Fixed-point efficient knock-in Vero cell line of targeted AAVS1 safe port and use method of fixed-point efficient knock-in Vero cell line
By combining the CRISPR/Cas9 and Twin PE systems, and utilizing the Bxb1 serine recombinase to perform site-specific and efficient integration of exogenous DNA at the AAVS1 safe harbor site, the problems of low targeted gene insertion efficiency and insufficient safety in existing technologies have been solved, achieving stable expression and safe insertion of exogenous genes in Vero cell lines.
Patent Information
- Application Number
- CN202511128238.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-13
- Publication Date
- 2025-11-07
AI Technical Summary
Existing technologies are inefficient and imprecise when targeting gene insertion, especially when inserting large DNA fragments, which poses risks. Furthermore, traditional methods may affect host gene expression and pose safety hazards.
By combining the CRISPR/Cas9 and Twin PE systems, the Bxb1 serine recombinase was used to perform site-specific and efficient integration of exogenous DNA at the AAVS1 safe harbor site. By designing pegRNA and donor plasmids, site-specific and efficient knock-in into Vero cell lines targeting the AAVS1 safe harbor was achieved.
Stable expression and efficient insertion of exogenous genes in Vero cell lines were achieved, shortening cell line construction time, reducing off-target editing probability, and improving insertion accuracy and safety.
Smart Images

Figure CN120905302A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of gene editing and cell engineering, and specifically relates to a targeted, efficient knock-in Vero cell line targeting AAVS1 safe harbor and a use method thereof. BACKGROUND
[0002] The commonly used gene insertion method is random integration or homologous recombination based on plasmids to insert exogenous DNA. With the development of gene editing technology, targeted nucleases (such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and CRISPR / Cas9) can mediate exogenous DNA integration into the recipient genome through homologous recombination repair (HDR), but the success rate of this method is affected by many factors, and the efficiency is low, especially when the exogenous DNA is more than several kb.
[0003] When a larger construct needs to be added, researchers usually use the random transgenic method of retrovirus and lentivirus vector systems, and the random integration method is widely used and convenient to operate, but it has shortcomings in accuracy, which may affect the controllability and efficiency of transgenic insertion position and is accompanied by a certain risk of gene damage. For example, it may have a local impact on host gene expression and silencing. Studies have shown that about 50% of "random" transgenic insertion will destroy the coding sequence of the endogenous gene, usually causing large fragment deletion and structural variation in the integration region. In addition, random transgenesis can also lead to multiple copy integration, including tandem repeats, thereby causing abnormal gene expression or silencing, so subsequent screening process is needed to determine stable and high expression clones.
[0004] The site-specific recombinase (SSR) system is a strategy for introducing a target gene into the genome. These enzymes were first discovered in bacteria, and site-specific recombinases can mediate precise integration, excision and inversion reactions of DNA molecules between specific sites. Recombinases can be divided into two categories: tyrosine recombinases and serine recombinases, which have different recognition sites and modes of action. Among them, serine recombinases can catalyze the integration of exogenous DNA into the target genome through recombination between their attachment sites attP and attB in mammalian cell engineering. In particular, the Bxb1 member of the large serine subfamily, due to its high specificity for recognition sites and low off-target rate, performs well in DNA integration in mammalian cells and is widely used in gene knock-in research. Bxb1 recombinase mediates site-specific recombination between phage attachment sites (48 bp of attP) and bacterial attachment sites (38 bp of attB) to catalyze integration. Although SSR has the advantages of simplicity, high specificity and high efficiency, its recognition site integration depends on random integration, which is usually considered as a semi-targeted integration method.
[0005] The double-strand break repair mechanism of the CRISPR / Cas9 system can introduce mutations, inversions, and copy number variations, accompanied by a high proportion of off-target editing and potential cancer risk. Twin Prime Editing (Twin PE), developed by David Liu et al. based on CRISPR / Cas9, is a new gene editing tool that can delete, replace, integrate, and invert the DNA sequence of endogenous human genome sites without generating DNA double-strand breaks. Compared with CRISPR / Cas9, the advantage of Twin PE is that it avoids double-strand breaks, significantly reduces off-target probability, and can efficiently delete, replace, or insert larger DNA sequences into the target endogenous genome location.
