Banana leaf included angle development related gene MaCYP85A1 and application thereof

By identifying and overexpressing the banana leaf angle gene MaCYP85A1, the leaf angle between rice and banana was increased, solving the problem of poor adaptability to dense planting in banana plant type improvement, improving the efficiency of mechanized planting and light energy utilization, and promoting the development of the banana industry.

CN120905296AInactive Publication Date: 2025-11-07SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511442637.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-10
Publication Date
2025-11-07
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

The absence of genes regulating banana leaf angle leads to poor adaptability to dense planting and mechanization. Existing technologies have failed to effectively improve banana plant type, affecting light energy utilization and mechanized harvesting efficiency.

Method used

We identified and overexpressed the banana leaf angle-related gene MaCYP85A1, increased the leaf angle in rice through transgenic technology, and regulated the banana leaf angle by treating it with brassinolide, inhibiting MaCYP85A1 expression to increase the leaf angle.

Benefits of technology

It provides genetic resources and molecular breeding methods to increase banana planting density and mechanization, promote the development of compact plant types in new banana varieties, and improve industry efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905296A_ABST
    Figure CN120905296A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of plant genetic engineering and crop breeding, and particularly discloses a banana leaf included angle development related gene MaCYP85A1 and application thereof. The key gene MaCYP85A1 for regulating and controlling the included angle of the banana leaves is identified through genome re-sequencing, transcriptome analysis and weighted co-expression network analysis by taking Brazilian banana and an upright mutant of the Brazilian banana as materials; the gene is specifically and highly expressed at the paraxial end of a banana petiole, the leaf included angle is regulated and controlled by participating in biosynthesis of brassinolide, the leaf included angle can be remarkably increased through overexpression of MaCYP85A1, and BR treatment can inhibit expression of MaCYP85A1 and increase the leaf included angle through negative feedback. According to the invention, the research blank of the banana leaf included angle regulation gene is filled, and key gene resources and technical support are provided for breeding new banana varieties suitable for close planting and mechanical planting.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant genetic engineering and crop breeding, and relates to a banana leaf angle development related gene MaCYP85A1 and application thereof. BACKGROUND

[0002] Banana (Musa acuminate L.) is a perennial herbaceous plant of Musaceae Musa, which is widely planted in tropical and subtropical regions, is the second largest fruit and the fourth largest food crop in the world, and the trade volume of fresh fruit ranks first in the world. It is also the largest tropical fruit in China, and the yield and consumption rank second in the world. Musa spp. In recent years, China's banana industry is facing two core problems: one is the continuous shrinkage of planting area; the other is the poor adaptability of high-density planting and mechanization. The banana plant is tall and the leaf angle is large, so the lower leaves are easily shaded when planted densely, resulting in low light energy utilization. At the same time, the tall and loose plant type increases the difficulty of mechanical harvesting, which seriously restricts the yield per unit area.

[0003] Existing banana plant type improvement technologies mainly focus on "dwarfing", which reduces the plant height through hybridization (such as breeding '63-1'), chemical mutagenesis (such as obtaining '8818-1'), radiation mutagenesis (such as breeding 'Zhongjiao 9'), etc. However, these technologies do not involve the "leaf angle", which is a key trait for high-density planting adaptability. In model crops such as rice and corn, genes such as

[0004] , CYP90D2 , OsDWARF have been identified to regulate leaf angle, and their functions are mainly related to brassinosteroid (BR) synthesis or signal transduction. However, there is no report on the key genes and molecular mechanisms of banana leaf angle regulation.

[0005] Therefore, it is of great significance to identify the key genes of banana leaf angle regulation and elucidate their mechanisms for breeding new banana varieties suitable for high-density planting and mechanization. SUMMARY

[0006] The present application aims to solve the problems of lack of banana leaf angle regulation genes and poor adaptability of high-density planting and mechanization in the prior art, and provides a banana leaf angle related gene MaCYP85A1 and elucidates its role in the BR synthesis pathway, providing gene resources and molecular breeding methods for breeding compact plant type banana varieties suitable for high-density planting and mechanization.

[0007] To achieve the above-mentioned purpose, the present application provides the following technical scheme: The first aspect of the present application provides the application of overexpression MaCYP85A1 gene in increasing the leaf angle of rice, MaCYP85A1 The CDS sequence of the gene is shown in SEQ ID NO. 1.

[0008] The second aspect of the present application provides an application of a biological material, and the application is any one of the following: D1) an application in increasing leaf angle of rice; D2) an application in preparing rice with increased leaf angle; The biological material is any one of the following E1) to E3): E1) an expression cassette containing the nucleic acid molecule shown in SEQ ID NO. 1; E2) a recombinant vector containing the nucleic acid molecule shown in SEQ ID NO. 1; E3) a recombinant microorganism containing the nucleic acid molecule shown in SEQ ID NO. 1, or a recombinant microorganism containing the expression cassette of E1, or a recombinant microorganism containing the recombinant vector of E2, and the microorganism is Agrobacterium.

[0009] The third aspect of the present application provides a method for cultivating rice with increased leaf angle, and the method comprises overexpressing the above-mentioned MaCYP85A1 gene in rice to obtain rice with increased leaf angle.

[0010] In the method, the overexpression of the MaCYP85A1 gene in rice is to increase the expression amount of the MaCYP85A1 gene in rice by using transgenic technology.

[0011] In the method, the increase of the expression amount of the MaCYP85A1 gene in rice by using transgenic technology is by introducing an expression vector integrated with the nucleic acid molecule shown in SEQ ID NO. 1 into the target plant.

[0012] The fourth aspect of the present application provides the application of the above-mentioned MaCYP85A1 gene in positively regulating BR signal of rice, and the positive regulation of BR signal of rice specifically means that after overexpression of the MaCYP85A1 gene, the leaf angle and tillering angle of rice are increased, and the number of rice fibrous roots is increased.

[0013] The fifth aspect of the present application provides a method for increasing leaf angle of banana, and the method comprises the following steps: spraying brassinolide with a concentration of 1 mg / L on the petiole part of banana; the spraying can cause the increase of leaf angle of banana, but inhibits the expression of the above-mentioned MaCYP85A1 gene through a negative feedback mechanism.

[0014] The beneficial effects of the present application are: (1) the key gene for regulating leaf angle is identified in banana for the first time, MaCYP85A1 which fills the research gap in this field; (2) the function of the MaCYP85A1Molecular mechanism of leaf angle formation by participating in BR synthesis pathway; (3) Provide target genes and theoretical basis for cultivating new varieties of compact banana with erect type by gene editing or transgenic technology; (4) Help to improve the planting density and mechanization level of banana, and enhance the industrial efficiency. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 Figure 1 is the phenotype difference of leaf angle between ‘BX’ and ‘RK’. (a) The difference of plant type between ‘BX’ and ‘RK’; (b-c) The size of leaf angle in different parts of ‘BX’ (b) and ‘RK’ (c); (d-e) The difference of cell size in petiole part between ‘BX’ and ‘RK’.

