Adenovirus vector as well as construction method and application thereof

Abstract

The invention provides an adenovirus vector as well as a construction method and application thereof, and the recombinant adenovirus vector is named as pAd5-C7. According to the invention, a Tet gene regulation and control system and a Cumate gene regulation and control system are integrated into a single-copy plasmid pAd5 containing an adenovirus type 5 genome in different ways to obtain a recombinant adenovirus vector pAd5-C7. On the basis of a Rembineering technology, a screening gene SacB / beta-geo is inserted into the downstream of a CMV promoter on pAd5-C7, and a rapid, efficient and universal recombinant adenovirus vector construction platform is constructed. Recombinant adenovirus plasmids constructed on the basis of the platform can be used for obtaining recombinant adenovirus particles with advanced protein regulated and controlled. In an adenovirus vector based on the human adenovirus type 5, the recombinant adenovirus which is normally expressed in allowable cells and is inhibited in advanced protein expression of the adenovirus in non-allowable cells is prepared.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to an adenovirus vector and a construction method and application thereof. BACKGROUND

[0002] As a highly efficient gene delivery tool, adenovirus vectors have been widely studied in the fields of gene therapy, vaccine development, gene function research, cell therapy and regenerative medicine in the past few decades. In the field of vaccine research, due to the characteristics of adenovirus such as wide host infectivity and high gene expression efficiency, it has become a carrier that attracts much attention in vaccine development. At present, adenovirus vector vaccines have been successfully applied in the vaccine development of many infectious diseases such as malaria and HIV, and have shown good protection ability and safety. However, the application of adenovirus vector vaccines still faces some challenges, such as pre-existing antibody interference and strong anti-vector immunity after administration. SUMMARY

[0003] Therefore, the present application provides an adenovirus vector and a construction method and application thereof. In the adenovirus vector based on human adenovirus type 5, an adenovirus that can normally express in permissive cells but the expression of late proteins in non-permissive cells is inhibited is prepared.

[0004] To achieve the above-mentioned purpose, the present application adopts the following technical solutions: In a first aspect, the present application provides a recombinant adenovirus vector, named pAd5-C7, which is an adenovirus vector based on recombinant human adenovirus type 5 for regulating the expression of late proteins.

[0005] In a second aspect, the present application provides a construction method of the recombinant adenovirus vector, comprising the following steps: (1) Selecting the IVa2 protein of adenovirus as a regulation target, and integrating the TetO sequence in the Tet regulation system into the main late promoter region of IVa2; (2) The exogenous gene expression of pAd5-C7 is started by the CMV promoter, and the CuO regulation element of the Cumate regulation system is inserted into the CMV sequence, i.e. CMV(CuO); (3) After the regulation protein TetR gene in the Tet regulation system is connected downstream of CMV(CuO), the E3 region of pAd5 is replaced to obtain the recombinant adenovirus vector.

[0006] It should be noted that in step (1), the integrated design includes the following features: selecting the HAd5 (Gene bank: AC-000008) IVa2 protein region, labeling the 279-297th nucleotide before the IVa2 protein start codon, and replacing the original sequence "CCCCCCTTCAGGAACACCCG" with the TetO sequence "TCTCTATCACTGATAGGGA".

[0007] Preferably, in step (2), the nucleotide sequence of CMV (CuO) is as shown in SEQ ID NO: 1; and / or, The expression frame sequence at E3 is as shown in SEQ ID NO: 2.

[0008] In a third aspect, the present application provides a recombinant adenovirus vector construction platform, which is pAd5-C7 / SacB+β-geo (DY380).

[0009] It should be noted that this platform can be used to quickly and efficiently prepare recombinant adenoviruses inserted with various foreign genes by using the Recombineering technology. The recombinant adenovirus constructed by pAd5-C7 / SacB+β-geo (DY380) can normally replicate and express in permissive cells 293T-CymR. In non-permissive cells without expressing CymR, the expression of adenovirus late proteins is inhibited, and the inhibition mechanism is as shown in Figure 1 .