[0006] The selection of integration sites is the key to gene site-specific integration. Genomic Safe Harbor (GSH) refers to a region that can stably express integrated transgenes without damaging the function of host cells. GSH plays an important role in developing gene stable insertion cell lines, not only improving insertion efficiency and stability, but also enhancing the reliability and safety of cell lines in research and clinical applications. AAVS1 (located in the intron of the PPP1R12C gene on human chromosome 19) is a recognized safe harbor site. Targeted gene integration using the AAVS1 site (safe harbor site, located at 19q13.42) provides a safe and efficient platform for gene therapy and basic research. Its low-risk characteristics (located in a non-essential region) and the ability to support stable expression of transgenes (open chromatin environment), combined with mature gene editing technology, make it an ideal genomic "landing site" for predictable and persistent expression.
[0007] There are certain limitations in using recombinase technology alone for precise insertion of exogenous genes into target sites, but the combination of recombinase technology and gene editing technology can improve the efficiency of precise insertion of exogenous genes and shorten the time for construction of cell lines. A research team used CRISPR / Cas9 technology to induce DNA double-strand breaks at a specific genomic location in HEK293T cells, introduced a resistance gene carrying a FRT site and a "landing pad" containing a lox site into the break, and under the action of Cre recombinase, the target gene (GOI) was precisely integrated into the lox site, while the resistance gene of the landing pad in the positive cells was removed by the Flp-FRT recombination mechanism, thereby completing the precise insertion of exogenous DNA. David et al. successfully installed the attP site at the HEK293T cell genome safe harbor by the Twin PE system, and combined Bxb1 serine integrase and donor sequences with attB sites to achieve more efficient large fragment DNA knock-in. Yarnall et al. developed a new technology called PASTE (Programmable Addition via Site-specific Targeting Elements) based on CRISPR, which fused serine integrase based on Cas9 nickase (nCas9) and reverse transcriptase, and can site-specifically integrate up to 36 kb of DNA long fragments into mammalian and human cells. Gene site-specific knock-in technology has important significance in biological research and clinical applications. It not only provides a core tool for constructing disease models, studying gene function, developing gene therapy and preparing recombinant proteins, but also promotes the development of precision medicine and synthetic biology. SUMMARY
[0008] The purpose of the present application is to provide a targeted AAVS1 safe harbor site-specific and efficient knock-in Vero cell line and its use method to solve the problems raised in the above background art.
[0009] To achieve the above purpose, the present application provides the following technical solutions: construction of a targeted AAVS1 safe harbor site-specific and efficient knock-in Vero cell line, cell: Vero purchased from ATCC; Plasmid: PE editing plasmid: (#132776, #174038), Bxb1 plasmid (#179104) purchased from addgene, minicircle DNA (MN530A-1) and Escherichia coli (MN900A-1) purchased from System Biosciences; The location of AAVS1 gene locus is: Genebank: NC_132909; The safe harbor in Vero cell is confirmed, and the location of AAVS1 in Vero is finally confirmed as Genebank: NC_132909. The method comprises connecting the editing sequence with the PE editing plasmid, and then transfecting the editing plasmid and the working plasmid into the Vero cell line, and obtaining the cell line with the attP sequence knocked into the AAVS1 site through antibiotic pressure screening.
[0010] Preferably, the PE editing plasmid is addgene: 174038, and the PE working plasmid is addgene: 132776.
[0011] Preferably, the PE working plasmid replaces the GFP with the puromycin termination sequence by using restriction endonuclease PmeI and EcoRI.
[0012] Preferably, the Vero cells into which the editing vector is introduced are continuously screened under pressure, and the stable expression monoclonal cells are obtained by combining the limited dilution method.
[0013] Preferably, the continuous pressure screening is carried out under the condition of an appropriate concentration of puromycin, and the screening time is 5 days, and the concentration of the puromycin is 5 μg / ml.
[0014] A method for using a Vero cell line, which comprises constructing a donor vector, co-transfecting the vector into the Vero cell line, and obtaining a stable expression cell line through antibiotic pressure screening.
[0015] Preferably, the vector donor plasmid is MN530A-1 (System Biosciences), and the Bxb1 plasmid is addgene: 179104.
