orange is a superior late-maturing Jincheng orange strain selected from the common Jincheng orange by the Citrus Research Institute of the Chinese Academy of Agricultural Sciences. The variety approval number is Yu Shen Citrus 2011001.
[0034] Example 1
[0035] I. Bioinformatics analysis of the CsCOMT2 gene.
[0036] The structure of the CsCOMT2 gene in Late Orange is as follows: Figure 1 As shown, the CsCOMT2 gene is located between 11102916 bp and 11105725 bp on chromosome 4 of Citrus sinensis, chromosome version number Citrus sinensis v3.0, containing 4 introns and 5 exons, encoding 239 amino acids. The CDS sequence of the CsCOMT2 gene is shown in SEQ ID NO.1.
[0037] The CDS sequence of the CsCOMT2 gene is SEQ ID NO.1: ATGACAGACAAAGCAAAACAAGCAGCA.
[0038] II. Cloning the CDS sequence of the CsCOMT2 gene.
[0039] 1. RNA extraction and cDNA synthesis.
[0040] Total RNA was extracted from leaves of *Citrus aurantiacus* using a plant total RNA extraction kit (Adley, CAT: RN09). RNA quality was verified by agarose gel electrophoresis, and RNA concentration was determined using a concentration meter. cDNA was then synthesized using a reverse transcription kit (PrimeScript RTMaster Mix, TaKaRa, CAT: RR036A) according to the accompanying instructions.
[0041] 2. Amplifying the CDS sequence of CsCOMT2 gene.
[0042] The primer OE-CsCOMT2-F (SEQ ID NO. 2), OE-CsCOMT2-R (SEQ ID NO. 3) and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q) were used to amplify the cDNA of Citrus sinensis Osbeck obtained, and the amplification system was prepared according to the instructions of high-fidelity enzyme PrimeSTAR Max DNA Polymerase. The PCR amplification program was as follows: 98℃, 5min; 98℃, 30s, 56℃, 30s, 72℃, 1.5min, 35 cycles; 72℃, 10min. The CDS sequence of CsCOMT2 gene was amplified to obtain a DNA fragment with a length of 726bp (CDS sequence 717bp-terminator 3bp+front and rear enzyme digestion sites 12bp in total).
[0043] The nucleotide sequence of primer OE-CsCOMT2-F is SEQ ID NO. 2: GGTACCATGACAGACAAAGCAAAACAAGCAG.
[0044] The nucleotide sequence of primer OE-CsCOMT2-R is SEQ ID NO. 3: GAATTCGAATATACGCCTGCAGATTGTGATCC.
[0045] The results of agarose gel electrophoresis are shown in Figure 2 The size of the amplified fragment is consistent with the expected results. Under the ultraviolet lamp, the agarose gel block containing the target fragment was cut off with a clean knife, and the DNA fragment was recovered using the kit (BioFlux, CAT: BSC02M1). Part of the recovered product was sent to the company for sequencing. The sequencing results were analyzed by comparison, and it was determined that the obtained DNA fragment was the CDS sequence of CsCOMT2 gene of Citrus sinensis Osbeck (SEQ ID NO. 1).
[0046] III. Construction of CsCOMT2 gene overexpression vector and transformation of Agrobacterium.
[0047] 1. Construction of CsCOMT2 gene overexpression vector:
[0048] The obtained recovered DNA fragment, i.e. the CDS sequence of the CsCOMT2 gene of the late-kumquat, was digested with restriction enzymes Kpnl and EcoRI (Thermo Fisher) and recovered by gel, and then linked at 16°C for 12h. The enzyme digestion system and reaction conditions were prepared according to the attached instructions. The linkage used a T4 DNA Ligase kit (Promega, CAT: M1801), and the linkage system and reaction conditions were prepared according to the attached instructions of the T4 DNA Ligase kit.
