Application of the crucian carp wisp1 gene in regulating intermuscular spine development in fish
By knocking out specific target sites in the crucian carp wisp1a and wisp1b genes using CRISPR/Cas9 gene editing technology, a crucian carp wisp1 mutant was constructed. This solved the problems of cumbersome operation and low mutation rate in existing technologies, and achieved a highly efficient and simple method to reduce intramuscular spines.
Patent Information
- Application Number
- CN202511447160.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-11
- Publication Date
- 2026-01-06
- Estimated Expiration
- 2045-10-11
AI Technical Summary
Existing technologies for constructing barbless silver carp are labor-intensive, time-consuming, and cumbersome, with low mutation rates, relying on gynogenesis, and have high technical barriers, so the mutation rate needs to be improved.
By using CRISPR/Cas9 gene editing technology to knock out specific target sites on exon 5 of the crucian carp wisp1a gene and exon 4 of the wisp1b gene, and by co-injecting sgRNA and Cas9 protein into crucian carp embryos, wisp1a+/-, wisp1b+/-, and wisp1a+/-+wisp1b+/- mutants were constructed to reduce the number of intermuscular spines.
It was achieved that mutants with a significant reduction in the number of intramuscular spines could be obtained directly in the F0 generation. The operation is simple, the cycle is short, the efficiency is high, the mutation rate is improved, and it does not rely on gynogenesis. The number of intramuscular spines is reduced by 95.8%.
Smart Images

Figure CN120905318B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the application of a gene, specifically the application of the crucian carp wisp1 gene in regulating the development of intermuscular spines in fish, and belongs to the field of functional genomics technology. Background Technology
[0002] Intermuscular spines are small, needle-like bones located in the diaphragm tissue of bony fish. They are commonly found in most freshwater fish, especially farmed cyprinids such as crucian carp, grass carp, and silver carp. The presence of intermuscular spines negatively impacts the economic and edible value of fish; therefore, genetic improvement of intermuscular spines has become an important goal in fish genetic breeding.
[0003] In recent years, a series of genetic breeding studies have been conducted on fish with no or reduced intermuscular spines, for example:
[0004] Chinese invention patent CN110684777B discloses that by knocking out the zebrafish scxa gene using CRISPR / Cas9 gene editing technology, a zebrafish strain with a reduction of more than 70% in the number of intramuscular spines can be obtained.
[0005] Chinese invention patent CN112772468B discloses that by knocking out the zebrafish bmp6 gene using CRISPR / Cas9 gene editing technology, a zebrafish mutant with completely absent intermuscular spines can be obtained.
[0006] Chinese invention patent CN115943930B discloses a method to knock out the runx2b-A and runx2b-B genes of silver carp using CRISPR / Cas9 gene editing technology, inject sgRNA and Cas9 mRNA into mature eggs, and then fertilize the injected eggs with sperm from Xingguo red carp to perform gynogenesis, thereby obtaining silver carp without intermuscular spines.
[0007] Chinese invention patent CN115720874B discloses that by knocking out the runx2b gene in blunt snout bream using CRISPR / Cas9 gene editing technology, blunt snout bream without intermuscular spines can be obtained.
[0008] Zebrafish are small, easy to raise, have a short development cycle, and high reproductive capacity, making them important experimental models for vertebrates. Currently, genetic breeding research on the development of intermuscular spines mainly focuses on the zebrafish as a model fish, while research on farmed fish is limited to crucian carp and blunt snout bream.