[0016] Figure 2 Figure 2 is the detection of variant sites in ‘BX’ and ‘RK’. (a) The distribution density of SNP in different chromosomes; (b) The distribution of variant site region; (c) The number of genes with CNV; (d) The distribution density of variant sites in chromosomes. From outside to inside, it is chromosome, SNP, InDel, SV and CNV; (e) The KEGG enrichment results of genes with duplication in ‘BX’.

[0017] Figure 3 Figure 3 is the analysis of plant type and gene expression in different development stages of banana. (a) The phenotype of banana in key development stages of plant type; (b-c) The development trend of plant height (b) and leaf angle (c) in different stages; (d) The PCA analysis results of transcriptome in different stages; (e) The differentially expressed genes in ‘BX’ and ‘RK’ in different stages. Red and blue represent down-regulated and up-regulated genes in ‘BX’, respectively; (f) The time series clustering of gene expression and KEGG enrichment analysis of genes in C1 module in ‘BX’; (g) The heat map of BR-related genes in the unique clustering module of ‘BX’ in different stages.

[0018] Figure 4 Figure 4 is the analysis of key genes regulating the development of banana leaf angle by WGCNA. (a) The sliding cut tree of genes and the division of gene modules; (b) The correlation heat map of module characteristic genes and leaf angle; (c) The correlation of genes in paleturquoise module with module characteristic genes and the correlation distribution of gene expression profile with leaf angle; (d) The co-expression network of genes in paleturquoise module. Different colors represent different gene modules in the network; (e) The Hub gene subnetwork in paleturquoise module; (f) The gene expression heat map of Hub genes in ‘BX’ and ‘RK’ in different development stages.

[0019] Figure 5 MaCYP85A1 Figure 5 is the spatiotemporal expression analysis. (a)MaCYP85A1 Phylogenetic analysis in monocots and dicots; (b) MaCYP85A1 Expression analysis in different tissues of banana; (c) MaCYP85A1 Expression analysis in the adaxial and abaxial end of banana petiole; (d) MaCYP85A1 Expression analysis in different development stages of ‘BX’ and ‘RK’ tissues; (e-f) MaCYP85A1 Expression location analysis in onion (e) and tobacco (f) cells; (g) MaCYP85A1 Self-activation activity test.

[0020] Figure 6 For overexpression MaCYP85A1 Influence the leaf angle size and BR content of rice. (a) Leaf angle and tiller angle of wild type (WT) and overexpression lines. Bar = 1 cm; (b-d) Statistics of leaf angle, lateral root number and root length of overexpression lines; (e-f) Statistics of grain length and width of overexpression lines; (g) Differential gene expression analysis of wild type and overexpression lines. Blue and red represent up-regulated and down-regulated genes in overexpression lines, respectively; (h-j) Differential gene analysis of leaf sheath and tiller node parts; (j) KEGG enrichment analysis of up-regulated genes of overexpression lines; (k) BR content detection of different tissues of wild type and overexpression lines; (l) Positive regulation of leaf angle size of rice by different concentrations of BR treatment.

[0021] Figure 7 For the influence of BR on the development of banana leaf angle. (a) Phenotype of banana at different stages after BR treatment; (b) Leaf angle size of banana after BR treatment; (c) Plant height size of banana after BR treatment; (d) Expression level change after BR treatment; (e) BR content of petiole part of ‘BX’ and ‘RK’. MaCYP85A1

[0022] Figure 8 For the influence of BR on the development of banana leaf angle. (a) Phenotype of banana at different stages after BR treatment; (b) Leaf angle size of banana after BR treatment; (c) Plant height size of banana after BR treatment; (d) Expression level change after BR treatment; (e) BR content of petiole part of ‘BX’ and ‘RK’. MaCYP85A1 Promoter activity analysis. (a) BR content of different tissues of ‘BX’ and ‘RK’; (b) GUS staining results of different tissues of ‘BX’ and ‘RK’; (c) GUS staining results of different tissues of wild type and overexpression lines; (d) Promoter activity analysis of ‘BX’ and ‘RK’. MaCYP85A1 Promoter and gene sequence comparison; (b) Promoter cis-acting element analysis; (c) Number of cis-acting elements; (d) GUS staining results of different tissues of rice. WT, 35S::GUS and pro::GUS represent wild type, pCAMBIA1305 empty control and pCAMBIA1305::pro::GUS transgenic rice, respectively; (e) CHIP-hub predicted upstream TFs targeting the promoter. Ellipse and rhombus represent transcription factors (TFs) and promoters, respectively; blue and red lines represent negative regulation and positive regulation of TFs on the promoter, respectively. MaCYP85A1 Promoter and gene sequence comparison; (b) Promoter cis-acting element analysis; (c) Number of cis-acting elements; (d) GUS staining results of different tissues of rice. WT, 35S::GUS and pro::GUS represent wild type, pCAMBIA1305 empty control and pCAMBIA1305::pro::GUS transgenic rice, respectively; (e) CHIP-hub predicted upstream TFs targeting the promoter. Ellipse and rhombus represent transcription factors (TFs) and promoters, respectively; blue and red lines represent negative regulation and positive regulation of TFs on the promoter, respectively. MaCYP85A1 Promoter and gene sequence comparison; (b) Promoter cis-acting element analysis; (c) Number of cis-acting elements; (d) GUS staining results of different tissues of rice. WT, 35S::GUS and pro::GUS represent wild type, pCAMBIA1305 empty control and pCAMBIA1305::pro::GUS transgenic rice, respectively; (e) CHIP-hub predicted upstream TFs targeting the promoter. Ellipse and rhombus represent transcription factors (TFs) and promoters, respectively; blue and red lines represent negative regulation and positive regulation of TFs on the promoter, respectively. MaCYP85A1 Promoter and gene sequence comparison; (b) Promoter cis-acting element analysis; (c) Number of cis-acting elements; (d) GUS staining results of different tissues of rice. WT, 35S::GUS and pro::GUS represent wild type, pCAMBIA1305 empty control and pCAMBIA1305::pro::GUS transgenic rice, respectively; (e) CHIP-hub predicted upstream TFs targeting the promoter. Ellipse and rhombus represent transcription factors (TFs) and promoters, respectively; blue and red lines represent negative regulation and positive regulation of TFs on the promoter, respectively. MaCYP85A1 Promoter and gene sequence comparison; (b) Promoter cis-acting element analysis; (c) Number of cis-acting elements; (d) GUS staining results of different tissues of rice. WT, 35S::GUS and pro::GUS represent wild type, pCAMBIA1305 empty control and pCAMBIA1305::pro::GUS transgenic rice, respectively; (e) CHIP-hub predicted upstream TFs targeting the promoter. Ellipse and rhombus represent transcription factors (TFs) and promoters, respectively; blue and red lines represent negative regulation and positive regulation of TFs on the promoter, respectively. DETAILED DESCRIPTION ​