[0010] In some embodiments, the preparation method of the platform is as follows: (1) inserting the screening gene SacB+β-geo downstream of the CMV (CuO) promoter of pAd5-C7, a preset foreign gene insertion position; (2) selecting blue colonies on LB plates coated with chloramphenicol (25 μg / mL) and kanamycin (25 μg / mL) by blue-white spot screening, extracting the plasmid and then performing Hind III enzyme digestion identification to determine the plasmid integrity; (3) performing Pac I linearization enzyme digestion on the pAd5-C7 / SacB+β-geo with correct enzyme digestion identification, transfecting the linearized recombinant adenovirus fragment into 293T-CymR to perform virus rescue, and performing continuous passage of the rescued rAd5-C7 / SacB+β-geo in 293T-CymR cells, and then taking the continuously passed rAd5-C7 / SacB+β-geo to perform qPCR and WB identification.

[0011] As an embodiment of the present application, the rAd5-C7 capable of inhibiting the expression of late proteins is a replication-defective adenovirus with E1 and E3 double region deletion.

[0012] In a fourth aspect, the present application provides a construction method of the recombinant adenovirus vector construction platform, characterized by comprising the following steps: (1) Based on pAd5-C7, a screening gene SacB+β-geo is inserted into the foreign gene expression frame position of pAd5-C7 to obtain pAd5-C7 / SacB+β-geo; (2) Obtain pAd5 (DY380) bacterial liquid, mix the pAd5-C7 / SacB+β-geo with the pAd5 (DY380) bacterial liquid, perform electrotransformation and incubation to obtain pAd5-C7 / SacB+β-geo (DY380).

[0013] In a fifth aspect, the present application provides an application of the platform in construction of a recombinant adenovirus.

[0014] In a sixth aspect, the present application provides a recombinant adenovirus, named rAd5-C7, which is obtained based on the rescue of the recombinant adenovirus vector.

[0015] In a seventh aspect, the present application provides a preparation method of the recombinant adenovirus, comprising the following steps: (1) The recombinant adenovirus vector is transfected into 293T-CymR cells, and after obvious adenovirus pathological phenomena appear in the cells, the cells are repeatedly freeze-thawed three times to obtain a cell harvest liquid; (2) The obtained cell harvest liquid is continuously subcultured on 293T-CymR cells to rescue the recombinant adenovirus rAd5-C7 / SacB+β-geo or rAd5-C7 / eGFP, and a virus harvest liquid containing virus particles is collected and stored; (3) The virus harvest liquid is expanded and cultured, and purified to obtain the recombinant adenovirus rAd5-C7 / SacB+β-geo or rAd5-C7 / eGFP strain.

[0016] In a seventh aspect, the present application provides a method for determining the expression ability of an exogenous gene and a late protein of the recombinant adenovirus on Vero cells, wherein after the recombinant adenovirus is inoculated on Vero cells, whether the expression time of rAd5-C7 / eGFP is positively correlated with the intensity of the expressed GFP is determined.

[0017] In an eighth aspect, the present application provides an application of the recombinant adenovirus strain in preparation of a production or / and prophylactic or / and therapeutic product.

[0018] Compared with the prior art, the present application has the following beneficial effects: The expression of the IVa2 gene of the rAd5-C7 constructed in the application is regulated by a Tet regulation system, and the expression of TetR and the target gene are both regulated by CMV (CuO). When the constructed rAd5-C7 infects cells that do not express CymR, TetR and the target gene will be expressed together, and after the expression of TetR, TetR will bind to the TetO sequence in the adenovirus genome, thereby inhibiting the expression of the IVa2 protein. The decrease of IVa2 expression will affect the expression of most late proteins of adenovirus, such as Hexon, Fiber, Penton base and pV, etc. At the same time, based on pAd5, the CMV (CuO)-TetR is inserted into the E3 deletion region, and then the SacB+β-geo gene is screened and inserted into the E1 deletion region to obtain the recombinant adenovirus vector pAd5-C7 / SacB+β-geo. Combined with the Recombineering technology, a fast, efficient and universal recombinant adenovirus vector construction platform pAd5-C7 / SacB+β-geo (DY380) is constructed, which can quickly and rapidly prepare the recombinant adenovirus vector pAd5-C7 / eGFP based on pAd5-C7 through resistance screening and blue-white spot screening, and prepare the corresponding recombinant adenovirus rAd5-C7 / eGFP. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 A schematic diagram of the principle of the late protein inhibition of the rAd5-C7 provided by the application; Figure 2 A schematic diagram of the design of different adenovirus vectors provided by the application; Figure 3 A rescue result graph of the rAd5-C7 / SacB+β-geo provided by the application; Figure 4 A WB identification result graph of the rAd5-C7 / SacB+β-geo provided by the application; Figure 5 A fluorescence observation result graph of the rAd5-C7 / eGFP on HEK293T and 293T-CymR provided by the application; Figure 6 A foreign gene expression result graph of different recombinant adenoviruses on non-permissive cells provided by the application; Figure 7 A late protein gene expression result graph of different recombinant adenoviruses on non-permissive cells provided by the application; Figure 8 A genome content graph of different recombinant adenoviruses on non-permissive cells at different time points provided by the application; Figure 9The figure of the titer determination results of the growth ability of different recombinant adenoviruses provided by the present application on HEK293T and 293T-CymR. DETAILED DESCRIPTION