[0049] The obtained linkage product was transformed into E. coli DH5a, and the transformation method used the method recorded in the attached instructions of E. coli DH5a (purchased from Weidi Biology). The plasmid of the positive clone was extracted by using a plasmid extraction kit (Omega, CAT: D6942), and the overexpression vector pLGNe-CsCOMT2 of the CsCOMT2 gene was obtained.
[0050] As shown in FIG. 2, it is the structure of the overexpression vector pLGNe-CsCOMT2 of the CsCOMT2 gene. Figure 3
[0051] 2. Transformation of the overexpression vector of the CsCOMT2 gene into Agrobacterium.
[0052] The obtained overexpression vector pLGNe-CsCOMT2 was introduced into Agrobacterium tumefaciens EHA105 by heat shock method, and the specific steps were as follows: 2 mL centrifuge tube containing frozen Agrobacterium competent cells EHA105 (50 μL) was thawed on ice; 2 μL overexpression vector plasmid was added to the competent cells, and the mixture was mixed by blowing and then placed on ice for 5 min, frozen in liquid nitrogen for 5 min, incubated at 37°C for 5 min, and placed on ice for 5 min. Then 800 μL of LB liquid medium was added to the 2 mL centrifuge tube, mixed by blowing with a pipette, and incubated at 260 r / min and 28°C for 2 h. After the time, the bacterial solution was centrifuged at 6000 r / min for 1 min, the supernatant was discarded, and the bacterial body was resuspended with 50 μL of LB liquid medium. After resuspension, it was spread on LB solid medium containing 50 mg / L kanamycin and incubated at 28°C for 2 days. After the bacterial colonies grew, the colonies were picked and subjected to PCR verification using primers ID-CsCOMT2-F (SEQ ID NO. 4) and ID-CsCOMT2-R (SEQ ID NO. 5) and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q). The amplification system was configured according to the instructions of high-fidelity enzyme PrimeSTAR Max DNA Polymerase, and the PCR amplification conditions were as follows: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.
[0053] Nucleotide sequence of primer ID-CsCOMT2-F SEQ ID NO. 4: TCGTTGAAGATGCCTCTGCCGACAG.
[0054] Nucleotide sequence of primer ID-CsCOMT2-R SEQ ID NO. 5: GAATATACGCCTGCAGATTGTGAT CC.
[0055] The PCR amplification product was subjected to agarose gel electrophoresis, and the colony with correct band size was the positive clone containing the overexpression vector pLGNe-CsCOMT2.
[0056] Four, transient transformation of CsCOMT2 gene overexpression vector pLGNe-CsCOMT2.
[0057] 1. Agrobacterium infection:
[0058] Select the growth state of the same late Jin orange fruit, with the ultra-clean bench, with a volume concentration of 75% ethanol solution disinfection standby; 500 μL containing pLGNe and pLGNe-CsCOMT2 plasmid Agrobacterium liquid was added to 50 mL liquid LB medium (containing 50 mg / L kanamycin), and cultured at 28°C, 200 r / min to OD 600 = 0.5. Centrifugal precipitation, resuspend Agrobacterium in 1 / 2MS liquid medium, then randomly select four injection points on the equatorial surface of the disinfected late Jin orange fruit, and mark, use 1 mL syringe to inject Agrobacterium containing pLGNe-CsCOMT2 plasmid suspension into the peel of late Jin orange, 1 mL per area, marked as experimental group. The same method was used to inject an equal amount of Agrobacterium containing pLGNe plasmid suspension into the late Jin orange as the control group. The experimental group and the control group were repeated three times, and the late Jin orange fruit injected with Agrobacterium suspension was placed in a 28°C incubator for dark culture for 5 days.
[0059] As Figure 4 shown, the photos of the experimental group and the control group of late Jin orange fruit transient transformation on the same day and after 5 days of culture, Figure 4 A is the photo of the control group (pLGNe) and the experimental group (pLGNeCsCOMT2-1, pLGNeCsCOMT2-2 and pLGNeCsCOMT2-3) of late Jin orange fruit on the same day of transient transformation, Figure 4 B is the photo of the control group (pLGNe) and the experimental group (pLGNeCsCOMT2-1, pLGNeCsCOMT2-2 and pLGNeCsCOMT2-3) of late Jin orange fruit after 5 days of culture, Figure 4 C is the photo of part of the sample when extracting total RNA.