[0023] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0024] Explanation of the sequence list: SEQ ID NO.1: SEQ ID NO. 2: AGTTCCTGAAGCAAGGTCCAA SEQ ID NO. 3: AAGCATAGCACTCCTCATCGT SEQ ID NO. 4: CTTAGCACTTTCCAGCAGATG SEQ ID NO. 5: ACACCAAAAAACTACCCCGAC SEQ ID NO. 6: CAGAAATGGTGGTCTTGGCAATGGTTAT SEQ ID NO. 7: CAATTCGATCCTAATCGTCCCAAACACG SEQ ID NO. 8: GTAGATCTGACTAGTCAGAAATGGTGGTCTTGG SEQ ID NO. 9: TTCTCCTTTACTAGTATCGTCCCAAACACGGATAT SEQ ID NO. 10: CAGAAATGGTGGTCTTGGCAATGGTTAT SEQ ID NO. 11: CAATTCGATCCTAATCGTCCCAAACACG SEQ ID NO. 12: GTAGATCTGACTAGTCAGAAATGGTGGTCTTGG SEQ ID NO. 13: TTCTCCTTTACTAGTATCGTCCCAAACACGGATAT Example 1 MaCYP85A1 Functional identification of genes 1. Materials and methods 1.1 Plant material The present skilled person screened a leaf angle straight ‘Brazilian banana’ (BX) natural mutant (‘Reke No. 3’, RK) by field plant type statistics, and used the mutant as a material to mine and functionally verify the key genes of banana leaf angle.

[0025] 1.2 Mining RK variant sites by mutant genome resequencing analysis and functional annotation of variant site genes 1.1.1 DNA extraction and library sequencing DNA extraction was performed using a DNA quick extraction kit (DN1402, Aidley Biotech Co., Ltd., Beijing, China) as follows: Healthy young banana leaves were selected, cut into small pieces, placed in 2 ml centrifuge tubes, two 5 mm diameter steel balls were added, and quickly frozen in liquid nitrogen; The banana leaves were thoroughly ground using a tissue grinder (TissueLyser II, QIAGEN, Germany) (30 Hz, 30 s); 600 μl of AP1 lysis solution was added to the thoroughly ground centrifuge tube, and lysis was performed at 65°C for 20 min; 300 μl of AP2 protein binding solution was added, and after standing on ice for 5 min, centrifugation was performed at 13000 rpm for 5 min; 300 μl of supernatant was pipetted into a new centrifuge tube, 450 μl of AP3 protein binding solution was added again, and centrifugation was performed for 3 min; 700 μl of supernatant was pipetted into the adsorption column, and centrifugation was performed at 13000 rpm for 30 s; 600 μl of rinse solution was added, and centrifugation was performed at 13000 rpm for 30 s, repeated twice; 60 μl of sterile water was added to the adsorption column, which was placed at room temperature for 5 min, then centrifuged at 13000 rpm for 1 min to collect the DNA and stored at -20°C.

[0026] The DNA concentration and integrity were detected using an ultramicro UV spectrophotometer and a 1% agarose gel, respectively.

[0027] The DNA that met the sequencing requirements was sent to Beijing Baimaikai Biotechnology Co., Ltd. for library sequencing.

[0028] 1.1.2 SNP and InDel detection After sequencing, the sequencing data was uploaded to the local server, and md5sum was used to verify the data integrity. The fastqc software was used to detect the quality of the sequencing data, and the Q30, GC %, length, reads number, etc. information of the data was obtained. According to the detection results, the fastp (Chen et al., 2018) software was used to filter the sequencing results, remove the reads with base quality value less than Q20 accounting for more than 50% and N content greater than 10 in the reads, and summarize the filtering results.

[0029] The banana A genome (Musa acuminata, V4) as the reference genome, which was obtained from the Banana genome hub database, and the alignment process was as follows: The reference genome was indexed using picard (Broad Institute, 2019) and BWA (Li et al., 2009; Li et al., 2010) software through the genome annotation file; The sequencing results were aligned to the reference genome according to the index file using BWA software; The alignment results were sorted using samtools (Danecek et al., 2021) software, and the result file was converted from sam format to bam format; The picard software was used to remove the duplicate information of the alignment results, and the samtools software was used to index the alignment results.

[0030] After alignment, samtools, picard, and qualimap (García-Alcalde et al., 2012; Okonechnikov et al., 2016) software were used to analyze the alignment results, and information such as alignment rate, genome coverage, sequencing depth, and insert size was obtained.

[0031] GATK software was used to obtain SNP and InDel information of 'BX' and 'RK' respectively and filter the results (Tables 2-4). Bcftools and GATK software were used to filter the results again, remove SNP sites with more than 2 SNPs within 5 bp of the genome, InDel sites with more than 2 InDels within 10 bp of the genome, and SNP sites within 10 bp of the InDel site. Vcf tools were used to filter the minor allele frequency (maf) less than 0.05, sequencing depth less than 4 x and greater than 1000 x, variant site quality value less than 30 and genotype quality (GQ) greater than 80, and separate SNP and InDel.

[0032] 1.1.3 Variant analysis ① Chromosome structure variant analysis: breakdancer software was used to analyze chromosome structure variants (Structure Variantions, SV) according to the alignment results of sequencing data, and SVs with less than 10 reads and score values less than 40 were filtered, and SV length, variant type, and variant region gene information were annotated.

[0033] ②Gene copy number variation analysis: CNVnator was used to analyze the sequencing results for gene copy number variations (CNV). The scaffolds with base numbers less than 1 x 10 7 bp in the reference genome were filtered, and the genome was divided into equal-length windows (bins) according to the sequencing depth, with a bin size of 30 bp for CNV site detection. According to the detection results, CNVs with a length of less than 1000 bp, p a -value greater than 0.01, and a proportion of reads with a quality value of 0 (q0) greater than 0.1 were filtered, and reads with multiple alignments in the CNV and a contribution greater than 50%. The filtered CNVs were annotated using cnvnator to obtain gene information for the variation sites.

[0034] The SV and CNV results of 'BX' and 'RK' were merged using the survivor software, and the difference information between 'BX' and 'RK' was screened according to the merged results. The gene information of SV and CNV sites was extracted according to the variation type, and the results were analyzed using TBtools.

[0035] 1.4 Gene function annotation and enrichment analysis The variation site genes were subjected to enrichment analysis using eggNOG-Mapper (Huerta-Cepas et al., 2019; Cantalapiedra et al., 2021) and clusterProfiler (Yu et al., 2012) packages, and the analysis process was as follows: Download the annotation data from the EggNOG database; Extract the longest transcript protein sequence of each gene in the genome as a representative sequence for gene function annotation; Use eggNOG-Mapper to annotate the extracted protein sequences with a threshold of 1e -05 -4; Extract the ID of the differential gene, and use the clusterProfiler package and the annotation results to enrich the function of the differential gene (p p -value = 0.05, qvalue = 0.2) and save the enrichment results; Use ggplot2 (Version 3.4.0) to visualize the enrichment results.