[0016] Preferably, the donor plasmid replaces the GFP reporter sequence with an attB and a CMV enhancer and promoter, an MC multiple cloning site, an SV40 ployA, and endonuclease XmaI and StuI recognition sequences by using restriction endonuclease XmaI and StuI.
[0017] Preferably, the Bxb1 plasmid replaces Cas9(H840A) with a puromycin sequence by using restriction endonuclease NotI and EcoRI.
[0018] Preferably, the continuous pressure screening is carried out under the condition of an appropriate concentration of puromycin, and the screening time is 5 days, and the concentration of the puromycin is 5 μg / ml.
[0019] Compared with the prior art, the beneficial effects of the application are: the targeted AAVS1 safe harbor site, the high-efficiency knock-in Vero cell line and the use method thereof: the constructed VAP23 cell line, the stable expression of the exogenous gene, no loss and attenuation after multiple passages, and the ability to quickly obtain the Vero cell line with the exogenous gene introduced into the genome within 2-3 months, which has wide application value in the aspect of exogenous gene knock-in. On the other hand, the gene editing site insertion method used in the present application provides a new idea for the construction of genetic engineering of cell lines, and has important significance for targeted insertion biological research. BRIEF DESCRIPTION OF DRAWINGS
[0020] Figure 1 Sanger sequencing diagram of Vero-AAVS1-attP (VAP23) cell line; Figure 2 Sanger sequencing verification diagram of attB-attL / R recombination site in VAP23-EGFP cell line; Figure 3 Fluorescence microscope photos (scale: 100 μm) of VAP23-EGFP monoclonal cell strains (1 / 2 / 3); Figure 4 Passage stability detection of VAP23-EGFP monoclonal cell strains (1 / 2 / 3): (a) primary (P0) flow cytometry histogram; (b) flow cytometry histogram of passage 30 (P30); Figure 5 Cell growth rate curve; Figure 6 Cell doubling time; Figure 7 Cell morphology long dynamics under 20X optical microscope; Figure 8 Expression of AAVS1 before and after gene. DETAILED DESCRIPTION
[0021] The present application provides a targeted AAVS1 safe harbor site, a high-efficiency knock-in Vero cell line and a use method thereof, and the specific embodiments will be described in detail below. First of all, it needs to be clear that this patent does not contain drawings, so in the description process, the steps and technical details will be described in detail in the form of words to ensure that the skilled in the art can realize the present application according to the content described.
[0022] Please refer to Figures 1-4 In the targeted AAVS1 safe harbor site, the high-efficiency knock-in Vero cell line and the use method thereof of the present application, the cell line contains the Bxb1 attachment site attP sequence integrated into the AAVS1 gene.
[0023] Cells: Vero cells were purchased from ATCC.
[0024] Plasmids: PE editing plasmids (#132776, #174038), Bxbl plasmid (#179104) were purchased from addgene, minicircle DNA (MN530A-1) and E. coli (MN900A-1) were purchased from System Biosciences.
[0025] Search of AAVS1 locus, multiple bioinformatics methods were used, the locus was located at Genebank: NC_132909.
[0026] Specifically: search and confirmation of safe harbor in Vero cells The validated GSH sites (AAVS1 / PPP1R12C in human, mouse and pig genomes) were analyzed using NCBI’s Genome Data Viewer (https: / / www.ncbi.nlm.nih.gov / genome / gdv / ). Then, the flanking genes of the AAVS1 site were determined. If the arrangement of the two flanking genes in the Vero genome was similar to that of the orthologous genome, these regions would align together. For this purpose, the regions between the validated and candidate genes were pairwise aligned by the EMBOSS WATER algorithm (https: / / www.ebi.ac.uk / Tools / psa / emboss_water / ). If only one flanking gene around the validated AAVS1 site was similar to that in the Vero genome, the alignment was excluded. If there was no similarity, the region was not considered as a potential GSH. The potential GSH sites were assessed for the presence of coding or non-coding genes by NCBI’s Genome Data Viewer or UCSC Genome Browser (https: / / genome.ucsc.edu). The RNAseq data of African green monkey and human in the Gene Expression Atlas (https: / / www.ebi.ac.uk / gxa / home) were used to determine the transcriptional level of the flanking genes in Vero cells. Finally, the location of AAVS1 in Vero was confirmed to be Genebank: NC_132909.