[0060] 2, qRT-PCR analysis of transiently transformed late Jin orange fruit:
[0061] The total RNA of the injection area of the experimental group and the control group of late Jin orange cultured in a 28°C incubator for 5 days in the dark was extracted (Aidley, CAT No: RN09), and cDNA was synthesized using the reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT: RR036A). The expression amount of the target gene was detected by qRT-PCR. The detection primer was RT-CsCOMT2-F (SEQ ID NO. 6) and RT-CsCOMT2-R (SEQ ID NO. 7).
[0062] qRT-PCR reaction conditions: 95°C for 3 min, 94°C for 10 s; 56°C for 10 s, 72°C for 10 s, 40 cycles; 72°C for 10 min.
[0063] The nucleotide sequence of primer RT-CsCOMT2-F is SEQ ID NO.6:TTTGTGGATGCCGACAAGGA.
[0064] The nucleotide sequence of primer RT-CsCOMT2-R is SEQ ID NO.7:GAACCTGCTCTTCAGGCACT.
[0065] Use 2 -△△Ct The relative expression levels of the CsCOMT2 gene in the experimental and control groups of Late Jin oranges were calculated as follows: the control group sample was defined as the reference factor, i.e., its CsCOMT2 expression level was 1. Then, the fold increase in gene expression in the experimental group sample relative to the reference factor was calculated as 2. -△△Ct , which is its relative expression level.
[0066] The results are as follows Figure 5 As shown, the expression level of CsCOMT2 gene in the experimental groups (pLGNe-CsCOMT2-1, pLGNe-CsCOMT2-2 and pLGNe-CsCOMT2-3) was significantly higher than that in the control group, with the highest level being more than 8 times that of the control group.
[0067] V. Determine the content of vincain-2, rutin, hesperidin and lemon balm in the fruits of the experimental group and the control group.
[0068] The contents of vinazine-2, rutin, hesperidin, and / or lemon balm glycosides in the fruit peel of the experimental and control groups after 5 days of dark incubation at 28℃ were determined by UPLC-MS. Figure 7 China A Figure 7 B, Figure 7 C and Figure 6 Figure 7 shows the structural formulas of veselene-2, rutin, hesperidin and lemon balm glycoside.
[0069] The results are as follows Figure 6 China A Figure 6 B, Figure 6 C and Figure 6 As shown in Figure D, compared with the control group fruits transiently transformed with pLGNe, the contents of vescenin-2, rutin, hesperidin, and lemon balm in the peels of the experimental groups pLGNe-CsCOMT2-1, pLGNe-CsCOMT2-2, and pLGNe-CsCOMT2-3, which were transiently transformed with pLGNe-CsCOMT2, increased by 30.86%–51.69%, 25.99%–32.40%, 9.49%–13.87%, and 24.27%–36.84%, respectively. This indicates that transient overexpression of the CsCOMT2 gene can significantly increase the contents of vescenin-2, rutin, hesperidin, and lemon balm in the fruit of the late-maturing orange.
[0070] In conclusion, the application firstly discovers that the expression amount of CsCOMT2 gene is positively correlated with the contents of vitamin C, nobiletin, hesperidin and / or eriocitrin in citrus, the higher the expression amount of CsCOMT2 gene is, the higher the contents of vitamin C, nobiletin, hesperidin and / or eriocitrin in citrus are, and the citrus transiently transformed with the CsCOMT2 gene overexpression vector is 51.7% higher than that of the citrus transformed with the empty vector in the experiment; the CsCOMT2 gene can be used as a candidate gene for breeding new citrus varieties with high contents of vitamin C, nobiletin, hesperidin and / or eriocitrin, and has important significance for cultivating functional new citrus varieties by using genetic engineering method, accelerating breeding process, reducing breeding workload and improving comprehensive utilization rate of citrus.