[0020] The technical solutions of the present application will be described clearly and completely in the following combined with the embodiments. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments of the present application, any equivalent transformation or substitution made by those skilled in the art without creative labor according to the following embodiments is within the protection scope of the present application.

[0021] The main reagents and materials used in the embodiments are as follows: The pAd5 plasmid and DY380 bacterial liquid are stored in the Viral Vaccine Research Room of Wuhan Institute of Biological Products Co., Ltd.

[0022] The TetR gene fragment is purchased from the pTet-off-advanced plasmid of Addgene.

[0023] The mouse anti-rAd5 serum is prepared and stored in the Viral Vaccine Research Room of Wuhan Institute of Biological Products Co., Ltd.

[0024] 2×Phanta Max Master Mix (Dye Plus) is purchased from Nanjing Novozyme BioTech Co., Ltd.

[0025] ClonExpress Ultra One Step Cloning Kit (C115-02) is purchased from Nanjing Novozyme BioTech Co., Ltd.

[0026] QIAGEN Plasmid Maxi Kit (25) plasmid extraction kit is purchased from QIAGEN Company in Germany.

[0027] ChamQ Universal SYBR qPCR Master Mix is purchased from Nanjing Novozyme BioTech Co., Ltd.

[0028] Transfection reagent Lipo8000 is purchased from Shanghai Biyun Tian Biological Technology Co., Ltd.

[0029] Restriction endonuclease Pac I and Hind III are purchased from NEB Company in the United States.

[0030] DMEM culture medium is purchased from Invitrogen Gibco Company in the United States.

[0031] Virus DNA straight extension probe method qPCR premix is purchased from Shengong Bioengineering (Shanghai) Co., Ltd.

[0032] MightyScript First-Strand cDNA Synthesis Master Mix was purchased from Shengong Bioengineering (Shanghai) Co., Ltd.

[0033] TaKaRa MiniBEST Viral RNA / DNA Extraction Kit Ver. 5.0 was purchased from Baosite Biotechnology (Beijing) Co., Ltd.

[0034] Fetal bovine serum was purchased from Shengong Bioengineering (Shanghai) Co., Ltd.

[0035] HRP-labeled goat anti-mouse IgG antibody was purchased from Wuhan Dr. Deki Biological Engineering Co., Ltd.

[0036] 293T cells (ATCC® CRL3216) were purchased from ATCC (American Type Culture Collection).

[0037] 293T-CymR cells were prepared and preserved by the Viral Vaccine Research Room of Wuhan Institute of Biological Products Co., Ltd.

[0038] Example 1 1. Establishing a recombinant adenovirus vector construction platform pAd5-C7 / SacB+β-geo (DY380) 1.1 Construction of pAd5-C7 / SacB+β-geo To verify the inhibitory effect of pAd5-C7 after modification on late protein expression, pAd5-C5, pAd5-C6 and pAd5-C7 were designed to be used as controls in subsequent experiments. The construction schematic diagram of the three is shown in Figure 2 SEQ ID NO: 2. The construction of pAd5-C7 / SacB+β-geo was carried out in three steps. First, the SacB+β-geo fragment was inserted into the E3 replacement site. Then, CMV (CuO)-TetR was used to replace SacB+β-geo at E3. Finally, the SacB+β-geo fragment was inserted into the E1 region in Figure 2 .