[0027] The cell genome contains an attP sequence, the nucleotide sequence is as shown in Figure 1 GGTTTGTCTGGTCAACCACCGCGGTCTCAGTGGTGTACGGTACAAACC.
[0028] Specifically: construction and identification of Vero-AAVS1-attP cell line (1) Design and synthesis of pegRNA sequence: pegRNA consists of spacer sequence, scaffold sequence, 3' PBS sequence and repair template sequence RTT (3' extension). pegRNA is designed according to the design principles of David Liu and using online software https: / / zlab.bio / guide-design-resources. A pair of pegRNA sequences for editing Bxb1-attP (GT) site of AAVS1 gene is designed. The scaffold sequence is a conserved sequence, and the corresponding sequence is SEQ ID No. 2 Construction of editing plasmid: The annealing system of pegRNA is: DNA annealing buffer 23 μl, Topo ligase / Botoligo (100 μM) 1 μl; annealing program: 95 °C, 3 min; then from 94 °C to 25 °C at a rate of 1 °C / min. The U6-pegRNA-GG-acceptor (#174038) vector is linearized by enzyme digestion, and the enzyme digestion system is: U6-pegRNA-GG-acceptor 1 μg, BsaI-HFv2 (NEB) 5 μl, 10 × Cutsmart Buffer 5 μl, Nuclease free water To 50 μl, 37 °C reaction for 4 hours, according to the instructions of Thermoscientific gel recovery kit, the enzyme digestion product is recovered by gel recovery, and the target DNA fragment is obtained. The assembly system of pU6-pegRNA-vector, pegRNA component fragments is: U6-pegRNA-GG-acceptor (30 ng / μl) 2 μl, pegRNA-spacer (4 μM) 1 μl, 3'-extension (4 μM) 1 μl, pegRNA-scaffold (4 μM) 1 μl, DNA ligation Mix (TakaRa) 5 μl, and the connection reaction conditions are 16 °C reaction for 30 min. After the completion of the ligation reaction, it is transformed into Trelief™5α competent cells, and plasmid identification is carried out by using colony PCR-Sanger sequencing, and the identification primers are: upstream primer GCCTATTTCCCATGATTCCT, downstream primer TTTTTGTGATGCTCGTCAGG The reaction system is: 2 x T5 Super PCR Mix (Colony) 12.5 μl, upstream primer (10 μM) 1 μl, downstream primer (10 μM) 1 μl, bacterial suspension 1 μl, nuclease-free water 9.5 μl, total volume 25 μl, and the amplification conditions are: 98 ℃ pre-denaturation for 3 min, 98 ℃ denaturation for 10 s, 58 ℃ annealing for 15 s, 72 ℃ extension for 15 s, a total of 35 cycles, 72 ℃ extension for 5 min. The PCR product with the same expected band size is sequenced and verified, and the size is consistent with the expectation and the reading frame is correct.
[0029] The selection of the attP sequence insertion position and the design of the editing sequence are as shown in Figure 2 VR-Peg-1-top: CACCGTCTTAGGGTGGTCTTCTCCGTTTT VR-Peg-1-bot: CTCTAAAACGGAGAAGACCACCCTAAGAC VR-Ext-1-top: GTGCCGTACACCACTGAGACCGCGGTGGTTGACCAGACAAACCAGAAGACCACCCT VR-Ext-1-bot: CGCGAGGGTGGTCTTCTGGTTTGTCTGGTCAACCACCGCGGTCTCAGTGGTGTACG VR-Peg-2-top: CACCGAGCCATATTAATCGGCCCTGTTTT VR-Peg-2-bot: CTCTAAAACAGGGCCGATTAATATGGCTC VR-Ext-2-top: GTGCGGTCAACCACCGCGGTCTCAGTGGTGTACGGTACAAACCGCCGAT TAATATGGCTCTGG VR-Ext-2-bot: CGCGCCAGAGCCATATTAATCGGCCGTTTGTACCGTAACCCACTGAGACCGCGGTGGTTGACC.
[0030] Example 1: A method for constructing the above-mentioned Vero cell line is provided, which comprises connecting the editing sequence with the PE editing plasmid, and then transfecting the editing plasmid and the working plasmid into the Vero cell line, and obtaining the cell line with the attP sequence knocked in at the AAVS1 site through antibiotic pressure screening.