[0036] 1.2 Identification of key periods of leaf angle development and identification of differentially expressed genes in different development periods combined with transcriptome analysis 1.2.1 Phenotype determination of tissue culture seedlings at different growth stages BX' and 'RK' tissue culture seedlings at 4-5 leaf stage were used as materials, and 150 uniform and healthy seedlings were selected and planted in a glass greenhouse, with temperature set at 28 ℃, humidity 40%, watering once a day, keeping the soil moist, and allowing them to grow naturally. After the seedlings were transplanted for 2 weeks, the height and leaf angle of the banana seedlings were measured, and the first measurement result was used as the first week for numbering in turn.

[0037] 1.2.2 RNA extraction and library sequencing The total RNA of petiole and pseudostem of 'BX' and 'RK' at different growth stages was extracted using plant RNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd., Beijing, China), and the method was as follows: The petiole tissue of 'BX' and 'RK' at different growth stages was ground thoroughly under low temperature; About 0.2 g of sample was weighed into a 2 ml enzyme-free centrifuge tube and 500 μl of SL lysis solution (containing 5% β-mercaptoethanol) was added. After vigorous shaking for about 20 s, centrifugation was performed at 12000 rpm for 2 min; 400 μl of supernatant was taken to a CS adsorption column, and centrifugation was performed at 12000 rpm for 2 min; The adsorption column was discarded and 160 μl of anhydrous ethanol was added. After mixing, it was transferred to a CR3 adsorption column, and after centrifugation at 12000 rpm for 20 s, the waste liquid was discarded; 350 μl of RW1 deproteinization solution was added, and centrifugation was performed at 12000 rpm for 15 s. After the waste liquid was discarded, 10 μl of DNase I and 70 μl of RDD buffer were added, and it was placed at room temperature for 15 min; 350 μl of RW1 deproteinization solution was added, and centrifugation was performed at 12000 rpm for 15 s. The waste liquid was discarded; 500 μl of RW rinse solution was added, and centrifugation was performed at 12000 rpm for 30 s, repeated 2 times; 40 μl of RNase free ddH2O was added, and it was placed at room temperature for 2 min, centrifuged at 12000 rpm for 1 min, and the RNA solution was stored at -80 ℃; The RNA concentration and integrity were detected by ultramicro UV spectrophotometer and 2% agarose gel, respectively.

[0038] 1.2.3 Quantitative analysis of gene expression In this study, banana genome (( Musa acuminata , V4) was used as the reference genome for alignment analysis, and the alignment process was as follows: The redundant information in the genome annotation file was removed, and the reference genome was indexed using hisat2 (Kim et al., 2019) software; The filtered sequencing data was aligned to the reference genome using the method of chain specificity analysis with hisat2 software; The result file was converted from sam format to bam format and indexed using Samtools software; The alignment results were analyzed for quality control using RseQC software to check the Inner size and RNA integrity.

[0039] The alignment results of each sample were analyzed for gene expression quantification using Htseq-count software. The gene expression quantification results of all samples were merged in order, and the gene expression values were converted to FPKM values according to the sequencing amount and gene length information of each sample, and the Pearson correlation between samples was calculated.

[0040] 1.2.4 Gene expression pattern clustering analysis Gene expression pattern clustering analysis was performed using the Mfuzz (Kumar et al., 2007) package, and the analysis process was as follows: The average value of gene expression data at different time periods was calculated respectively; Genes with more than 25% missing values and standard deviation less than 0.1 were filtered out; The gene expression was standardized according to the filtering results; Manual clustering was performed according to the standardized results, and the results were adjusted.

[0041] 1.2.5 Gene differential expression analysis DESeq2 package was used to analyze the gene differential expression (DEGs) of the transcriptome data. With the difference multiple (Fold change, FC) greater than 2 (|log2FC| ≥ 1) and the false discovery rate (False Discovery Rate, FDR) less than 0.01 as the differential gene screening condition, the differential genes of 'BX' and 'RK' at different growth stages were obtained.

[0042] 1.3 WGCNA analysis combined with RK variation information to identify MaCYP85A1 is the key gene regulating banana leaf angle WGCNA (Langfelder et al., 2008) package was used to analyze the transcriptome results using weighted gene co-expression network analysis (WGCNA), and the analysis process was as follows: The gene expression data was read, outliers were removed, and genes with average FPKM value less than 5 in all samples and missing value greater than 50% were filtered out; Based on gene expression data, Hclust was used to perform hierarchical clustering on all sequencing samples to obtain the correlation between samples, and abnormal samples were removed based on the clustering results. Load and match trait data and gene expression data; Calculate the fit index, regression line slope, and average connectivity, and select a soft threshold based on the calculation results to make the constructed network more consistent with a scale-free network. An adjacency matrix was constructed from the gene expression data based on the selected soft threshold. Convert the adjacency matrix into a topological overlap matrix (TOM) and calculate the topological dissimilarity matrix (1-TOM). Based on the 1-TOM results, genes were clustered using the Average method with topological dissimilarity as the distance. Based on the gene clustering results, modules are divided, and the number of genes in each module is no less than 30. Extract the feature genes of each module, and calculate the correlation and dissimilarity between modules based on the feature genes; The modules are clustered using the Average method, and modules with a similarity greater than 0.8 are merged based on the clustering results. The correlation and significance (P) between the module and the trait are calculated to obtain the gene set that is significantly associated with the leaf angle; Based on gene expression data, the correlation between all genes in each module and the characteristic genes in that module (Module membership, MM) and the correlation between module genes and trait data (Gene significance, GS) are calculated, and the correlation between MM and GS is calculated. Based on the results, genes highly correlated with the development of banana leaf angle are screened. Clustering is performed based on module characteristic genes, and the correlation between modules is calculated; Save the correlation network data generated during the analysis process for subsequent network analysis.

[0043] 1.4. Spatiotemporal Representation Analysis and Determination MaCYP85A1 Highly expressed specifically at the adaxial end of banana petiole 1.4.1 Phylogenetic Tree Construction Using the NCBI database MaCYP85A1 Protein sequences were subjected to BLAST, and the sequence with the highest homology for each species was selected for phylogenetic tree construction. Phylogenetic trees were constructed from protein homologous sequences of 20 species (10 monocots and 10 dicots), including rice, maize, wheat, soybean, peanut, and apple. 1.4.2 Subcellular localization Subcellular localization was performed using onions and tobacco, respectively, following these steps: (1) Reagent preparation ① Reagent preparation AS (acetyl-syringone, 1M / L): 0.192g AS dissolved in 1ml dimethyl sulfoxide (DMSO); MgCl2(1M / L): 0.0952g MgCl2dissolved in 1ml ddH2O; MES (2-N morpholine ethanesulfonic acid, 1M / L): 0.213g dissolved in 1ml ddH2O; After the reagents were completely dissolved, they were filtered with a 0.22 μm sterile filter membrane (FPV423013, JET BIOFIL, canada) to remove bacteria, and placed in a sterile centrifuge tube and stored at 4 ℃.