[0039] 1.1.1 Obtaining E1 and E3 region homologous fragments Reference Figure 2Structure diagram of pAd5-C7. The SacB+β-geo (pAd5-E3), CMV (CuO)-TetR (pAd5-E1) and SacB+β-geo (pAd5-E1) homologous fragments required for recombineering were prepared respectively. 500 μL of pAd5 (DY380) bacterial solution cultured overnight at 30 °C at 180 rpm was inoculated into 10 mL of fresh LC (LB medium with a final concentration of 25 μg / mL of chloramphenicol) liquid medium and cultured at 30 °C at 500 rpm for 2-3 h. When the bacterial solution grew to OD 600 = 0.5-0.6, the bacterial solution was placed in a 42 °C water bath for 15 min.

[0040] 1.1.2 Preparation of electrocompetent cells The heat-treated pAd5 (DY380) bacterial solution was incubated on ice for 10 min. After the incubation was completed, it was transferred to a pre-cooled 15 mL centrifuge tube and centrifuged at 4 °C at 6000 x g for 5 min, and the supernatant was discarded. The collected bacterial cells were resuspended with 10 mL of pre-cooled sterile water, centrifuged under the same conditions, and repeated twice. The bacterial cells after the cold water bath twice were resuspended with 1 mL of pre-cooled sterile water, and the obtained resuspended bacterial solution was ready for use for electroporation.

[0041] 1.1.3 Electroporation of target gene fragments carrying homologous sequences on both sides According to different construction steps, the homologous fragments prepared in 1.1.1 were added to the EP tube at 500 ng / tube, and 200 μL of electrocompetent cells prepared in 1.1.2 was mixed with the gene fragments. After standing for 2-3 min, the standard electroporation program was used for electroporation. After electroporation, 800 mL of SOC was added and incubated at 30 °C at 500 rpm for 1 h.

[0042] 1.1.4 Selection of recombinant adenovirus vectors 3 μL of IPTG solution (1 M) and 50 μL of X-gal solution (20 mg / mL) were mixed in a 1.5 mL EP tube, and then added dropwise to the pre-prepared LC (25)+LK (25) plate containing 25 μg / mL of chloramphenicol and 25 μg / mL of kanamycin, and then evenly coated with a coating rod, and then placed at 30 °C for 1 h. A certain amount of bacterial solution after electroporation in 1.1.3 was coated on the above LC (25)+LK (25) plate, and cultured at 30 °C. After a certain period of time, the colonies were observed, and the blue colonies were considered to be successful replacement of the target fragment into the corresponding vector.

[0043] 1.2 Identification of pAd5-C7 / SacB+β-geo 1.2.1 Verification of the integrity of pAd5-C7 / SacB+β-geo After the target gene insertion of the blue colonies selected in 1.1.4 is identified by PCR, the plasmid is extracted according to the instructions of Plasmid Maxi Kit (25) kit. After the concentration of the extracted plasmid is determined, 10 μg of the plasmid is subjected to restriction enzyme digestion according to the instructions of Hind III, and the enzyme-digested fragments are subjected to electrophoresis on a 0.8% (w / v) nucleic acid gel. The recombination adenovirus vector plasmid is preliminarily judged to be complete according to the plasmid enzyme digestion map.

[0044] 1.2.2 Functional verification of pAd5-C7 / SacB+β-geo 1.2.2.1 Cell preparation After the 293T-CymR cells recovered are subcultured for 1-2 passages, if the cell morphology and growth rate are normal, the cell transfection experiment can be performed. The specific steps are as follows: the 293T-CymR cells are inoculated in the cell culture vessel at a cell density of 3 x 10 5 cells / mL the night before transfection. The next day, when the confluence of the 293T-CymR cells reaches about 30%, the transfection experiment can be performed.