[0009] However, in constructing a spineless silver carp, Chinese invention patent CN115943930B not only requires injecting a mixture of sgRNA and Cas9 mRNA containing two specific knockout target sites, runx2b-A and runx2b-B, into the silver carp eggs, but also requires the injected eggs to be fertilized with Xingguo red carp sperm to obtain the F0 generation through gynogenesis. Furthermore, it is necessary to select silver carp with a reduced number of intermuscular spines from the F0 generation and obtain the F1 generation through gynogenesis again. Only in the F1 generation will the desired spineless silver carp appear. The entire construction process is labor-intensive, time-consuming, and cumbersome. It relies on gynogenesis and requires inducing gynogenesis through Xingguo red carp sperm to obtain the F0 generation. This is a special and technically demanding breeding operation, which increases technical barriers and uncontrollable factors. Most importantly, compared with normal wild-type silver carp with intermuscular spines, about 40.0% (n=34 / 88) of the runx2b-A and runx2b-B mutant silver carp in the F0 generation showed partial absence of intermuscular spines, and about 68% (n=291 / 432) of the runx2b-A and runx2b-B mutant silver carp in the F1 generation showed complete absence of intermuscular spines. The mutation rate needs to be improved. Summary of the Invention
[0010] To address the shortcomings of existing technologies, the present invention aims to: discover new genes related to fish skeletal development from fish genes, and based on these genes, utilize CRISPR / Cas9 gene editing technology to provide a method for regulating the development of intermuscular spines in fish that significantly reduces workload, is simpler and faster to operate, and has a higher mutation rate.
[0011] To achieve the above objectives, the present invention adopts the following technical solution:
[0012] The application of the crucian carp wisp1 gene in regulating the development of intermuscular spines in fish. The crucian carp wisp1 gene has two copies, namely the wisp1a gene and the wisp1b gene. Knocking out the specific target point on the 5th exon of the wisp1a gene as shown in SEQ ID NO: 1 and the specific target point on the 4th exon of the wisp1b gene as shown in SEQ ID NO: 2 can reduce the number of intermuscular spines in fish.
[0013] The method for regulating intermuscular spine development in fish using the aforementioned crucian carp wisp1 gene includes the following steps:
[0014] (1) PCR amplification was performed using the upstream and downstream primers of the wisp1a gene or the wisp1b gene sgRNA, wherein the sequence of the upstream primer of the wisp1a gene sgRNA is shown in SEQ ID NO: 3, the sequence of the upstream primer of the wisp1b gene sgRNA is shown in SEQ ID NO: 4, and the sequence of the downstream primer of the wisp1a gene and the wisp1b gene sgRNA is shown in SEQ ID NO: 5;
[0015] (2) Mix the in vitro transcribed sgRNA and Cas9 protein at a molar ratio of 3:1, incubate at room temperature, add phenol red, and co-inject the wsp1a gene target and wsp1b gene target into crucian carp embryos to obtain wsp1a. + / - +wisp1b + / - The mutant has a reduction of more than 95% in the number of intermuscular spurs.
[0016] Preferably, in step (1), the amplification system is 50 μL, specifically including: 25 μL of 2×Phusion Flash high-fidelity PCR premix, 2 μL of upstream primer with a concentration of 10 μM, 2 μL of downstream primer with a concentration of 10 μM, and 21 μL of sterile water.
[0017] Preferably, in step (1), the amplification program is as follows: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 60℃ annealing for 10s, 72℃ extension for 15s, 34 cycles; 72℃ extension for 5min.
[0018] Preferably, in step (2), the final concentration of sgRNA is greater than 50 ng / μL.
[0019] Preferably, in step (2), the father and mother of the crucian carp embryo are both 2-year-old crucian carp that are well-grown and sexually mature, and the father and mother are artificially induced to produce and inseminate to obtain crucian carp embryos.
[0020] Preferably, in step (2), the crucian carp embryo is a single-cell embryo.
[0021] The advantages of this invention are:
[0022] (1) This invention successfully constructed crucian carp wisp1a using CRISPR / Cas9 gene editing technology. + / - wisp1b + / - and wisp1a + / - +wisp1b + / -The mutants (F0 generation) had mutation rates of 59.38%, 81.25%, and 43.75%, respectively. This enabled the direct acquisition of mutants with a significant reduction in the number of intermuscular spines in the F0 generation without relying on the complex process of gynogenesis. The entire construction process is simpler, shorter, and more efficient.