[0044] ② Medium preparation According to the volume ratio, 1 μl of AS solution was added to each milliliter of MS medium to a final concentration of 1 mM / L, 10 μl of MgCl2solution to a final concentration of 10 mM / L, and 1 μl of MES solution to a final concentration of 10 mM / L.

[0045] (2) Preparation of Agrobacterium solution ① 100ul competent cells were added with 10 ng-1 μg of vector, and then placed on ice for 5 min, frozen in liquid nitrogen for 5 min, placed in a 37 ℃ water bath for 5 min, and placed on ice for 5 min; 35S : MaCYP85A1 The vector was introduced into LBA4404 Agrobacterium (AC1030, Shanghai Weidi Biotechnology Co., Ltd., China) according to the instructions: 10 ng-1 μg of vector was added to 100ul competent cells, and then placed on ice for 5 min, frozen in liquid nitrogen for 5 min, placed in a 37 ℃ water bath for 5 min, and placed on ice for 5 min; ② 700ul of LB liquid medium (without antibiotics) was added, and incubated at 28 ℃, 200rpm for 3h; ③ After centrifugation at 5000 r / s for 2 min, the supernatant was discarded; ④ The collected bacterial solution was evenly spread on LB solid medium (containing 100ug / ml rifampicin and 100ug / ml kanamycin) and incubated in a 28 ℃ incubator for about 60h (16h light incubation, 8h dark incubation); ⑤ A single colony on the medium was picked and placed in LB liquid medium (containing 100ug / ml rifampicin and 100ug / ml kanamycin), and incubated in a shaker at 28 ℃, 200rpm for 2 days, with an OD 600 of about 0.5.

[0046] (3) Subcellular localization of onion 1. Medium preparation MS medium: 4.4 g MS medium powder (M0222.0050, duchefa biochemie, Netherlands) was weighed and dissolved in 1 L distilled water (16 g agar powder was added in each liter of MS solid medium), sterilized at 121 ℃ for 20 min; Permeation medium: 1 mM / L AS, 10 mM / L MES and 10 mM / L MgCl2 were added to the MS liquid medium; Co-culture medium: AS was added to the MS solid medium to a final concentration of 1 mM / L.

[0047] 2. Agrobacterium infection Reference Liu Haiyan (Liu Haiyan et al., 2009) and make modifications: ① Select fresh and healthy onions, remove the outer 3-5 scales; ② Use an alcohol lamp to sterilize the scalpel, cut 0.5 cm 2 left and right onion pieces, and place them in 75% ethanol for 3-5 min of sterilization; ③ Rinse the sterilized onion pieces in sterile water 3 times, use tweezers to tear off the inner epidermis and place it on the MS solid medium, 25 ℃ overnight culture, close to the mesophyll side of the medium; ④ Take the Agrobacterium from the shaker and place it in a centrifuge, centrifuge at 5000 r / s for 10 min, discard the supernatant and collect the bacterial cells; ⑤ Resuspend the collected bacteria in MS permeation medium, use a spectrophotometer to detect the concentration of the bacterial solution, the final concentration is OD 600 =1.0 and stand on ice for 1 h; ⑥ Add the pre-cultured onion inner epidermis to the permeation medium containing the Agrobacterium solution, and culture at 28 ℃ for 45 min; ⑦ Use sterile filter paper to absorb the excess bacterial solution on the onion inner epidermis; ⑧ Place the onion inner epidermis on the MS co-culture medium and culture in the dark at 28 ℃ for 24 h; Use tweezers to pick up the onion epidermis and place it in DAPI staining solution (1 mg / ml) for nuclear staining. After 5 min, rinse the onion epidermis with water 3-5 times to remove excess staining solution. Use the pressing method to make onion inner epidermis slices, add a drop of fluorescent mounting medium, and observe the fluorescent signal by laser confocal microscopy to determine the expression location of the gene in the cell.

[0048] (4) Tobacco subcellular localization Healthy and young tobacco leaves were selected for subcellular localization. Agrobacterium was injected from the back of the tobacco using a 1 ml syringe. After 2 days of dark culture, fluorescence observation was performed using a laser confocal microscope.

[0049] 1.4.3 Tissue-specific expression analysis The expression levels of ‘BX’ and ‘RK’ tissue culture seedlings at different growth stages and at the bolting stage were detected by qRT-PCR, respectively. MaCYP85A1 The bolting stage selected roots, pseudostems, petioles, corms, leaves, and flower buds, a total of 6 parts. The petiole was detected at the proximal and distal ends, and the flower bud was detected at the inflorescence and bud. The tissue culture seedlings selected roots, corms, pseudostems, petioles, and leaves for detection. The method is as follows: ① Primer design According to the CDS sequence of the candidate gene ID, the primer blast online software in the NCBI database was used for qRT-PCR primer design. The banana genome (Taxonomy ID: 4640) was used as a reference for primer design. The primers were synthesized by Sheng Wu Bioengineering Co., Ltd. (Shanghai, China) with unique amplification results, annealing temperature around 60 ℃, and amplification of target fragments around 300 bp and crossing introns.

[0050] ② Primer screening The extracted RNA was reverse transcribed into cDNA using the reverse transcription kit (RR047A, Takara, Kusatsu, Japan). The synthesized primers were amplified by PCR using cDNA as a template. The amplification results were electrophoresed using a 1 % agarose gel to test the number of target bands.

[0051] Table 1 qRT-PCR primer sequences

[0052] Table 2 PCR reaction system

[0053] Table 3 PCR amplification reaction conditions

[0054] ③ qRT-PCR verification The cDNA after reverse transcription was diluted 3 times as a template, and the qRT-PCR verification was carried out with Actin primer as an internal reference gene (Chen et al., 2011). The expression of candidate genes in different growth periods and different parts of banana was tested using fluorescence quantitative kit (RR820A, Takara, Kusatsu, Japan) and Roche LightCycler96 fluorescence quantitative PCR instrument.

[0055] Table 4 qRT-PCR amplification reaction conditions

[0056] 1.5 Overexpression verification in rice MaCYP85A1 Involving in leaf angle formation by regulating brassinosteroid (BR) synthesis 1.5.1 Transgenic function verification 1.5.1.1 Gene cloning and vector construction Extraction MaCYP85A1 The CDs sequence (SEQ ID NO. 1) was used to design gene primers using primer 5.0, and the primer amplification specificity was tested using primer blast. The banana leaf sheath part cDNA was used as a template, and the high-fidelity enzyme (R045A, Takara, Kusatsu, Japan) and gene primers containing vector homologous arms were used for PCR amplification.