[0071] The above-described embodiments are only used to describe the preferred modes of the application, and do not limit the scope of the application, and various modifications and improvements of the technical solutions of the application made by those skilled in the art without departing from the design spirit of the application shall fall within the protection scope of the claims of the application.
Claims
1. Application of CsCOMT2 gene in breeding of new citrus varieties, characterized in that, The CDS sequence of the CsCOMT2 gene is shown as SEQ ID NO.
1.
2. Use according to claim 1, characterized in that, The CsCOMT2 gene is overexpressed to increase the content of vitamin E-2, nobiletin, hesperidin and / or melilotoside in the citrus peel, and a new citrus variety with high content of vitamin E-2, nobiletin, hesperidin and / or melilotoside is obtained.
3. An overexpression vector, characterized by, The overexpression vector contains the CsCOMT2 gene, and the CDS sequence of the CsCOMT2 gene is shown as SEQ ID NO.
1.
4. A recombinant bacterial strain, characterized in that, The recombinant strain contains the vector for overexpressing the CsCOMT2 gene, and the CDS sequence of the CsCOMT2 gene is shown as SEQ ID NO.
1.
5. The use of the overexpression vector of claim 3 or the recombinant strain of claim 4 in the breeding of new citrus varieties, characterized in that, The overexpression vector or the recombinant strain overexpresses the CsCOMT2 gene to increase the content of vitamin E-2, nobiletin, hesperidin and / or melilotoside in the citrus peel, and a new citrus variety with high content of vitamin E-2, nobiletin, hesperidin and / or melilotoside is obtained.
6. A method for breeding a new citrus variety with high content of gossypitrin-2, nobiletin, hesperidin and / or melilotoside, characterized in that, The method comprises the following steps: amplifying the CDS sequence of the CsCOMT2 gene, constructing an overexpression vector of the CsCOMT2 gene, transforming Agrobacterium, and infecting citrus fruits to obtain a new citrus variety; The CDS sequence of the CsCOMT2 gene is shown as SEQ ID NO.
1.
7. Application of CsCOMT2 gene in breeding of new citrus varieties with high content of pericomin, characterized in that, The CDS sequence of the CsCOMT2 gene is shown as SEQ ID NO. 1; the CsCOMT2 gene is overexpressed to increase the content of melilotoside in the citrus peel, and a new citrus variety with high content of melilotoside is obtained.
8. Application of CsCOMT2 gene in breeding of new citrus varieties with high naringin content, characterized in that, The CDS sequence of the CsCOMT2 gene is shown as SEQ ID NO. 1; the CsCOMT2 gene is overexpressed to increase the content of nobiletin in the citrus peel, and a new citrus variety with high content of nobiletin is obtained.
9. Application of CsCOMT2 gene in breeding of new citrus varieties with high content of Citrus sinensis-2, characterized in that, The CDS sequence of the CsCOMT2 gene is shown as SEQ ID NO. 1; the CsCOMT2 gene is overexpressed to increase the content of vitamin E-2 in the citrus peel, and a new citrus variety with high content of vitamin E-2 is obtained.
10. Use of the CsCOMT2 gene to increase the content of the Vp-2, naringin and jaceosidin in the citrus peel, characterized in that, The CDS sequence of the CsCOMT2 gene is shown as SEQ ID NO. 1; the CsCOMT2 gene is overexpressed to increase the content of vitamin E-2, nobiletin and melilotoside in the citrus peel.
Citation Information
Patent Citations
Application of citrus FcMYC2 gene and encoded protein thereof in regulation and control of citrus essential oil synthesis
CN110938126A
Application of citrus CsNAC21 / 22 gene in improvement of citrus canker resistance
CN118638854A
Method for improving citrus canker resistance through CsERF39 gene and application of CsERF39 gene
CN118834902A
Application of citrus CsDREB gene in citrus plant height regulation and control and dwarf variety cultivation
CN119464358A
Targeted editing of citrus genes for disease resistance
US20210189410A1