[0023] (2) Phenotypic analysis showed that wisp1a + / - The mutant had a 72.2% reduction in the number of intermuscular spikes, wisp1b + / - The mutant had a 22.2% reduction in the number of intermuscular spikes, wisp1a + / - +wisp1b + / - The mutants exhibited the most significant phenotype, with a 95.8% reduction in the number of intermuscular spines (p<0.05).
[0024] (3) Molecular mechanism studies have shown that wisp1a + / - +wisp1b + / - The expression of skeletal development-related genes (bmp6a, bmp6b, runx2b, sp7, alpl) was significantly altered in the mutant (p<0.05).
[0025] (4) This invention reveals for the first time that the crucian carp wisp1 gene is related to fish skeletal development and establishes the first fish wisp1 double gene mutation model. This not only provides new insights into the molecular mechanism of intermuscular spine development in fish, but also lays the foundation for its role in reproduction. Future research can further explore the potential function of the wisp1 gene in fish reproduction. Attached Figure Description
[0026] Figure 1 This is a schematic diagram of the structure and target location of the crucian carp wisp1a and wisp1b genes. In the diagram, red text indicates the target sequence, black text with underlined lines indicates the PAM region, black rectangles indicate exons, and thick black lines indicate introns.
[0027] Figure 2 The images show the results of polyacrylamide gel electrophoresis of PCR products from F0 generation embryos 48 hours after injection. The left image shows the results of polyacrylamide gel electrophoresis of PCR products targeting the wisp1a gene, and the right image shows the results of polyacrylamide gel electrophoresis of PCR products targeting the wisp1b gene. M is the marker, WT is the wild type, 01-05 are the test samples, and the samples within the red box are mutant samples.
[0028] Figure 3 This is a Sanger sequencing result of PCR products from F0 embryos 48 hours after injection. The bases within the black boxes are the target sites.
[0029] Figure 4 It is wild-type (WT) and wisp1a + / - wisp1b + / - wisp1a + / - +wisp1b + / - Images of the results of Alizarin Red staining on the back and tail of adult mutant crucian carp. The left column shows the results of Alizarin Red staining on the back, and the right column shows the results of Alizarin Red staining on the tail. The black arrows point to the intermuscular spines, and the boxes indicate the locations of malformations. The scale bar is 50 μm.
[0030] Figure 5 It is wild type and wisp1a + / - wisp1b + / - The predicted tertiary structure of WISP1 protein in mutant crucian carp;
[0031] Figure 6 Different skeletal development-related genes in wild-type and wisp1a + / - +wisp1b + / - The graph shows the relative expression levels of mutant crucian carp individuals. In the graph, * indicates p<0.05 and ** indicates p<0.01. Detailed Implementation
[0032] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.
[0033] I. Experimental fish and fertilized eggs
[0034] The fish used in the experiment was crucian carp (Carassius auratus), which was farmed on Chongming Island in the lower reaches of the Yangtze River in Shanghai.
[0035] The experiment used two-year-old male and female parents who were in good growth and sexual maturity. Fertilized eggs were obtained after artificial induction of labor and insemination.
[0036] II. Knocking out the wisp1 gene
[0037] 1. Design gRNA
[0038] Download the DNA sequence of the crucian carp wisp1 gene (which encodes Wnt1-inducible signaling pathway protein 1, WISP1) from the NCBI website.
[0039] In the genome of crucian carp used in the experiment, the wisp1 gene has two copies, namely the wisp1a gene and the wisp1b gene, both of which contain 5 exons.
[0040] Based on the principles of gene editing target design, the online target site GGN was designed using ChopChop (https: / / chopchop.cbu.uib.no / ). 18 NGG sequences (including PAM sequences) were individually compared using BLAST on the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) to select targets with high specificity.
[0041] After screening, such as Figure 1 As shown, the target on exon 5 of the wisp1a gene has good specificity, and the sequence of the target is: 5'-CGAACGGATCCGGCTTCACC-3' (SEQ ID NO: 1); the target on exon 4 of the wisp1b gene has good specificity, and the sequence of the target is: 5'-CTCAAAGACCTGTGGGCGGG-3' (SEQ ID NO: 2).
[0042] After target screening was completed, gRNAs were designed using primer software based on primer design principles, targeting specific targets on exon 5 of the wisp1a gene (SEQ ID NO: 1) and on exon 4 of the wisp1b gene (SEQ ID NO: 2).
[0043] The upstream primers for the sgRNAs of the wisp1a and wisp1b genes were designed as follows: GATCACTAATACGACTCACTATA+GGNx+GTTTTAGAGCTAGAAATAGC. Here, GGNx represents the gene knockout target site, the sequence preceding the target site (GATCACTAATACGACTCACTATA) is the T7 promoter sequence, and the sequence following the target site (GTTTTAGAGCTAGAAATAGC) is the 5' end sequence of the gRNA backbone. The specific sequences of the upstream primers for the wisp1a and wisp1b gene sgRNAs are as follows:
[0044] The upstream primer sequence for the wisp1a gene sgRNA is: GATCACTAATACGACTCACTATACGAACGGATCCGGCTTCACCGTTTTAGAGCTAGAAATAGC (SEQ ID NO: 3).
[0045] The upstream primer sequence for the wisp1b gene sgRNA is: GATCACTAATACGACTCACTATACTCAAAGACCTGTGGGCGGGGTTTTAGAGCTAGAAATAGC (SEQ ID NO: 4).
[0046] The downstream primers for the sgRNAs of the wisp1a and wisp1b genes were designed as follows: GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (SEQ ID NO: 5). Among them, GCTATTTCTAGCTCTAAAAC is a sequence complementary to the 5' end sequence of the gRNA backbone.
[0047] 2. Synthesize gRNA
[0048] PCR amplification was performed using upstream (10 μM) and downstream (10 μM) primers for sgRNA.
[0049] The amplification system is 50 μL, specifically consisting of: 25 μL 2×Phusion Flash high-fidelity PCR premix, 2 μL of 10 μM upstream primer, 2 μL of 10 μM downstream primer, and 21 μL sterile water.
[0050] The amplification program was as follows: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 60℃ annealing for 10s, 72℃ extension for 15s, 34 cycles; 72℃ extension for 5min.
[0051] The obtained PCR products were subjected to 2% agarose gel electrophoresis. After verifying that the band size was correct, the PCR products were purified and recovered, and the concentration was measured using Nanodrop 2000 (Thermo Scientific, USA).
[0052] RNA was transcribed in vitro using the mMESSAGE mMACHINE® T7 Ultra (Thermo Scientific, USA) kit, and then the sgRNA was purified and recovered using the RNA purification kit (ZYMO, USA).
[0053] Take out 1 μL to measure the RNA concentration, and then check the quality of the RNA by 2% agarose gel electrophoresis before storing it at -80℃ for later use.
[0054] 3. Microinjection
[0055] The in vitro transcribed sgRNA and Cas9 protein were mixed at a molar ratio of 3:1 and incubated at room temperature for 10 min. Then, phenol red was added, and the wisp1a and wisp1b gene targets were injected individually or co-injected into single-cell stage crucian carp embryos.
[0056] The final concentration of sgRNA was greater than 50 ng / μL. The control group was injected with 25% phenol red, and at the same time, uninjected embryos from the same batch were collected as blank control group.
[0057] 4. Detect target mutation rate
[0058] Forty-eight hours after injection of F0 embryos, 20 embryos were selected from each of the following groups: single injection of wisp1a gene target group, single injection of wisp1b gene target group, co-injection of wisp1a and wisp1b gene target groups, and control group. Twenty uninjected embryos from the same batch were selected as the blank control group. Genomic DNA was rapidly extracted from the embryos using a lysis method. 50 μL of lysis buffer (Tris 10 mM, KCl 50 mM, 0.3% Tween-20, 0.3% NP40, and proteinase K 0.5 mg / mL) was added to the embryos to be lysed. The samples were digested using a PCR instrument, first at 55℃ for 50 min, and then at 98℃ for 10 min.
[0059] After lysis, the mixture was vortexed and centrifuged. The supernatant was used as a template for PCR amplification. A 20 μL amplification system was prepared, and the target amplification detection primers were used to amplify the sequence near the target site. The amplification program was the same as that for sgRNA PCR amplification. The target amplification detection primers are shown in Table 1.
[0060] Table 1 Primer sequences for target amplification detection
[0061]
[0062] The amplification products were detected by polyacrylamide gel electrophoresis (PAGE). If the knockout of the target site was effective, the PCR product would show multiple bands on the electrophoresis; otherwise, it would only show a single band.
[0063] If the PCR product is subjected to Sanger sequencing and there are overlapping peaks near the target site in the peak pattern, then the target site has been successfully knocked out.
[0064] The results of PAGE electrophoresis of the amplification products are shown in the figure. Figure 2 Sanger sequencing results can be found Figure 3 .
[0065] Depend on Figure 2 and Figure 3 It can be seen that effective mutations have occurred at the target sites of both the crucian carp wisp1a and wisp1b genes.
[0066] According to statistics, single knockout of the wisp1a gene (wisp1a) + / - ), wisp1b gene single knockout (wisp1b) + / - Double knockout of wisp1a and wisp1b genes (wisp1a) + / - +wisp1b + / - The mutation rates were 59.38%, 81.25%, and 43.75%, respectively.
[0067] The sequence sequencing results of the crucian carp wisp1 gene-edited mutant are shown in Tables 2-1, 2-2 and 2-3.
[0068] Table 2-1 Sequence of single knockout mutant of wisp1a gene in crucian carp
[0069]
[0070] Table 2-2 Sequences of single knockout mutants of the crucian carp wisp1b gene
[0071]
[0072] Table 2-3 Sequences of double knockout mutants of wisp1a and wisp1b genes in crucian carp
[0073]
[0074] Tables 2-1, 2-2, and 2-3 show that the mutation types include base deletions and point mutations, and the mutation patterns of the two target sites are different.
[0075] III. Observation of Bone Staining
[0076] After the embryos develop into adult fish, wild-type crucian carp and the selected wisp1a were analyzed. + / - wisp1b + / - wisp1a + / - +wisp1b + / - Twenty adult mutant crucian carp were randomly selected for whole-skeleton staining with alizarin red, and the number of missing intermuscular spines was counted. The data were then analyzed using GraphPad Prism8 software.
[0077] The method for staining the entire skeleton of adult crucian carp with alizarin red is as follows:
[0078] (1) The fish were kept in a 4% (w / v) paraformaldehyde (PFA) solution for 72 hours;
[0079] (2) After PFA treatment, the fish were washed with water for 30 minutes, and then treated in bleaching solution (a mixture of hydrogen peroxide solution and potassium hydroxide solution, with a final concentration of 1.5% (w / v) for hydrogen peroxide and a final concentration of 1% (w / v) for potassium hydroxide) for 3 hours.
[0080] (3) After bleaching, wash the fish with water for 30 minutes, and then treat it in a saturated sodium tetraborate solution for 15±1 hours.
[0081] (4) After the sodium tetraborate treatment was completed, the fish were stained in a mixed solution of 1% (w / v) alizarin red and 1% (w / v) KOH for 8 hours;
[0082] (5) After the mixed solution treatment is completed, rinse the fish in 20% (v / v) Tween-20 solution for 15±1h, and then remove the scales;
[0083] (6) After removing the scales, the fish body was treated with gradient glycerol to make it transparent. Then the skeleton was observed under a microscope and the number of intermuscular spines was counted. The fish was then stored in 100% glycerol.
[0084] Wild type and wisp1a + / - wisp1b + / - wisp1a + / - +wisp1b + / - The results of alizarin red skeletal staining of the back and tail of adult mutant crucian carp are shown in the figure. Figure 4 .
[0085] Depend on Figure 4 It can be seen that compared with the wild type, (30 dph)wisp1a + / - wisp1b + / - and wisp1a + / - +wisp1b + / - The number of intramuscular spines in the mutant crucian carp was significantly reduced, and varying degrees of spinal curvature and deformity were observed.
[0086] Wild type and wisp1a + / - wisp1b + / - wisp1a + / - +wisp1b + / - The statistical results of the number of intermuscular spines on the back and tail of adult mutant crucian carp are shown in Table 3.
[0087] Table 3. Number of intermuscular spines on the back and tail of wild-type and mutant adult crucian carp
[0088]
[0089] Table 3 shows that, compared with the wild type, wisp1a + / - wisp1b + / - wisp1a + / - +wisp1b + / - The number of intermuscular spines on the back and tail of the mutant crucian carp was reduced by 72.2%, 22.2%, and 95.8%, respectively (p<0.05).
[0090] IV. Predicting Protein Tertiary Structure
[0091] wild type and wisp1a + / - wisp1b + / -The wisp1 gene sequence of mutant crucian carp was used to predict the protein tertiary structure using the SWISS MODEL website (https: / / swissmodel.expasy.org / ).
[0092] Wild type and wisp1a + / - wisp1b + / - The predicted tertiary structure of the WISP1 protein in mutant crucian carp is shown in the figure. Figure 5 .
[0093] Depend on Figure 5 It is known that mutations in the wisp1 gene lead to significant changes in the tertiary conformation of the WISP1 protein, which may be the key structural basis affecting the function of the WISP1 protein.
[0094] V. Real-time quantitative PCR
[0095] To further explore the molecular mechanism by which the wisp1 gene regulates the development of intermuscular spines in fish, the expression of five genes (bmp6a, bmp6b, runx2b, sp7, and alpl) related to fish skeletal development was verified by qRT-PCR.
[0096] Wild type and wisp1a + / - +wisp1b + / - After anesthetizing adult mutant crucian carp with ethyl m-aminobenzoate methanesulfonate (MS-222, 100 mg / L), tail muscle tissue was collected (n=6). The samples were flash-frozen in liquid nitrogen and stored in an ultra-low temperature freezer at -80℃ for later use.
[0097] Total RNA was extracted using the Trizol method, and cDNA was synthesized using the PrimeScript RT reagent Kit (TAKARA).
[0098] Specific primers for bone development-related genes (bmp6a, bmp6b, runx2b, sp7, alpl) were designed according to the principles of qRT-PCR primer design. Detection was performed using the SYBR Green (TB Green Premix Ex Taq II, TaKaRa) method in a Real-time PCR detection system, with β-actin as an internal reference gene. The qPCR primer sequences for bone development-related genes are shown in Table 4.
[0099] Table 4. qPCR primer sequences for genes related to bone development
[0100]
[0101] Amplification program: 95℃ pre-denaturation for 30s; 95℃ denaturation for 5s, 60℃ annealing for 30s, 72℃ extension for 15s, 40 cycles; 72℃ extension for 5min.
[0102] Use 2 -∆∆ct The relative gene expression levels were calculated using the method, and a one-way ANOVA analysis was performed using GraphPad Prism. The results are expressed as mean ± standard error, and the significance level was set at p < 0.05.
[0103] Different skeletal development-related genes in wild-type (WT) and wisp1a + / - +wisp1b + / - The results of relative expression level detection in mutant crucian carp individuals are shown below. Figure 6 .
[0104] Depend on Figure 6 It can be seen that compared with the wild type, wisp1a + / - +wisp1b + / - The expression levels of genes related to skeletal development in adult mutant crucian carp were significantly altered (p<0.05).
[0105] The above results confirm that the crucian carp wisp1 gene participates in the molecular regulatory network for intermuscular spine formation by regulating the expression of multiple skeletal development-related genes.
