Dual Rt-RAA detection probe primer group for rapidly identifying goat and sheep, product and detection method

Abstract

The invention provides a dual Rt-RAA detection probe primer group for rapidly identifying goats and sheep, a product and a detection method, and belongs to the technical field of gene detection. According to the invention, primers and probes are designed for specific regions (Cytb genes) of sheep and goat mitochondrial DNA, a dual Rt-RAA detection method for rapidly identifying goat and sheep is constructed, the method can synchronously and specifically distinguish and detect goat and sheep Cytb genes, the detection efficiency is remarkably improved, detection can be completed within 30 minutes, and the detection time is shortened. The detection limit of sheep and goats reaches 0.5%, the stability is good, cross reaction with common meat such as cattle, pigs and ducks is avoided, the detection efficiency is improved, the detection cost is saved, and the accuracy of the detection result is also improved. Moreover, along with the development of a portable fluorescent quantitative instrument, the method has a wide application prospect, and another reliable, rapid and accurate animal origin detection method is provided for primary laboratories and field experiments.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of gene detection, and particularly relates to a double Rt-RAA detection probe primer set for rapidly identifying goats and sheep, a product and a detection method. BACKGROUND

[0002] With the increasing prominence of global food safety issues, the regulatory requirements for food authenticity and traceability of various countries are constantly upgraded. For example, the European Union General Food Law clearly stipulates that the food supply chain must ensure the authenticity and traceability of food to prevent food fraud and adulteration.

[0003] PCR and its derivative technologies are usually considered as the preferred method for meat detection due to their high sensitivity and specificity, and are widely used in species identification, including traditional PCR, real-time quantitative PCR (Rt-qPCR), digital PCR and corresponding multiplex PCR. Among them, traditional PCR technology realizes identification by amplifying species-specific DNA fragments, but needs to analyze the amplification products by electrophoresis, which is complicated and time-consuming. Real-time quantitative PCR technology, although does not need to analyze the amplification products by electrophoresis, is often used as the "gold standard" for animal component detection, but like digital PCR, it requires high professional level of the operator and relies on expensive variable temperature instruments, which limits its wide application in basic laboratories. Multiplex PCR technology can detect multiple target genes at the same time, but its primer design is complex, non-specific amplification is easy to occur, the overall amplification efficiency is low, and it also needs to rely on variable temperature instruments for amplification.

[0004] In recent years, the emerging isothermal amplification techniques, such as loop-mediated isothermal amplification (LAMP) and recombinase-aided amplification (RAA), have become the first choice to replace PCR amplification of DNA due to their simple operation, rapid reaction and the absence of complex equipment. However, LAMP technology requires the design of multiple sets of primers to achieve nucleic acid amplification under constant temperature conditions, which is complex and prone to non-specific amplification, affecting the accuracy of the detection results. In contrast, RAA technology uses recombinase and single-stranded DNA binding protein to achieve rapid amplification of target DNA fragments under constant temperature conditions, significantly reducing detection costs and time. Real-time fluorescent RAA technology (Rt-RAA) can monitor the amplification of products in real time by introducing an exonuclease (exo) probe into the reaction system, further improving the sensitivity and specificity of the detection.

[0005] Goat (Capra hircus) and sheep (Ovis aries) are important sources of meat, and the authenticity and safety of their meat products are directly related to the health and rights of consumers. Goats grow slowly, have a low reproduction rate, and have high requirements for feeding environments, resulting in limited production. Compared with sheep, goats not only have lower fat content, but also have tight and flavorful meat, which is favored by consumers, and the market price is significantly higher than that of sheep meat. However, due to the high similarity between goats and sheep in appearance, genetic background, and biological characteristics, traditional identification methods have significant limitations in practical applications. Especially in deep-processed meat products, when the morphological characteristics are destroyed, the identification difficulty is significantly increased. In recent years, some unscrupulous businessmen have taken advantage of this identification limitation to sell sheep meat as goat meat to make higher profits. For example, in 2022, a store in the United Kingdom sold sheep meat as goat meat. This behavior not only involves food safety issues, but also seriously damages the rights and interests of consumers.