[0045] 1.2.2.2 Linearization and transfection of pAd5-C7 / SacB+β-geo A certain amount of the recombination adenovirus vector pAd5-C7 / SacB+β-geo is subjected to overnight enzyme digestion according to the instructions of the restriction endonuclease Pac I, and then the linearized recombination adenovirus vector fragment is transfected into the 293T-CymR cells prepared in advance according to the instructions of Lipo8000. After 24 h of transfection, the cell state is maintained by using high-glucose DMEM culture medium containing 2% FBS, and after the culture medium turns yellow, the new high-glucose DMEM culture medium containing 2% FBS is replaced. The recombination adenovirus rAd5-C7 / SacB+β-geo is considered to be rescued when obvious CPE appears, which is recorded as P0 generation.

[0046] 1.2.2.3 rAd5-C7 / SacB+β-geo amplification culture The 293T-CymR cells are prepared according to the scheme in 1.2.2.1, and when the confluence of the 293T-CymR cells reaches 60-70%, the cell state is maintained by using high-glucose DMEM culture medium containing 2% FBS. The P0 generation rAd5-C7 / SacB+β-geo is inoculated into the 293T-CymR cells, and after 48 h, when obvious cell lesions are observed, the P1 generation rAd5-C7 / SacB+β-geo is obtained by repeated freeze-thawing. Thereafter, the continuous passage is performed according to the same scheme, and the harvested virus harvests are sequentially marked as P2, P3. The rescue results of the rAd5-C7 / SacB+β-geo are shown in Table 1. Figure 3 ​

[0047] 1.2.2.4 WB identification of rAd5-C7 / SacB+β-geo The rAd5-C7 / SacB+β-geo virus harvests prepared in 1.2.2.3 at different time points were used to identify the adenovirus proteins in the virus harvests according to the standard WB protocol. The HAd5 mouse antisera prepared in the laboratory (dilution 1:2000) was used as the primary antibody, and the HRP-labeled goat anti-mouse IgG (dilution 1:5000) was used as the secondary antibody.

[0048] The results of the WB identification of rAd5-C7 / SacB+β-geo are shown in Figure 4 rAd5 / eGFP was used as the positive control, and HEK293T was used as the negative control. The rAd5 / eGFP lane showed a band of about 60 KDa (similar to the size of the Penton and Fiber proteins), while no corresponding band was detected in the HEK293T lane. According to the β-actin, the amount of sample loaded in the HEK293T lane was higher than that in the rAd5 / eGFP lane, which ruled out the influence of non-specific binding caused by the difference in sample loading. It was considered that the HAd5 mouse antisera could recognize the Penton and / or Fiber proteins of rAd5. The Penton and / or Fiber proteins were detected in the virus harvests of the P0-P3 generations of rAd5-C7 / SacB+β-geo, so it was considered that the recombinant adenovirus rAd5-C7 / SacB+β-geo was successfully rescued. That is, the pAd5-C7 / SacB+β-geo was structurally complete and could successfully rescue the recombinant adenovirus.

[0049] Example 2 1. Construction and rescue of recombinant adenovirus vector pAd5-C7 / eGFP 1.1 Preparation of linearized fragment C7-eGFP According to the sequences on both sides of the foreign gene insertion position in SEQ ID NO: 3, the C7-eGFP fragment for homologous recombination insertion into the E1 foreign gene insertion position was prepared by PCR. It should be noted that since the sequence SEQ ID NO: 3 is too long, it is difficult to upload, so the sequence SEQ ID NO: 3 is divided into 17 segments, as shown in 3-1 to 3-17. Arranging 3-1 to 3-17 in order is the sequence shown in SEQ ID NO: 3.

[0050] 1.2 Construction of recombinant adenovirus vector pAd5-C7 / eGFP Recombineering construction was performed according to the construction protocol of pAd5-C7 / SacB+β-geo in Example 1 1.1 with the C7-eGFP fragment prepared in Example 2 1.1. The difference is that when pAd5-C7 / eGFP was selected, pre-made LC (25 μg / mL) plates containing 10% sucrose were used. After incubation for a certain time, white colonies were considered as successful replacement of C7-eGFP fragment into pAd5-C7 / SacB+β-geo pAd5-C7 / eGFP.

[0051] 1.3 Virus rescue of recombinant adenovirus rAd5-C7 / eGFP Virus rescue of rAd5-C7 / eGFP was performed on 293T-CymR according to the virus rescue protocol of rAd5-C7 / SacB+β-geo in Example 1 1.2.2.

[0052] 2. Identification of recombinant adenovirus rAd5-C7 / eGFP 2.1 Expression identification 293T-CymR and HEK293T cells were prepared according to the protocol of Example 1 1.2.2.1, and the same volume of P3 rAd5-C7 / eGFP virus harvest obtained in Example 2 1.3 1.3.3 was inoculated into the two types of cells, and the expression of green fluorescent protein was observed after 48 h.

[0053] The results of fluorescence observation are shown in Figure 5 The P3 rAd5-C7 / eGFP virus harvest obtained by rescue was inoculated into HEK293T cells, and obvious green fluorescence was observed, while no green fluorescence expression was observed on 293T-CymR cells. This indicates that rAd5-C7 / eGFP was successfully rescued, and rAd5-C7 / eGFP can normally express green fluorescent protein on HEK293T cells that do not express CymR, while the expression of green fluorescent protein is inhibited on 293T-CymR cells that express CymR.

[0054] 2.2 Functional identification of recombinant adenovirus rAd5-C7 / eGFP 2.2.1 rAd5-C7 / eGFP titer determination 2.2.1.1 Cell preparation 293T-CymR cells were cultured to 80-90% confluence, and after digestion, a cell suspension was prepared, which was added to a 96-well plate at 100 μL (1 x 10 5 cells / mL) per well. The 96-well plate was placed in a 37°C, 5% CO2 incubator for incubation, and after 2 h of cell adhesion, the next experiment was performed.

[0055] 2.2.1.2 Virus dilution The rAd5-C7 / eGFP virus harvest to be tested was diluted 10 times by using serum-free high-glucose DMEM maintenance solution, and 10 -1 dilutions were set up. The diluted virus harvest was added to the 96-well plate with cells prepared, 100 μL of virus liquid of different dilutions was added to rows A-H, and 100 μL of DMEM maintenance solution without virus was added to columns 11 and 12 as negative controls. -10

[0056] 2.2.1.3 Observation of cytopathic effect (CPE) From the third day, the cytopathic effect was observed every day, and the number of positive wells of each dilution was recorded. The judgment standard of positive wells was that the cells could detect the expression of green fluorescent protein. The CCID50 of rAd5-C7 / eGFP was calculated according to the number of positive wells corresponding to the dilution.

[0057] 2.2.2 Determination of expression ability of rAd5-C7 / eGFP on non-permissive cells 2.2.2.1 Cell preparation The Vero cells in good growth state were taken, trypsinized, and prepared into cell suspension with DMEM culture solution, and inoculated into 6-well plates at a density of 3 x 10 5 cells / mL, 500 μL / well. When the cell confluence reached 80-90%, the DMEM culture solution in the 24-well plate was replaced with serum-free DMEM maintenance solution.

[0058] 2.2.2.2 Virus inoculation According to the titer of rAd5-C7 / eGFP determined in Example 2 2.2.1, rAd5-C7 / eGFP, rAd5-C6 / eGFP and rAd5-C5 / eGFP were inoculated into the Vero cells prepared in advance at a MOI of 10.

[0059] 2.2.2.3 Green fluorescent intensity determination After rAd5-C7 / eGFP, rAd5-C6 / eGFP and rAd5-C5 / eGFP were inoculated into Vero cells at a MOI of 10, the green fluorescent intensity of different treatment groups was determined at 0 h, 12 h, 24 h, 48 h, 72 h and 96 h. The differences in expression ability of rAd5-C7 / eGFP, rAd5-C6 / eGFP and rAd5-C5 / eGFP on non-permissive Vero cells were compared.

[0060] The exogenous gene expression ability of different recombinant adenoviruses on non-permissive Vero cells was as follows: Figure 6 ​The results show that different adenoviruses all express green fluorescent protein from 24h after inoculation at MOI=10. In the subsequent 24h-96h, the expression amount of green fluorescent protein increases with the increase of expression time. But compared with the three recombinant adenoviruses, the green fluorescent protein expressed by rAd5-C7 / eGFP and rAd5-C6 / eGFP is significantly stronger than that of rAd5-C5 / eGFP at 48h. And the difference in intensity increases with time. At the same time, the expression amount of green fluorescent protein of rAd5-C7 / eGFP is also higher than that of rAd5-C6 / eGFP, indicating that the expression ability of exogenous genes on Vero cells is enhanced, but the specific reason is unknown.

[0061] 2.2.3 rAd5-C7 / eGFP in non-permissive cells on the late protein expression identification The Vero cell samples inoculated with rAd5-C7 / eGFP, rAd5-C6 / eGFP and rAd5-C5 / eGFP at different time points in 2.2.2.3 were taken, and the total RNA of the samples was extracted according to the instructions of Takara RNA extraction kit. After determining the concentration of the extracted RNA, the same amount of RNA was taken, and reverse transcription was carried out according to the instructions of MightyScript first strand cDNA synthesis Master Mix kit. The cDNA obtained by reverse transcription was used as a template for qPCR detection of the expression amount of Hexon protein, Fiber protein, pV protein and Pentonbase protein.

[0062] The late gene expression of different recombinant adenoviruses in non-permissive cells (Vero) is shown in Figure 7 The results show that the mRNA expression of the four late proteins reaches a detectable level from 48h after inoculation. At 72h and 96h after inoculation, the mRNA content of the four late proteins continues to increase with time. Among the different time points that can be detected, the mRNA expression of the four late proteins in Vero cells of rAd5-C7 / eGFP is significantly lower than that of rAd5-C6 / eGFP and rAd5-C5 / eGFP. While there is no significant difference in mRNA content between rAd5-C6 / eGFP and rAd5-C5 / eGFP, indicating that the regulation of late proteins depends on the content of TetR expressed by recombinant adenovirus.

[0063] 2.2.4 Viral genome amplification assay The rAd5-C7 / eGFP, rAd5-C6 / eGFP and rAd5-C5 / eGFP virus harvests were inoculated into Vero cells at MOI=10. Virus harvest samples were collected at 2h, 12h, 24h, 48h, 72h, 96h after inoculation, and qPCR was performed according to the instructions of the virus DNA straight extension probe method qPCR premix (B639280-0005). The relative content of the rAd5-C7 / eGFP genome in the virus harvests at different time points was compared. Forward Primer sequence: ggtcctcctcgtatagaaactcggac, Reverse Primer sequence: cacgtggcctacacctacaaac, Probe sequence: cgaagagggcgacatgtgtcttc. The genome content of different recombinant adenoviruses at different time points in Vero cells is shown in Table 1. Figure 8

[0064] The results show that in the replication non-permissive cell Vero cell, the genome content of the adenovirus gradually decreases over time. The possible reason is that due to the activation of the specific antiviral pathway of Vero cells, and the inability of the recombinant adenovirus to replicate in the cell, the genome of the recombinant adenovirus gradually decreases over time.

[0065] 2.2.5 Growth ability determination of rAd5-C7 / eGFP 2.2.5.1 Virus inoculation According to the scheme in Example 1 1.2.2.1, 293T-CymR cells and HEK293T cells were prepared, and when the cell confluence reached 50-60%, the original culture medium of the cells was removed, and 1 / 2 volume of high-glucose DMEM culture medium containing 1% FBS was added. rAd5-C7 / eGFP, rAd5-C6 / eGFP and rAd5-C5 / eGFP were inoculated into the cells at MOI=10, and were incubated in a 37°C, 5% CO2 incubator. After 3-4 hours, high-glucose DMEM culture medium containing 10% FBS was added for continued incubation.

[0066] 2.2.5.2 Titer determination According to the scheme in Example 2 2.2.4.1, samples were collected at 2h, 6h, 12h, 18h, 24h, 36h, 48h and 72h after inoculation. After repeated freezing and thawing three times, the samples were centrifuged at 3000 rpm for 10 min at 4°C, and the supernatant was collected as the virus harvest. The virus harvests of rAd5-C7 / eGFP, rAd5-C6 / eGFP and rAd5-C5 / eGFP at different time points were subjected to titer determination according to the scheme in Example 22.2.1.

[0067] ​The results of the growth ability determination of different recombinant adenoviruses on HEK293T and 293T-CymR are shown in Table 1. Figure 9

[0068] The results show that, compared with rAd5-C5 / eGFP and rAd5-C6 / eGFP, the growth ability of rAd5-C7 / eGFP on HEK293T and 293T-CymR cells shows obvious difference. The growth ability on HEK293T cells is significantly lower than that on 293T-CymR cells since 36h after inoculation of rAd5-C7 / eGFP. It shows that rAd5-C7 / eGFP shows a certain self-limiting property, while the CymR expressed by 293T-CymR can inhibit the expression level of rAd5-C7 / eGFP TetR, thereby removing the self-limiting property of rAd5-C7 / eGFP, so that it can normally replicate and multiply.

[0069] The specific raw materials in the present application are all existing substances, which can be directly purchased from the market.

[0070] The above is only the preferred embodiment of the present application, and is not used to limit the protection scope of the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.​

Claims

1. A recombinant adenoviral vector, characterized in that, A recombinant human adenovirus type 5 based adenovirus vector for regulating late protein expression, named pAd5-C7.

2. The method of constructing a recombinant adenoviral vector according to claim 1, wherein, The method comprises the following steps: (1) selecting the IVa2 protein of adenovirus as a regulation target, and integrating the TetO sequence in the Tet regulation system into the main late promoter region of IVa2; (2) the pAd5-C7 exogenous gene expression is started by a CMV promoter, and the CuO regulation element of the Cumate regulation system is inserted into the CMV sequence, namely CMV(CuO); (3) after the regulation protein TetR gene in the Tet regulation system is connected downstream of CMV(CuO), the E3 region of pAd5 is replaced, and a recombinant adenovirus vector is obtained.

3. The method of claim 2, wherein, In step (2), the nucleotide sequence of CMV(CuO) is shown as SEQ ID NO: 1; and / or, The expression frame sequence at E3 is shown as SEQ ID NO:

2.

4. A recombinant adenoviral vector construction platform, characterized in that, The platform is pAd5-C7 / SacB+β-geo (DY380).

5. The method of constructing a recombinant adenoviral vector platform according to claim 4, wherein, The method comprises the following steps: (1) based on pAd5-C7, a screening gene SacB+β-geo is inserted into the pAd5-C7 exogenous gene expression frame position to obtain pAd5-C7 / SacB+β-geo; (2) obtain pAd5 (DY380) bacterial liquid, mix the pAd5-C7 / SacB+β-geo with the pAd5 (DY380) bacterial liquid, perform electric transformation, and incubate to obtain pAd5-C7 / SacB+β-geo (DY380).

6. The platform according to claim 4 is applied to construction of a recombinant adenovirus.

7. A recombinant adenovirus, characterized in that, The platform is named rAd5-C7 and is rescued based on the recombinant adenovirus vector according to claim 1.

8. The method for preparing recombinant adenovirus according to claim 7, characterized in that, The method comprises the following steps: (1) the recombinant adenovirus vector is transfected into 293T-CymR cells, and after obvious adenovirus pathological phenomena appear in the cells, the cells are repeatedly freeze-thawed three times to obtain a cell harvest liquid; (2) the obtained cell harvest liquid is continuously subcultured on 293T-CymR cells to rescue the recombinant adenovirus rAd5-C7 / SacB+β-geo or rAd5-C7 / eGFP, and a virus harvest liquid containing virus particles is collected and stored; (3) the virus harvest liquid is expanded and cultured, and purified to obtain the recombinant adenovirus rAd5-C7 / SacB+β-geo or rAd5-C7 / eGFP strain.

9. The method of claim 7, wherein the recombinant adenovirus is assayed for the ability to express foreign genes and late proteins in Vero cells. After the recombinant adenovirus is inoculated on Vero cells, whether the GFP intensity of rAd5-C7 / eGFP expression is positively correlated with the expression time is determined.

10. The recombinant adenovirus strain according to claim 7 is applied to preparation of a production or / and prevention or / and treatment product.

Images