[0057] Using spe Ⅰ Single enzyme digestion was carried out on pCAMBIA1302 vector, and the enzyme digestion products were subjected to 1.5 % agarose gel electrophoresis and recovered linearized vector. The gene fragment containing the vector homologous arm was connected into the linearized vector by In-Fusion kit (639648, Takara, Kusatsu, Japan), and the connected vector (pCAMBIA1302-CDs) was transformed into DH5a, and cultured at 37 ℃ for 12 h. Single colonies were picked and cultured, and after PCR detection, it was sent to Shengong (Shengong Bioengineering Co., Ltd., Shanghai, China) for sequencing. The sequencing results were subjected to sequence splicing and alignment using DNA Man, and the vector strain completely aligned with the reference sequence was stored at -80 ℃ using 30 % glycerol. 35S :: MaCYP85A1 ) was transformed into DH5a, and cultured at 37 ℃ for 12 h. Single colonies were picked and cultured, and after PCR detection, it was sent to Shengong (Shengong Bioengineering Co., Ltd., Shanghai, China) for sequencing. The sequencing results were subjected to sequence splicing and alignment using DNA Man, and the vector strain completely aligned with the reference sequence was stored at -80 ℃ using 30 % glycerol.

[0058] Table 5 Gene cloning and vector construction primers

[0059] 1.5.1.2 Promoter vector construction Extraction MaCYP85A1 The 2000 bp sequence upstream of the start codon was designed with primers at both ends. The spe Iand Hind Ⅲ pCAMBIA1305 was digested with enzymes, and a promoter vector (pCAMBIA1305::) was constructed using an In-Fusion kit. pMaCYP85A1 The ligated vector was then transferred into EHA105 Agrobacterium.

[0060] Table 6 Primers for promoter cloning and vector construction

[0061] 1.5.1.3 Genetic transformation of rice pCAMBIA1302- MaCYP85A1 ( OE-MaCYP85A1 ) and pCAMBIA1302 empty vector were transformed into EHA105 Agrobacterium (AC1010, Shanghai Weidi Biotechnology Co., Ltd., China), with Nipponbare ( Oryza Sativa L. spp. japonica callus was used as material for transformation. Hygromycin (50 mg / ml) was used to screen the transformed callus, and the screened resistant callus was induced to differentiate and root. After differentiation into seedlings, leaf DNA was extracted, and primers were constructed using gene vectors for detection. Positive T0 generation transgenic rice seedlings were then screened.

[0062] 1.5.1.4 Phenotypic Statistics (1) Screening of positive plants Hygromycin and PCR were used to screen transgenic rice progeny, as follows: Remove the hull and seed coat of the rice seed to expose the embryo and endosperm (ensuring the embryo remains intact). Soak the remaining part in a 3% sodium hypochlorite solution for 30 minutes, shaking it 3-5 times during the process to ensure thorough disinfection. Wash the disinfected seeds 3-5 times with sterile water, and place the rinsed seeds on sterile filter paper to remove excess water. Seeds were placed in 1 / 2 MS solid medium containing hygromycin (50 mg / ml), with the embryos in contact with the surface of the medium, and cultured in a constant temperature climate chamber (30℃, 16h light culture; 25℃, 8h black culture). After 3 days of cultivation, the seed germination rate in the petri dishes was counted, and one week later, the rice seedlings were transplanted into 96-well rice breeding boxes and cultured in Hogrange medium. One week after transplanting, rice leaves were cut and positive plants were screened using a tissue PCR kit.

[0063] (2) Purification of transgenic rice According to the screening results of positive plants, the positive seedlings were transplanted to a greenhouse, 30 °C light culture for 16 h, 25 °C dark culture for 8 h, and when the rice pillow was flat (1.5-2 months after germination), bagging selfing was performed until the T2 generation.

[0064] 1.5.2 BR content determination BR is a neutral compound with high hydrophobicity, easily soluble in organic solvents, and commonly extracted with methanol or acetonitrile (Takatsuto et al., 1982; Yokota et al., 2001; Swaczynová et al., 2007). In this study, brassinosteroids were extracted from banana petiole using anhydrous methanol, as follows: 1.5.2.1 BR extraction ① Respectively, 0.2 g of plant tissue to be tested was placed in a 2 ml centrifuge tube, and two stainless steel beads with a diameter of 5 mm were placed in each centrifuge tube; ② Using a cell crusher, 30 Hz, 30 s of grinding; ③ Respectively, 1 ml of anhydrous methanol was added to each centrifuge tube, and ultrasonic crushing was performed for 5 min; ④ The ultrasonically crushed centrifuge tubes were placed in a 4 °C environment for 24 h of light-free extraction; ⑤ Using a low-temperature centrifuge, 1000 rpm, 4 °C, centrifugation for 20 min; ⑥ The supernatant after centrifugation was transferred to a 2 ml enzyme-free centrifuge tube and stored at -20 °C.

[0065] 1.5.2.2 BR content determination The content of brassinosteroids was determined using a plant brassinosteroid (BR) ELISA detection kit (MB-4706B, Enzyme-labeled Biological, China), as follows: (1) Standard curve construction ① The microplate was taken out from the 4 °C refrigerator and placed at room temperature for 20 min; ② The microplate was washed with 20-fold diluted wash buffer, each sample well was filled with wash buffer, and after 1 min, the liquid in the well was shaken off, inverted on the blotting paper and repeatedly tapped, the wash buffer in the sample well was fully absorbed, and the washing was repeated 5 times; ③ Respectively, 50 μl of different concentrations of standard and 100 μl of horseradish peroxidase (HRP) labeled detection antibody were added to the sample wells, mixed well, and the reaction wells were covered with a sealing film, and incubated in a 37 °C water bath or incubator for 60 min; ④ Discard the liquid, fill each sample well with washing solution, let stand for 1 minute, then pour out the liquid in the well. Repeat 5 times, then invert the sample well onto absorbent paper to dry the washing solution in the sample well. ⑤ Add 50 μl of substrate A and 50 μl of substrate B to each sample well and incubate at 37°C in the dark for 15 min; ⑥ After incubation, add 50 μl of stop solution to each sample well. Within 15 min, use a microplate reader (SynergyH1, Bio-tek, America) to measure the OD value of each sample well at 450 nm. ⑦ Use mycurvefit (https: / / www.mycurvefit.com / ) to plot a linear regression curve and calculate the BR concentration value for each sample based on the standard curve equation.

[0066] (2) Sample determination Add 10 μl of extraction solution and 40 μl of sample dilution solution to the sample well, and measure the OD value of the diluted sample.

[0067] 1.5.3 Observation of petiole cells and analysis of BR induction 'BX' and 'RK' leaf petioles with different leaf angles were selected and cross-sectioned. Cell morphology of the cross-sections was observed using a stereomicroscope (VHX-6000, Keyence, China). Healthy Brazilian banana seedlings at the 6-7 leaf stage were selected and sprayed with 1 mg / L BR once a day. The leaf angle was measured and recorded.

[0068] 1.5.4 BR-induced gene expression Apply 1 mg / L BR evenly to the petioles of Brazilian bananas at the 5-6 leaf stage using a cotton swab. Collect banana petioles at 0 h, 1 h, and 24 h after treatment, extract RNA, and perform reverse transcription. Use the reverse transcribed cDNA as a template for qRT-PCR, following the same method as above.

[0069] 1.6.BR treatment significantly increased the banana leaf angle and inhibited... MaCYP85A1 level of expression 1.6.1 BR-induced gene expression Apply 1 mg / L BR evenly to the petioles of Brazilian bananas at the 5-6 leaf stage using a cotton swab. Collect banana petioles at 0 h, 1 h, and 24 h after treatment, extract RNA, and perform reverse transcription. Use the reverse transcribed cDNA as a template for qRT-PCR, following the same method as above.

[0070] 1.6.2 Analysis of banana leaf angle induced by BR Leaf petioles with different leaf angle were selected for cross section, and cell morphology was observed using a stereo microscope (VHX-6000, Keyence, China). Healthy Musa acuminate L. seedlings at the 6-7 leaf stage were sprayed with 1 mg / L of BR once a day, and the leaf angle was measured and recorded.

[0071] 2 Result analysis: 2.1 Phenotypic statistics determine the difference in leaf angle between ‘BX’ and ‘RK’ Natural variation widely exists in crops, which is the driving force for crop evolution and provides the basis for crop domestication and improvement. Our research team previously obtained a natural mutant ‘Reka 3’ (RK) through screening of tissue culture seedlings of ‘BX’. Analysis of leaf angles at different parts of the plant at the bolting stage showed that the leaf angles at different parts of ‘RK’ were not significantly different, and the overall plant type was compact and upright, and the plant height was lower than that of ‘BX’ (Fig. 1a-c). Cross-section observation of the petiole showed that the cells at the proximal end of the petiole in ‘RK’ were significantly smaller than those in ‘BX’, and there was no significant difference in cell layer number (Fig. 1d-e). These results have important biological significance for the later mining of leaf angle regulation genes. Figure 7 Figure 1 d-e). These results have important biological significance for the later mining of leaf angle regulation genes.

[0072] 2.2 Re-sequencing analysis detects ‘RK’ variation sites and genes Plant mutants are generated by gene mutations, which can lead to new phenotypes or characteristics. Mutants serve as important genetic resources, providing more possibilities for new variety breeding. Genome re-sequencing in ‘RK’ detected 44618 SNP and 4085 InDel variation sites, which were mainly found in intergenic regions and intron regions (Fig. 2a-b). Gene copy number analysis showed that ‘RK’ contained 2800 duplicated genes and 173 deleted genes, which were distributed on the chromosomes of ‘BX’ (Fig. 2c-d). Functional annotation of the variation genes showed that the genomes of the two varieties showed significant differences in the hormone signal transduction pathway (Fig. 2e). Figure 2 Figure 2 Figure 2 e).

[0073] 2.3 Transcriptional analysis identifies differentially expressed genes at different developmental stages To explore the differentially expressed genes involved in banana leaf angle development, the leaf angle size of ‘BX’ and ‘RK’ at different developmental stages was measured and the petiole part was subjected to transcriptome analysis. Four weeks after transplanting, the plant height of ‘RK’ was significantly lower than that of ‘BX’, and at 8 weeks, the leaf angle of ‘RK’ was significantly lower than that of ‘BX’ (Fig. 3a-b). Transcriptional analysis of the petiole part showed that 106 genes were differentially expressed in ‘RK’ and ‘BX’ at the 4th week, and 109 genes were differentially expressed at the 8th week (Fig. 3c-d). Gene ontology (GO) analysis showed that the differentially expressed genes were mainly involved in the regulation of cell wall organization, cell wall organization, and cell wall biogenesis (Fig. 3e-f). Figure 3 ​​​a-c). Therefore, we speculate that the 7th and 8th week of transplanting the potted seedlings is the key period for the development of banana leaf angle. The transcriptome analysis results show that the 3rd week has significant differences from other growth periods, and the differences within the 4th-6th week and 7th-10th week groups are smaller, indicating that the gene transcription level changes of 'BX' and 'RK' are obvious with the growth Figure 3 d-e). Temporal clustering analysis of differential genes detected a unique expression trend module (C1) in 'BX', which contains 3009 genes and is specifically up-regulated at the key period of leaf angle development Figure 3 f). KEGG enrichment analysis shows that these genes are mainly involved in hormone signal transduction and BR biosynthesis, and most of them belong to Cytochrome P450 gene family members Figure 3 g).

[0074] 2.4 WGCNA analysis identified MaCYP85A1 as the key genes regulating banana leaf angle In order to further explore the key genes regulating the development of banana leaf angle, WGCNA analysis was performed. According to the gene sliding cut tree, all differential expression genes were divided into 28 gene modules, of which 12 were positively correlated with leaf angle modules and 16 were negatively correlated modules, with correlation coefficients between -0.58 and 0.7 Figure 4 a-b). The correlation between the expression profiles of all genes in the module and the module characteristic genes (GS) and the absolute value of the correlation between the genes and the phenotype traits (MM) is between 0.63 and 0.82 and 0.54 and 0.75 Figure 4 c). Combined with the results of temporal analysis of gene expression, we detected MaCYP85A1 may be the key genes regulating the development of banana leaf angle, and 33 Hub genes were detected in this module, including MaCYP85A1 ( Figure 4 d-e). Combined with the transcriptome data, we found that the expression levels of these Hub genes in 'BX' and 'RK' were significantly different, especially at the 7th and 8th week, the difference was particularly significant Figure 4 f). Therefore, we selected MaCYP85A1 as candidate genes for regulating banana leaf angle for further study.

[0075] 2.5 Spatiotemporal expression analysis determines MaCYP85A1 is specifically highly expressed in the proximal end of banana petiole Further analysis MaCYP85A1 of its function, we constructed a protein phylogenetic tree, and the results showed that MaCYP85A1 is homologous to Osdwarf , which is highly conserved in monocots and significantly distinguished from dicotsFigure 5 a). Tissue-specific expression shows that MaCYP85A1 It is highly expressed in banana petioles, with significantly higher expression levels at the adaxial end than at the abaxial end, consistent with the differences in petiole cells between 'BX' and 'RK' varieties. Figure 5 bc). Further research revealed that during the critical period of banana leaf angle development, MaCYP85A1 Specific upregulation of expression, and the expression level in 'BX' was significantly higher than that in 'RK'. Figure 5 d). Subcellular localization showed that it was expressed in both the cell nucleus and cell membrane, and possessed self-activating activity ( Figure 5 e.g., the above results indicate that... MaCYP85A1 Acting on the banana petiole, it may be a key gene involved in regulating the development of the banana leaf angle.

[0076] 2.6 Validation of overexpression in rice MaCYP85A1 By adjusting BR synthesis, it participates in the formation of leaf angle. To clarify MaCYP85A1 We have built a function to adjust the blade angle. 35S::MaCYP85A1 The vector was then transferred to rice for validation. Statistical analysis showed that the leaf angle and tillering angle of the overexpressing lines were significantly increased. Figure 6 ab), the number of fibrous roots increases, but the overall root length decreases ( Figure 6 cd), however, had no significant effect on the size of rice grains ( Figure 6 Transcriptome analysis further revealed (ef). MaCYP85A1 Overexpression significantly upregulated genes involved in rice BR synthesis and hormone signal transduction pathways. Figure 6 gj). Analysis of BR content in different tissues revealed that the overexpressing strain had the highest BR content in the leaf pulvinus region, showing a significant increase compared to the WT strain. Figure 6 k). Exogenous application of different concentrations of BR significantly increased the leaf angle of rice. Figure 6 l). In summary, MaCYP85A1 It regulates leaf angle by participating in BR hormone synthesis.

[0077] 2.7 BR treatment significantly increased the banana leaf angle and inhibited... MaCYP85A1 level of expression To investigate the effect of BR on banana leaf angle, BR (1 mg / L) was sprayed onto the banana petiole. Compared with the control, the banana leaf angle in the treatment group increased significantly after 1 day, and the difference between the two groups gradually increased thereafter, then leveled off on the 7th day. Figure 7 ab). However, there was no significant difference in plant height between the two groups after BR treatment ( Figure 7 c). qPCR detection revealed that BR treatment significantly reduced... MaCYP85A1 The expression level is consistent with the negative feedback mechanism of BR signal transduction.Figure 7 d). Further detection of BR content in petiole of 'BX' and 'RK' showed that BR content in petiole of 'BX' was significantly higher than that of 'RK' (P < 0.01) Figure 7 e). The results again indicated that BR was an important hormone for regulating the development of banana leaf angle.

[0078] 2.8 Promoter analysis determines MaCYP85A1 Specific expression in the water rice pillow position and by multiple TFs Regulation Through genome comparison, no variation site was detected in the promoter sequence of 'RK' (P < 0.01) Figure 8 a). Multiple motifs were detected in the promoter sequence, most of which were hormone regulatory elements (P < 0.01) Figure 8 b-c). We speculate MaCYP85A1 It may be a key gene for interaction of different hormone pathways. To explore the expression region of the promoter, we constructed MaCYP85A1 pro + GUS Vector and transferred into rice. After GUS staining, GUS signal was only detected in the leaf pillow position of rice, and other positions were not stained (P < 0.01) Figure 8 d). It is shown MaCYP85A1 Specifically expressed in the leaf pillow position. Through Chip-hub, 10 TFs Target MaCYP85A1 Promoter sequence, of which 7 TFs Positive regulation MaCYP85A1 Gene expression, 3 TFs Negative regulation MaCYP85A1 Gene expression. This provides insight for further analysis of MaCYP85A1 Regulate the mechanism of banana leaf angle.

[0079] In summary: through genome resequencing and transcriptome (WGCNA) analysis, the key gene MaCYP85A1 , which encodes a cytochrome P450 enzyme, is a key enzyme in the brassinosteroid (BR) biosynthetic pathway, is mined from banana erect mutant 'Reka No. 3' (RK).

[0080] MaCYP85A1 Specifically highly expressed in banana petiole (especially the adaxial end), the expression peak coincides with the key period of leaf angle development, and its expression in wild type 'Brazilian banana' (BX, large leaf angle) is significantly higher than that in compact mutant 'RK' (small leaf angle).

[0081] By overexpressing MaCYP85A1 In rice, it can significantly increase the leaf angle and tiller angle, and increase the endogenous BR content, proving that the gene has a positive regulation function on the leaf angle. MaCYP85A1Overexpression of BR synthesis genes in Arabidopsis promotes leaf angle development. The expression of BR synthesis genes is negatively feedback regulated by BR signal (exogenous BR treatment can inhibit the expression of BR synthesis genes), which is consistent with the classical regulation model of BR synthesis.

[0082] The application has been described in detail. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0083] The term "protein" is used interchangeably herein to mean a polymer of amino acid residues. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more of the amino acid residues is a non-naturally encoded amino acid. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are connected via covalent peptide bonds.

[0084] The term "transformation" refers to the process of introducing a heterologous DNA sequence into a host cell or organism.

[0085] The term "expression" refers to the transcription and / or translation of an endogenous gene or transgene in a plant cell.

[0086] It will be apparent to those skilled in the art that various modifications and variations can be made in the present application without departing from the spirit or scope of the application. Thus, it is intended that the present application cover modifications and variations of this application provided they come within the scope of the appended claims and their equivalents.

Claims

1. overexpression MaCYP85A1 The use of the gene in increasing the leaf angle of rice is characterized in that, MaCYP85A1 The CDS sequence of the gene is shown in SEQ ID NO.

1.

2. Use of a biomaterial, characterized in that, The application is any one of the following: D1) application in increasing leaf angle of rice; D2) application in preparing rice with increased leaf angle; The biological material is any one of the following E1) to E3): E1) expression cassette containing nucleic acid molecule shown as SEQ ID NO. 1; E2) recombinant vector containing nucleic acid molecule shown as SEQ ID NO. 1; E3) recombinant microorganism containing nucleic acid molecule shown as SEQ ID NO. 1, or recombinant microorganism containing expression cassette of E1), or recombinant microorganism containing recombinant vector of E2), and the microorganism is Agrobacterium.

3. A method for breeding a plant having an increased leaf angle, characterized by, The method comprises overexpressing in a plant MaCYP85A1 a gene, obtaining a plant with increased leaf angle, the plant being rice, the MaCYP85A1 The CDS sequence of the gene is shown as SEQ ID NO.

1.

4. The method of claim 3, wherein, The overexpression in plants MaCYP85A1 The expression amount of the gene is increased in rice by using transgenic technology. MaCYP85A1 The expression amount of the gene is increased in rice by using transgenic technology.

5. The method of claim 4, wherein, The expression of the gene is increased in the rice by introducing a plant expression vector in which a nucleic acid molecule represented by SEQ ID NO. 1 is integrated into the target plant. MaCYP85A1 The expression of the gene is increased in the rice by introducing a plant expression vector in which a nucleic acid molecule represented by SEQ ID NO. 1 is integrated into the target plant.

6. MaCYP85A1 The application of the gene in regulating rice BR signal positively, characterized in that, The MaCYP85A1 The CDS sequence of the gene is shown as SEQ ID NO.

1.

7. Use according to claim 6, characterized in that, The positive regulation of BR signal in rice is specifically represented by overexpression MaCYP85A1 After the gene, the leaf angle and tiller angle of rice are increased.

8. Use according to claim 6, characterized in that, The positive regulation of BR signal in rice is specifically manifested as overexpression MaCYP85A1 After the gene, the number of rice fibrous roots increases.

9. A method of increasing the angle of leaf divergence in banana plants, characterised by, The method comprises the following steps: Spray the banana petiole with brassinolide at a concentration of 1 mg / L; the spraying inhibits the growth of brassinolide in bananas through negative feedback. MaCYP85A1 Gene expression, thereby increasing the leaf angle; MaCYP85A1 MaCYP85A1 The CDS sequence of the gene is shown in SEQ ID NO.1.