[0006] Currently, in the face of the rapid consumption of meat products, the existing detection methods are difficult to efficiently and quickly screen a large number of products, especially the identification of different species in the same category. At present, Uddin et al. constructed a multiplex PCR method to detect and distinguish goat and sheep DNA in food, but subsequent electrophoresis analysis is required, which is complex and further increases the identification time. Singh et al. developed a TaqMan multiplex probe-based rt-qPCR to detect and amplify the mitochondrial genome region of sheep and goats, which has strong specificity and high sensitivity, but still relies on expensive temperature-changing instruments and takes a long time to detect. Vishnura et al. applied double real-time PCR and high-resolution melting curve analysis to detect the difference between goat meat and sheep meat, although the developed analysis method can effectively improve the accuracy of meat adulteration detection through high-resolution melting analysis, but it requires high professional requirements for the operator, and the SYBR dye used is more prone to pollution than the probe method, and the TaqMan multiplex probe rt-qPCR detection is also not suitable for popularization at the grassroots level.

[0007] Therefore, in order to further strengthen food safety supervision and protect the rights and interests of consumers, it is urgent to develop a rapid, accurate and sensitive method for distinguishing and identifying sheep and goats. SUMMARY

[0008] The purpose of the present application is to provide a double Rt-RAA detection probe primer set for rapidly identifying goats and sheep, a product and a detection method, which can complete the detection within 30 minutes, and the detection method is rapid, accurate and sensitive.

[0009] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical solutions:

[0010] The present application provides a double Rt-RAA detection probe primer set for rapidly identifying goats and sheep, which is designed according to the conserved sequence in the mitochondrial gene Cytb sequence.

[0011] Preferably, the double Rt-RAA detection probe primer set for rapidly identifying goats and sheep comprises the following sequences:

[0012] Goat:

[0013] Capra-F2-SEQ ID NO. 3:

[0014] AACAGGATCGAACAACCCCACAGGAATTCC;

[0015] Capra-R2-SEQ ID NO. 4:

[0016] AGGTCGGGTGTGAATAGTACTAGTAATATTAG;

[0017] Capra-P-SEQ ID NO. 5:

[0018] CATTTCACCCTTACTACACCATTAAAGATA[FAM-dT][THF]T[BHQ1-dT]AGGCGCCATGCTACT-C3 spacer;

[0019] Sheep:

[0020] Ovis-F2-SEQ ID NO. 8:

[0021] TAGTTCACCTACTCTTCCTCCACGAAACAG;

[0022] Ovis-R1-SEQ ID NO. 7:

[0023] TGTTAAGTGGGTTTGCTGGGGTGTAGTTGTC;

[0024] Ovis-T-SEQ ID NO. 10:

[0025] ACCCTTATTACACCATTAAAGACATCCTAGG[ROX-dT][THF]C[BHQ2-dT]ATCCTACTAATCCTC-C3 spacer.

[0026] The application further provides a detection product for rapidly identifying goats and sheep, which comprises the above-mentioned double Rt-RAA detection probe primer composition for rapidly identifying goats and sheep.

[0027] Preferably, the detection product comprises a detection kit and a detection chip.

[0028] The application further provides a double Rt-RAA detection method for rapidly identifying goats and sheep, which comprises the following steps:

[0029] The double Rt-RAA detection probe primer composition for rapidly identifying goats and sheep is used to perform double Rt-RAA amplification on a sample to be detected.

[0030] Preferably, the reaction procedure of the double Rt-RAA amplification is as follows:

[0031] 35-41℃, 30s / cycle, 40 cycles.

[0032] Compared with the prior art, the application has the following beneficial effects:

[0033] (1) The application designs primers and probes for specific regions of sheep and goat mitochondrial DNA (Cytb gene), and constructs a double Rt-RAA detection method for rapidly identifying goats and sheep. The method can simultaneously and specifically detect the Cytb gene of goats and sheep, significantly improves the detection efficiency, and can complete the detection within 30 minutes. The detection limit of goats and sheep reaches 0.5%, has good stability, and has no cross-reaction with common meat such as cattle, pigs and ducks, improves the detection efficiency, saves the detection cost, and improves the accuracy of the detection result. Moreover, with the development of portable fluorescence quantitative instruments, the application will have broad application prospects, and provides another reliable animal source rapid and accurate detection method for basic laboratories and on-site experiments.

[0034] (2) In actual sample detection, the application can accurately identify the sheep and goat source components, which is completely consistent with the fluorescence quantitative PCR detection result in the national standard, and the accuracy is 100%, which can realize the rapid and efficient identification of sheep and goat source components, provides reliable technical support for food safety and species authenticity identification, provides an efficient and accurate technical method for rapid identification of sheep and goats, further safeguards the legal rights and interests of consumers, and strengthens the effect of food safety supervision. BRIEF DESCRIPTION OF DRAWINGS

[0035] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative labor.

[0036] Figure 1 It is the amplification target DNA fluorescence curve of the goat primer-probe combination in Example 1 of the application. B is the amplification target DNA fluorescence curve of the goat primer-probe combination.

[0037] Figure 2 It is the amplification target DNA fluorescence curve of the goat Capra-F2 / Capra-R2-probe and different sheep primer-probe combination in Example 1 of the application. A is the double Rt-RAA synchronous amplification target DNA fluorescence curve; B is the Ct value generated by the synchronous amplification of different primer-probe combinations.

[0038] Figure 3It is the specificity verification result figure in the test example 2 of the present application, wherein A is the specificity verification of double Rt-RAA synchronous detection; B is the independence verification of the goat Rt-RAA detection system; C is the independence verification of the sheep Rt-RAA detection system;

[0039] Figure 4 It is the stability result figure of the double Rt-RAA method synchronous detection of goat and sheep source components in the test example 4 of the present application, wherein A is the synchronous amplification curve when the mass fraction of goat and sheep is 2%; B is the synchronous amplification curve when the mass fraction of goat and sheep is 1%; C is the synchronous amplification curve when the mass fraction of goat and sheep is 0.5%; D is the synchronous amplification curve when the mass fraction of goat and sheep is 2%; E is the analysis of detected goat Ct value; F is the analysis of detected sheep Ct value. DETAILED DESCRIPTION

[0040] A number of exemplary embodiments of the present application are described in detail below, which should not be considered limiting of the present application, but rather as a description of certain aspects, features, and embodiments of the present application.

[0041] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, for a range of values of a parameter, unless otherwise stated, each intervening value of the parameter is also specifically included within the scope of the present application. The intervening values of the parameter are combined with a stated value of the parameter in range form. These are only exemplary embodiments of the present application, but do not limit the scope of the application. It is contemplated that other embodiments that do not fall within the scope of the appended claims can arise based on a study or consideration of the disclosure of this application relative to the prior art.

[0042] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned in this specification are herein incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference is not an admission that it is prior art with respect to the present application. All documents cited in the of the Invention are, in relevant part, incorporated herein by reference.

[0043] Many modifications and variations of this application can be made without departing from its spirit or scope, which will be apparent to those skilled in the art. The specific embodiments of the present application are described herein by way of example and for purposes of the disclosure. Other embodiments of the present application are within the scope of the claims.

[0044] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having" and the like are open-ended and do not exclude additional, unrecited elements or method steps.

[0045] The materials, reagents, machines and equipment used in the following examples and test examples are as follows:

[0046] Materials and reagents:

[0047] The experimental mice were from Guangdong Medical Laboratory Animal Center. The fresh meat quality control samples, including dog meat, cat meat, fox meat, mink meat, goat meat and sheep meat, were supplied by Guangzhou Shuopu Biological Technology Co., Ltd. Beef, pork, chicken, duck, horse meat, goose meat, donkey meat and camel meat were the routine quality control samples of the laboratory. Rabbit meat, red deer meat and sika deer meat were purchased online and verified for authenticity according to GB / T 38164-2019, and the results met the standard. RAA (fluorescent) nucleic acid amplification kit (Zongce Biological) was provided by Dongguan Yuanjia Experimental Technology Co., Ltd.

[0048] Instruments and equipment:

[0049] CFX96 Touch fluorescent quantitative PCR instrument, Bio-Rad Company, USA; JXFSTPRP-32 tissue grinder, Shanghai Jingxin Industrial Development Co., Ltd.; ME403 one-thousandth electronic balance, Mettler Toledo Company, Switzerland; Nanodrop ONEc ultramicro spectrophotometer, Thermo Scientific Company, USA.

[0050] Example 1

[0051] In Example 1 of the present application, a double Rt-RAA detection probe primer composition for rapidly identifying goat and sheep was designed and screened, and the specific steps were as follows:

[0052] Probe design

[0053] The mitochondrial gene Cytb sequences of goat (GenBank number: MN540081.1) and sheep (GenBank number: MH938654.1) were downloaded from the GenBank database, respectively, and the RAA primers and exo probes of goat and sheep were designed in the conservative region. The primers and probes were verified for specificity by BLAST. The sequences of the designed primers and probes were sent to Shengong Biological Engineering (Wuhan) Co., Ltd. for synthesis, and the primers are shown in Table 1.

[0054] Table 1 RAA primers and exo probes of goat and sheep

[0055]

[0056]

[0057] Rt-RAA primer screening

[0058] The goat and sheep primers of Table 1 were each combined pairwise to perform double Rt-RAA amplification. Two parallel experiments were set up for each combination.