[0031] The PE editing plasmid is addgene: 174038, PE working plasmid: addgene: 132776.
[0032] The working plasmid replaces GFP with a stop puromycin sequence by using restriction enzymes PmeI, EcoRI.
[0033] The Vero cells into which the editing vector is transferred are subjected to continuous pressure screening combined with limited dilution to obtain stable expression of a monoclonal cell.
[0034] The continuous pressure screening is screening under the condition of an appropriate concentration of puromycin, and the screening time is 5 days The concentration of the puromycin is 5 μg / ml. The PE editing sequence is as shown in Figure 2 .
[0035] Embodiment 2: The application provides a use method of the modified Vero cell line described above, wherein the application includes construction of a donor vector, and then co-transfecting the vector into a Vero cell line, and obtaining a stable expression cell line through antibiotic pressure screening.
[0036] The vector donor plasmid is: MN530A-1 (System Biosciences), Bxb1 plasmid: addgene: 179104.
[0037] The donor plasmid replaces the GFP reporter sequence with an attB and a CMV enhancer and promoter, an MC multiple cloning site, an SV40 ployA, and an endonuclease XmaI and StuI recognition sequence by using restriction enzymes XmaI and StuI.
[0038] The Bxb1 plasmid replaces Cas9 (H840A) with a puromycin sequence by using restriction enzymes NotI and EcoRI.
[0039] In one specific implementation, a method for connecting a target protein into a donor plasmid is provided.
[0040] The Vero cells into which the donor plasmid and the Bxb1 plasmid are transferred are subjected to continuous pressure screening combined with limited dilution to obtain stable expression of a monoclonal cell, The continuous pressure screening is screening under the condition of an appropriate concentration of puromycin, and the screening time is 5 days The concentration of the puromycin is 5 μg / m.
[0041] Further: determination of the working concentration of puromycin: Vero cells were plated in six-well plates at an appropriate density, and when the cells grew to 70%-90% confluence, the original culture medium was replaced with DMEM culture medium containing different concentrations of puromycin, with concentrations of 0 µg / ml, 2.5 µg / ml, 5 µg / ml, 7.5 µg / ml, 10 µg / ml, and 12.5 µg / ml. The culture was continued in a 37°C, 5% CO2 incubator, and the screening culture solution was replaced every 2 days. After about 5 days of culture, the lowest concentration of puromycin at which the cells died completely was determined to be the optimal working concentration, which was 5 µg / ml.
[0042] Transfection: Vero cells in the logarithmic growth phase were digested and blown into a single-cell suspension, and the concentration was adjusted to 1×105 cells / ml. The 6-well culture plates were inoculated with 2 ml per well, and placed in a 37°C, 4% CO incubator for 24 h. According to the LipofectamineTM3000 product instructions, pCMV-PE2-P2A-puro, pegRNA1, and pegRNA2 plasmids were co-transfected into Vero cells at a ratio of 9:2:2, and EGFP was transfected as a control to evaluate the transfection efficiency. After 2 days of cell transfection, the original culture medium was replaced with DMEM culture medium containing 5 μg / mL of puromycin for positive cell screening. The fresh screening culture solution was replaced every 2 days, and the screening was performed for 5 days. After the control wells were completely dead, the normal culture medium was replaced for continued culture. After cell expansion, DNA was extracted for PCR-Sanger sequencing to detect the editing results. The sequencing primers were: upstream primer TCGACTTCCCCTCTTCCGAT, downstream primer GGCCCTAAGGATGGGGCTTTT. The reaction system was: 2×T5SuperPCRMix (Colony) 12.5 µl, upstream primer (10 μM) 1 µl, downstream primer (10 μM) 1 µl, cell DNA 1 µl (50-200 ng / µl), nuclease-free water 9.5 µl, and the total volume was 25 µl. The reaction conditions were the same as above. If the editing was successful, a 500 bp band was generated. Detection found that there was a 500 bp band, representing that part of the cells were successfully edited.