[0106] In summary, this invention successfully constructed the crucian carp wisp1a gene using CRISPR / Cas9 gene editing technology. + / - Mutant (mutation rate 59.38%), wisp1b + / - Mutants (mutation rate 81.25%) and wisp1a + / - +wisp1b + / - Mutant (mutation rate 43.75%). Phenotypic analysis showed: wisp1a + / - The mutant had a 72.2% reduction in the number of intermuscular spikes, wisp1b + / - The mutant had a 22.2% reduction in the number of intermuscular spikes, wisp1a + / - +wisp1b + / - The mutant exhibited the most significant phenotype, with a 95.8% reduction in intermuscular spikes (p<0.05). Molecular mechanism studies revealed that wisp1a + / - +wisp1b + / - The expression of skeletal development-related genes (bmp6a, bmp6b, runx2b, sp7, alpl) was significantly altered in the mutant (p<0.05).
[0107] This invention reveals for the first time that the wisp1 gene in crucian carp is related to fish skeletal development and establishes the first fish wisp1 double gene mutation model. This not only provides new insights into the molecular mechanism of intermuscular spine development in fish, but also lays the foundation for its role in reproduction. Future research can further explore the potential function of the wisp1 gene in fish reproduction.
[0108] It should be noted that the above embodiments are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. Those skilled in the art can make other variations or modifications based on the above description. It is impossible to exhaustively list all possible implementations here. All obvious variations or modifications derived from the technical solutions of this invention are still within the scope of protection of this invention.
Claims
1. Application of the crucian carp wisp1 gene in regulating the development of fish myomere spines, characterized in that, The crucian wisp1 gene has two copies, wisp1a gene and wisp1b gene, and knocking out the specific target site shown as SEQ ID NO: 1 on the 5th exon of the wisp1a gene and the specific target site shown as SEQ ID NO: 2 on the 4th exon of the wisp1b gene can reduce the number of fish intermuscular spines, and the fish is crucian.
2. The method for regulating the development of the intermuscular spine of fish by using the wisp1 gene of Carassius auratus according to claim 1, wherein the fish is Carassius auratus. The method comprises the following steps: (1) PCR amplification is performed using the upstream primer and the downstream primer of the wisp1a gene sgRNA or the wisp1b gene sgRNA, wherein the sequence of the upstream primer of the wisp1a gene sgRNA is shown as SEQ ID NO: 3, the sequence of the upstream primer of the wisp1b gene sgRNA is shown as SEQ ID NO: 4, and the sequence of the downstream primer of the wisp1a gene sgRNA and the wisp1b gene sgRNA is shown as SEQ ID NO: 5; (2) Mix the in vitro transcribed sgRNA and Cas9 protein according to the molar concentration ratio of 3:1, incubate at room temperature, add phenol red, and co-inject the wisp1a gene target and the wisp1b gene target into the crucian carp embryos to obtain wisp1a + / - +wisp1b + / - mutants, the number of which is reduced by more than 95%.
3. The method of claim 2, wherein, In step (1), the amplification system is 50 μL, and specifically comprises: 25 μL of 2×Phusion Flash high-fidelity PCR premix, 2 μL of the upstream primer with a concentration of 10 μM, 2 μL of the downstream primer with a concentration of 10 μM, and 21 μL of sterile water.
4. The method of claim 2, wherein, In step (1), the amplification program is as follows: 98°C pre-denaturation for 30 s; 98°C denaturation for 10 s, 60°C annealing for 10 s, 72°C extension for 15 s, 34 cycles; and 72°C extension for 5 min.
5. The method of claim 2, wherein, In step (2), the final concentration of the sgRNA is greater than 50 ng / μL.
6. The method of claim 2, wherein, In step (2), the male and female parents of the crucian embryos are both 2-year-old crucians that are well-grown and sexually mature, and the crucian embryos are obtained after artificial induced parturition and insemination of the male and female parents.
7. The method of claim 2, wherein, In step (2), the crucian embryos are single-cell stage embryos.
Citation Information
Patent Citations
Application of a separated nucleotide sequence in the construction of zebrafish with reduced intermuscular spines
CN110684777B
Breeding methods for new varieties of normally developed fish without intermuscular bones
CN112772468B
Creation and application of intermuscular spineless germplasm for cultured economic fish
CN115720874B
A method for producing silver crucian carp without intramuscular spines
CN115943930B
Method for creating intermuscular spiny prussian carp
CN115943930A