[0059] The double Rt-RAA amplification system: 2 μL of 10 μM primer, 0.6 μL of 10 μM probe, 25 μL of water buffer, 2.5 μL of 280 mmol / L MgAc buffer solution, and 1 μL of target DNA, and ddH2O to 50 μL. The amplification procedure: 39°C, 30s / cycle, 40 cycles.

[0060] The results are shown in Figure 1 .

[0061] Figure 1 The sheep primer-probe combinations all showed typical "S" type amplification curves Figure 1 (A), while the goat only had Capra-F2 / Capra-R2 primer-probe combination that was effectively amplified Figure 1 (B).

[0062] Further, the four sheep primer-probe combinations were each paired with the goat Capra-F2 / Capra-R2-probe combination and subjected to synchronous amplification, and the results are shown in Figure 2 .

[0063] Figure 2 It was shown that, under the same conditions of primer (400 nmol / L) and probe (120 nmol / L) concentrations of the goat and sheep in the double reaction system, all combinations produced effective reactions with the target DNA Figure 2 (A), and when the goat Capra-F2 / Capra-R2 was combined with the sheep Ovis-F2 / Ovis-R1, the cycle threshold (Ct) was the lowest Figure 2 (B). Therefore, this combination was used as the double amplification primer for subsequent experiments.

[0064] Test Example 1

[0065] The test example 1 of the present application detected the detection effect of the double Rt-RAA detection probe primer combination screened in Example 1 under different temperature conditions, and the specific steps were as follows:

[0066] The goat Capra-F2, Capra-R2, Capra-P and the sheep Ovis-F2, Ovis-R1, Ovis-T combination of Example 1 were used, the amplification system and amplification procedure of Example 1 were adopted, a temperature gradient of 29-45°C was set to evaluate the amplification performance of the combination under different temperature conditions, and the results are shown in Table 2.

[0067] As shown in Table 2, the amplification efficiency of the duplex Rt-RAA system is significantly correlated with the reaction temperature. Within the temperature range of 29-39℃, the Ct values of the goat and sheep-derived components both show a decreasing trend with the increase of temperature. When the temperature rises to 41℃, the amplification of the two species shows differences, the Ct value of the goat is still decreasing, while that of the sheep shows an increasing trend. When the temperature exceeds 41℃, the amplification efficiency of the two targets is significantly reduced. In summary, based on the requirement of simultaneous detection by the duplex Rt-RAA method, it is necessary to ensure that both targets obtain the best amplification efficiency, and therefore 39℃ is established as the optimal reaction temperature.

[0068] Table 2 Ct values of goat and sheep-derived components detected by the duplex Rt-RAA method at different reaction temperatures

[0069]

[0070] Test Example 2

[0071] In Test Example 2 of the present application, the specificity of the duplex Rt-RAA detection probe primer composition screened in Example 1 is detected, and the specific steps are as follows:

[0072] Using the goat Capra-F2, Capra-R2, Capra-P and sheep Ovis-F2, Ovis-R1, Ovis-T compositions in Example 1, the amplification system and amplification procedure in Example 1 are adopted, and the genomic DNA of 18 kinds of meat, i.e., goat, sheep, rat, cat, dog, fox, mink, beef, goose, camel, pork, rabbit, chicken, sika deer, horse, donkey, red deer and duck, is amplified respectively, and ddH2O is set as a blank control, and the detection results are shown in Figure 3 .

[0073] Figure 3 As shown, under the optimized duplex Rt-RAA reaction conditions, only the DNA of the goat and sheep samples shows the amplification curve, and the amplification curves of the remaining 16 kinds of non-target species are completely overlapped with the blank control Figure 3 A), and the DNA detection results of the three samples are highly consistent. It is shown that the designed primer and probe combination can effectively avoid the cross-reaction with the non-target species.

[0074] In order to further verify the independence of the two detection channels in the duplex detection system, the target DNA is detected by the goat and sheep single detection methods respectively, and the results are shown in Figure 3 B-C.

[0075] Figure 3 As shown in B-C, the goat and sheep single detection system only amplifies the target sequence, and no cross-reaction phenomenon is shown between them.

[0076] Test Example 3

[0077] The detection limit of the double Rt-RAA detection probe primer composition screened in Example 1 was detected in Test Example 3, and the specific steps are as follows:

[0078] Using the goat Capra-F2, Capra-R2, Capra-P and sheep Ovis-F2, Ovis-R1, Ovis-T compositions in Example 1, the goat and sheep were used as the matrix, and the detection of 10% to 0.1% mass fraction was analyzed respectively, and the results are shown in Table 3.

[0079] Table 3 shows that when the mass fraction of goat is lower than 0.5%, the fluorescence amplification value cannot be detected. In contrast, the primers and probes designed for the sheep gene sequence show higher sensitivity, and the amplification signal value can still be generated even at a mass fraction of 0.2%. Based on the simultaneous detection requirement of double Rt-RAA detection, the mass fraction of 0.5% is determined as the detection limit of the unified method.

[0080] Table 3 shows the detection limit of goat and sheep-derived components

[0081]

[0082]

[0083] Test Example 4

[0084] The stability of double Rt-RAA detection was detected in Test Example 4, and the specific steps are as follows:

[0085] According to the amplification results in Table 3, four mixed samples containing goat and sheep components with a mass ratio of 2%, 1%, 0.5% and 0.2% respectively were prepared using fully pulverized beef as the matrix, and the method of Example 1 was used for detection, and 6 parallel groups were set for each group, and the results are shown in Figure 4 .

[0086] Figure 4 It is shown that the double Rt-RAA method detects 6 goat and sheep positive components in the 2%, 1% and 0.5% sample groups Figure 4 (A-C), but only 6 sheep Figure 4 (D) can be detected in the 0.2% sample. In addition, as the mass fraction of meat products decreases, the Ct values of the double Rt-RAA simultaneous detection of goat and sheep gradually increase, but are all lower than 30 Figure 4 (E-F). Since the number of running cycles in this study is set to 40, which is much higher than 30. Therefore, the mass fraction of 0.5% can be used as the lowest detection amount of the established double Rt-RAA method for simultaneous detection of goat and sheep-derived components.

[0087] Test Example 5

[0088] Test Example 5 of the present application was carried out by the method of Example 1 for detection of commercially available samples, and the specific steps are as follows:

[0089] The method of Example 1 and the national standard Rt-qPCR technology were used to detect and compare 25 commercially available meat products. As shown in Table 4, the detection results of the two methods showed a high degree of consistency, indicating that the established double Rt-RAA detection system can be applied in actual detection.

[0090] Table 4 Double Rt-RAA and Rt-qPCR methods for detecting commercially available meat products of yellow cattle and yak-derived components

[0091]

[0092]

[0093] The above only describes the preferred embodiments of the present application, and it should be noted that for those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. A dual Rt-RAA detection probe primer composition for rapid identification of goats and sheep, characterized by, The double Rt-RAA detection probe primer composition for rapidly identifying goat and sheep is designed according to a conserved sequence in a Cytb sequence of a mitochondrial gene.

2. The dual Rt-RAA detection probe primer composition for rapid identification of goats and sheep according to claim 1, characterized by, The double Rt-RAA detection probe primer composition for rapidly identifying goat and sheep comprises the following sequences: Goat: Capra - F2 - SEQ ID NO. 3: AACAGGATCGAACAACCCCACAGGAATTCC; Capra - R2- SEQ ID NO. 4: AGGTCGGGTGTGAATAGTACTAGTAATATTAG; Capra P - SEQ ID NO. 5: CATTTCACCCTTACTACACCATTAAAGATA[FAM-dT][THF]T[BHQ1-dT]AGGCGCCATGCTACT-C3spacer; Sheep: Ovis - F2 - SEQ ID NO. 8: TAGTTCACCTACTCTTCCTCCACGAAACAG; Ovis - R1- SEQ ID NO. 7: TGTTAAGTGGGTTTGCTGGGGTGTAGTTGTC; Ovis -T- SEQ ID NO. 10: ACCCTTATTACACCATTAAAGACATCCTAGG[ROX-dT][THF]C[BHQ2-dT]ATCCTACTAATCCTC-C3spacer.

3. A detection product for rapid discrimination of goats from sheep, characterized in that, The detection product for rapidly identifying goat and sheep comprises the double Rt-RAA detection probe primer composition for rapidly identifying goat and sheep according to any one of claims 1-2.

4. The test product for rapid discrimination of goats from sheep according to claim 4, characterized in that, The detection product comprises a detection kit and a detection chip.

5. A dual Rt-RAA detection method for rapid identification of goat and sheep, characterized in that, The method comprises the following steps: The double Rt-RAA detection probe primer composition for rapidly identifying goat and sheep according to claim 1 is used to perform double Rt-RAA amplification on a sample to be tested.

6. The duplex Rt-RAA detection method for rapid identification of goat and sheep according to claim 5, wherein, The reaction procedure of the double Rt-RAA amplification is as follows: 35-41 DEG C, 30 s / cycle, 40 cycles.

Images