[0043] Vero-AAVS1-attP (GT) monoclonal cell selection and PCR-Sanger sequencing identification: the edited Vero cells were screened by limiting dilution method, and the edited cells were counted, diluted to 70-80 cells / ml, plated into 96-well plates at 200 μl per well, and observed under a microscope after 24 h. Label the wells with only one cell, continue to culture for 7-14 days, and when the cells grow into a clear cell colony, digest the cells and transfer them to a 24-well plate for expansion culture. When the cells grow to about 90%, extract the cell DNA for PCR-Sanger sequencing. The sequencing primers and PCR reaction system and reaction conditions are as above. If AAVS1-attP (GT) alleles exist, a 500 bp product will be produced. Select a strain of correct and healthy monoclonal cells verified by PCR sequencing to culture on a large scale, and name it: Vero-AAVS1-attP (23), abbreviated as VAP23, and part of the cells are frozen to preserve the monoclonal cell strain.
[0044] See Figures 5-7 After introducing GFP carrying the CMV promoter at the AAVS1 site, by comparing the growth kinetics and morphological changes with wild-type Vero cells, it was found that the growth curve and doubling time of VAP23-EGFP did not change significantly, and the morphology also did not change significantly.
[0045] See Figure 8 Gene transcription changes before and after the safe harbor, TNNT1 and EPS8L two genes in two kinds of cells after the insertion of the target gene slightly increased, but there was no statistical difference, P = 0.4913 > 0.05; P = 0.4968 > 0.05.
[0046] The above two experiments prove that the AAVS1 site has no obvious effect on cell growth kinetics and transcriptome after targeted integration of the target gene. The introduction of the target gene into this site does not affect the safety of Vero cells.
[0047] Use and stability test of VAP23 cell line (1) The donor plasmid has been modified during use. The plasmid MN530A-1 (System Biosciences) was modified to contain attB and a multiple cloning site, named Cloned-mc.
[0048] (2) Construction and production of donor Cloned-mc-EGFP: The multiple cloning site on the donor plasmid was selected, and EGFP was connected to the donor plasmid by enzyme digestion and ligation. Colony PCR-Sanger sequencing was used to identify the recombinant plasmid, and the identification primers were upstream primer TGATGGTCGAGACTCAGCGG and downstream primer GATCCACTAGAGTGTGGCGG. The reaction system and conditions are shown above. If it is a target monoclonal, a band of about 2000 bp can be obtained, and then sequencing verification is performed. The size is as expected, and the sequencing result is correct. The production of Cloned-mc-EGFP uses E. coli strain (MN900A-1) according to the instructions of System Biosciences. The donor plasmid is extracted using the PureLink™ HiPure Plasmid DNA Purification Kit recommended by Thermo.
[0049] (3) VAP23 cells were plated into 6-well plates, and the transfection conditions and time were performed according to the above method. After transfection, the normal culture medium was replaced and continued to be cultured. After the cells were expanded, PCR-Sanger sequencing was used to detect the editing results. The sequencing primers were upstream primer CCTGGCCATTGTCACTTTGC and downstream primer CGTCAATAGGGGGCGTACTT. This primer is a universal sequencing primer based on the cell genome and the CMV promoter, which can detect whether the target protein carrying the CMV promoter is inserted into the cell line. The reaction system and reaction conditions are the same as above. Detection found that a band was produced and sequencing showed that the knock-in was successful, indicating that part of the cell editing was successful.
[0050] (4) VAP23-EGFP monoclonal cell selection, PCR and Sanger sequencing were performed according to the above method. The primers were upstream primer 1 CCTGGCCATTGTCACTTTGC and downstream primer 1 TCTCGTTGGGGTCTTTGCTC; upstream primer 2 AGGACGACGGCAACTACAAG and downstream primer 2 TT TT TG TG ATGCTCGTCAGG. The PCR reaction system and conditions are shown above. The PCR product with the same size as the expected band was sequenced to verify. The monoclonal cells with correct sequencing results were cultured on a large scale, and part of the cells were frozen to preserve the monoclonal cell strain.
[0051] (5) Observation of EGFP expression under a fluorescence microscope: In order to detect the EGFP expression of VAP23 cell lines, three monoclonal cell strains VAP23-EGFP1 / 2 / 3 were obtained, and were observed and photographed under a fluorescence microscope. The fluorescence expression of the three cell lines was strong.
[0052] (6) Flow cytometry detection of the stability of exogenous protein EGFP expression in cell lines: To detect the stability of exogenous gene expression in the VAP23 cell line, three monoclonal cell lines, VAP23-EGFP1 / 2 / 3, were obtained. Flow cytometry was used to detect the expression of EGFP in primary VAP23-EGFP cells and after 30 passages. This was to explore the stability of the VAP23 cell line for constructing exogenous gene expression cell lines, so as to subsequently construct cell lines with stable expression of different exogenous genes at this site. Figure 4 As shown in the histogram, the x-axis represents relative fluorescence intensity, and the y-axis represents relative cell number. Flow cytometry results showed that, in three independent experiments, the proportion of EGFP-positive cells in the primary VAP23-EGFP monoclonal cell line was 99.46% ± 0.15%, and after 30 passages, it was 99.58% ± 0.02% (mean ± standard deviation, n=3). No significant changes were observed in MFI, with no fluorescence quenching or attenuation. This indicates that our constructed VAP23 cell line exhibits stable exogenous gene expression without loss or attenuation after multiple passages, and can rapidly introduce exogenous genes into the genome within 2-3 months, demonstrating broad application value in exogenous gene knock-in. Furthermore, the gene editing site-specific insertion method used in this study provides a new approach for the genetic engineering construction of cell lines, which is of great significance for targeted insertion biology research.
[0053] Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A method for constructing a site-directed and efficient knock-in Vero cell line targeting AAVS1 safe harbor, characterized in that: the cell is Vero purchased from ATCC; the plasmid is PE editing plasmid: (#132776, #174038), Bxb1 plasmid (#179104) purchased from addgene, minicircle DNA (MN530A-1) and E. coli (MN900A-1) purchased from System Biosciences; the AAVS1 gene locus is located at Genebank: NC_132909; the method for searching and confirming the safe harbor in Vero cells comprises connecting the editing sequence with the PE editing plasmid, and then transfecting the editing plasmid and the working plasmid into the Vero cell line, and obtaining the cell line with the attP sequence knocked in the AAVS1 site through antibiotic pressure screening. The PE editing plasmid is addgene: 174038, and the PE working plasmid is addgene: 132776. The PE working plasmid is obtained by replacing the GFP with the terminal puromycin sequence using restriction endonuclease PmeI and EcoRI. The Vero cells into which the editing vector is transferred are continuously screened under pressure, and the stable expression monoclonal cells are obtained by combining the limited dilution method.
2. The construction of a targeted, high-efficiency knock-in Vero cell line at the AAVS1 safe harbor according to claim 1, characterized in that: The continuous pressure screening is carried out under the condition of an appropriate concentration of puromycin, and the screening time is 5 days, and the concentration of the puromycin is 5 μg / ml.
3. The construction of a targeted, high-efficiency knock-in Vero cell line at the AAVS1 safe harbor according to claim 2, characterized in that: The donor vector is constructed, and the vector is co-transfected into the Vero cell line, and the stable expression cell line is obtained through antibiotic pressure screening.
4. The construction of a targeted, high-efficiency knock-in Vero cell line at the AAVS1 safe harbor according to claim 3, characterized in that: The donor plasmid is MN530A-1 (System Biosciences), and the Bxb1 plasmid is addgene: 179104.
5. The construction of a targeted, high-efficiency knock-in Vero cell line at the AAVS1 safe harbor according to claim 4, characterized in that: The donor plasmid is obtained by replacing the GFP reporter sequence with an attB and a CMV enhancer and promoter, an MC multiple cloning site, an SV40 ployA and endonuclease XmaI and StuI recognition sequence using restriction endonuclease XmaI and StuI.
6. A method of use of the Vero cell line according to any one of claims 1 to 5, characterized in that: The Bxb1 plasmid is obtained by replacing Cas9 (H840A) with a puromycin sequence using restriction endonuclease NotI and EcoRI.
7. The method of using the Vero cell line according to claim 6, characterized in that: The continuous pressure screening is carried out under the condition of an appropriate concentration of puromycin, and the screening time is 5 days, and the concentration of the puromycin is 5 μg / m.
8. The method of use of the Vero cell line according to claim 7, characterized in that: 9. The method of using the Vero cell line of claim 8, wherein: 10. The method of using the Vero cell line of claim 8, wherein: