Cigarette spot insect stain pollution detection method and application

Abstract

The invention provides a detection method for cigarette spot insect stain pollution and application, and relates to the technical field of cigarette quality control. The primer group comprises at least one of the following primer pairs: a first primer pair capable of specifically amplifying a target DNA sequence of Lasioderma serricorne; and the second primer pair can specifically expand the target DNA sequence of the tobacco powder borers. The primer group fundamentally solves the problem that a traditional chemical analysis method cannot distinguish insect stains from oil stains and material fragrance stains by accurately identifying DNA of lasioderma serricorne and tobacco powder borers. The high specificity ensures the accuracy and reliability of the detection result, and can provide clear biological evidence for pollution traceability. Meanwhile, the primer group is flexible in composition, has economical efficiency and practicability, and is suitable for various scenes such as specific problem investigation and large-range risk monitoring.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of cigarette quality control, in particular to a detection method for cigarette spot insect stain pollution and application. BACKGROUND

[0002] In modern industrial production, product quality control is the core link to protect brand reputation and consumer rights and interests. For fast consumer goods such as cigarettes, the appearance quality directly affects the willingness of consumers to purchase and the product experience. The production and manufacturing process of cigarettes is extremely fine and long, involving many complex physical and chemical processes from the processing of tobacco raw materials to the final product packaging. In this process, tobacco materials will inevitably come into contact with various exogenous substances, such as flavoring materials added to improve flavor, moisture introduced to adjust humidity, and lubricating oil or long-term formed scale that may leak from production equipment. In addition, there may be pests such as tobacco beetles and tobacco mealworms in the storage environment of raw materials. These factors all constitute potential risks for forming various types of spots on the surface of cigarette paper, which can be divided into water stains, oil stains, flavor stains, and insect stains, etc. according to their sources. Therefore, accurately and quickly identifying the specific causes of these surface spots is a key prerequisite for guiding the improvement of production processes, achieving precise process control, and tracing quality problems.

[0003] To solve the problem of tracing the source of cigarette surface spots, various analysis and identification methods have been proposed in the prior art. One type is a visual comparison method based on image processing, which establishes an image database of known types of pollution spots, compares the color, shape, texture, and other visual features of the test spots with the samples in the database, and then performs preliminary classification. Another type is based on chemical composition analysis, mainly including mass spectrometry and spectroscopy. Mass spectrometry determines the molecular weight and fragment information of the contaminant by measuring the mass-to-charge ratio of the molecule, thereby inferring its chemical structure. Spectroscopy, especially infrared spectroscopy, identifies the chemical bonds and functional groups within the contaminant by analyzing its absorption of specific wavelengths of light, and then determines its material category. These methods provide technical paths for qualitative analysis of spot contaminants from different dimensions.

[0004] However, the above-mentioned prior art faces many challenges and limitations in actual application. First, the pollution spots on cigarette paper are often small in size, and the absolute content of the contaminant is extremely low, which brings great difficulty to the effective extraction, transfer, and enrichment of the sample, and further leads to weak analysis signals, increasing the uncertainty of the results. Second, these identification methods are usually designed for directional analysis of a certain type or category of contaminants, but in actual production, a spot may be composed of multiple pollution sources, and a single analysis result may not fully reflect the true situation of the pollution, which may even be misleading, making it difficult to accurately determine the results.

[0005] A particularly prominent problem is the cross interference and identification difficulty between specific contaminants. For example, in distinguishing whether the spot contains insect stain contamination, the prior art is not satisfactory. The body fluid or exudate of pests such as Lasioderma serricorne is transferred to the spot on the cigarette paper during the production process, and the main chemical components of the spot are organic matter such as protein and lipid. When the spot is analyzed by mass spectrometry or infrared spectroscopy, the signal characteristics generated by the spot have a significant overlap with the signal characteristics of common organic matter contamination such as oil stain and material fragrance stain, which makes it difficult to clearly distinguish between the two. This ambiguity makes it difficult for production managers to determine whether the root cause of the problem is biological contamination or equipment contamination, so it is difficult to take targeted corrective and preventive measures. Therefore, before a comprehensive chemical analysis of the spot is performed, if a method can first confirm or exclude the presence of insect stain contamination, it will provide important guidance for the subsequent investigation focus and process optimization direction.

[0006] In view of this, the present application is proposed. SUMMARY

[0007] The purpose of the present application is to provide a cigarette spot insect stain contamination detection method and application, wherein the primer set can specifically recognize tobacco pest DNA with high specificity, thereby fundamentally solving the problem that traditional chemical methods cannot distinguish insect stains from oil stains and material fragrance stains. This tool can provide accurate and reliable biological evidence for contamination tracing, and is flexible, practical and can meet various detection needs.

[0008] In order to achieve the above-mentioned purpose of the present application, the following technical solutions are adopted: In a first aspect, the present application provides a primer set, which comprises at least one of the following primer pairs: A, a first primer pair capable of specifically amplifying a target DNA sequence of Lasioderma serricorne; B, a second primer pair capable of specifically amplifying a target DNA sequence of Lasioderma serricorne.

[0009] In a preferred embodiment, the first primer pair comprises: an upstream primer having a nucleotide sequence as shown in SEQ ID NO. 1; a downstream primer having a nucleotide sequence as shown in SEQ ID NO. 2.

[0010] In a preferred embodiment, the second primer pair comprises: an upstream primer having a nucleotide sequence as shown in SEQ ID NO. 3; a downstream primer having a nucleotide sequence as shown in SEQ ID NO. 4.

[0011] In a second aspect, the present application provides a kit comprising the primer set as described in the foregoing embodiments.

[0012] In a third aspect, the present application provides a method for detecting spot insect contamination on a cigarette, comprising: extracting DNA from a spot sample on the surface of a cigarette to be tested to obtain template DNA; performing fluorescent quantitative PCR amplification on the template DNA using the primer set as described in any one of the preceding embodiments, and obtaining an analysis result; determining whether the spot sample contains insect contamination according to the analysis result.

[0013] In some preferred embodiments, the reaction system for the fluorescent quantitative PCR amplification is shown in Table 2: 0.5 μL of the template DNA; 0.5 μL of each of the upstream and downstream primers in the primer pair; 8.5 μL of ddH2O; 10 μL of 2x Taq Plus Master Mix II.

[0014] In some preferred embodiments, the amplification procedure for the fluorescent quantitative PCR amplification comprises: pre-denaturation at 95°C for 3 minutes; performing 35 amplification cycles, and each of the amplification cycles comprises denaturation at 95°C for 30 seconds, annealing at 58°C-65°C for 20 seconds, and elongation at 72°C for 20-30 seconds; after the amplification cycles, elongation at 72°C for 7 minutes.

[0015] In some preferred embodiments, the step of determining whether the spot sample contains insect contamination according to the analysis result comprises: determining whether the analysis result simultaneously satisfies all of the following conditions: the amplification curve is a smooth S-type; the melting curve is a single peak; and the Ct value is not greater than 35; if yes, determining that the spot sample contains insect contamination; if no, determining that the spot sample does not contain insect contamination.

[0016] In some preferred embodiments, the step of extracting DNA from a spot sample on the surface of a cigarette to be tested to obtain template DNA further comprises: extracting DNA from a blank area on the surface of the cigarette to be tested as a blank control.

[0017] In a fourth aspect, the present application provides use of the primer set as described in the preceding embodiments in the preparation of a kit for detecting spot insect contamination on the surface of a cigarette.

[0018] In a fifth aspect, the present application provides application of the primer set as described in the foregoing embodiments or the kit as described in the foregoing embodiments in detection of the source of spot insect contamination on the surface of cigarettes.

[0019] In a sixth aspect, the present application provides application of the method for detecting spot insect contamination on cigarettes as described in the foregoing embodiments in detection of the source of spot insect contamination on the surface of cigarettes.

[0020] The present application provides a method for detecting spot insect contamination on cigarettes and application thereof, wherein the primer set provides a highly specific molecular tool, and the beneficial effects mainly lie in that it can fundamentally solve the ambiguity and uncertainty problems in distinguishing insect contamination from other types of contamination (such as oil contamination, flavor contamination) by using the existing chemical analysis method. Since the primer pair in the composition is designed for specific DNA sequences of the two common pests, tobacco beetles and tobacco powder beetles, the amplification reaction has extremely high specificity and will only respond to the DNA of the target insects, and will not have cross-reaction with any chemical substances such as oil, essence and flavor that do not contain target DNA. This high specificity directly brings about extremely high detection accuracy and reliability, and can provide clear and definite "yes" or "no" conclusions, providing solid biological evidence for judging the source of contamination. In addition, the design of the primer set directly addresses the specific problems commonly existing in the tobacco industry, and the composition of at least one primer pair also gives it flexibility in application, which can be used for in-depth investigation of specific problems, as well as large-scale risk monitoring, improving the applicability and economy of the tool. BRIEF DESCRIPTION OF DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the specific embodiments or prior art of the present application, the drawings needed in the description of the specific embodiments or prior art will be briefly introduced below. Obviously, the drawings in the following description are some embodiments of the present application, and those skilled in the art can also obtain other drawings according to these drawings without creative labor.

[0022] Figure 1 Flowchart of the method for detecting spot insect contamination on cigarettes in the embodiments of the present application; Figure 2 Fluorescence quantitative PCR amplification curve of the sample in Example 1 of the present application; Figure 3 Melting curve of the sample in Example 1 of the present application; Figure 4 Fluorescence quantitative PCR amplification curve of the sample in Example 2 of the present application; Figure 5 Melting curve of the sample in Example 2 of the present application; Figure 6A fluorescence quantitative PCR amplification curve chart of the sample of Example 3 of the present application; Figure 7 A melting curve chart of the sample of Example 3 of the present application. DETAILED DESCRIPTION

[0023] The embodiments of the present application will be described in detail below with reference to the examples, but those skilled in the art will understand that the following examples are only for illustration of the present application and should not be regarded as limiting the scope of the present application. The specific conditions are not specified in the examples, and the conventional conditions or the conditions recommended by the manufacturer are used. The reagents or instruments used are not specified by the manufacturer, and are all conventional products that can be obtained by purchase.

[0024] The primer set provided in the examples of the present application comprises at least one of the following primer pairs: A first primer pair capable of specifically amplifying the target DNA sequence of the tobacco beetle; B a second primer pair capable of specifically amplifying the target DNA sequence of the tobacco powder beetle.

[0025] The primer set provided in the examples is the basis for achieving high-specificity molecular detection, and its core is to contain one or more pairs of primers capable of specifically amplifying the target DNA sequence of the common tobacco storage pests. These pests, especially the tobacco beetle ( Lasioderma serricorne ) and the tobacco powder beetle ( Ephestia elutella ), are the main sources of biological contamination spots in the process of cigarette production and storage.

[0026] The primer set contains at least one primer pair, respectively for the above two pests. The first is a first primer pair capable of specifically amplifying the target DNA sequence of the tobacco beetle, and the second is a second primer pair capable of specifically amplifying the target DNA sequence of the tobacco powder beetle. "Specific amplification" here means that the primer pair only binds to and amplifies the specific DNA fragment of the target pest, and does not react with the DNA of tobacco itself, the DNA of other species, or chemical contaminants such as oil stains and flavor stains. This high specificity solves the problem that existing chemical analysis methods (such as spectroscopy or mass spectrometry) are difficult to distinguish insect stains from oil stains due to signal overlap.

[0027] It should be noted that the primer set in the examples can be obtained by first obtaining the COI gene sequence of the workshop tobacco pest (tobacco beetle and tobacco powder beetle) from the Genebank database, then using the DNAMAN software for sequence analysis and comparison, designing specific primers for tobacco pests, and marking them as H1 and H2, and using conventional PCR amplification technology to confirm the specific primers for fluorescence quantitative PCR.

[0028] In one specific embodiment, the target DNA sequence for amplification can be selected from the mitochondrial cytochrome c oxidase I (COI) gene, which is a commonly used molecular marker for species identification.

[0029] In some embodiments, the first primer pair comprises: an upstream primer having a nucleotide sequence as shown in SEQ ID NO. 1; and a downstream primer having a nucleotide sequence as shown in SEQ ID NO. 2.

[0030] In some embodiments, the second primer pair comprises: an upstream primer having a nucleotide sequence as shown in SEQ ID NO. 3; and a downstream primer having a nucleotide sequence as shown in SEQ ID NO. 4.

[0031] Specific nucleotide sequences are shown in Table 1: Table 1, sequences of primers in a primer set

[0032] NO. in Table 1 is SEQ ID NO.

[0033] In the embodiments of the present application, a kit is provided, which comprises the primer set as described in any one of the preceding embodiments.

[0034] In the embodiments of the present application, a method for detecting cigarette spot stain contamination is provided, which comprises: Step S1, extracting DNA from a spot sample on the surface of a cigarette to be tested to obtain a template DNA.

[0035] In this step, the cigarette to be tested can be a cigarette collected with a spot (particularly a yellow spot) found during production or storage.

[0036] Specifically, a tool such as a cutter can be used to cut off the part of the cigarette paper containing the surface spot. The cut-off sample needs to be immediately placed in a low-temperature environment at -20°C for storage to prevent DNA degradation.

[0037] Step S2, performing fluorescent quantitative PCR amplification on the template DNA using the primer set as described in any one of the preceding embodiments, and obtaining an analysis result.

[0038] The saved sample (spot sample) is placed in a centrifuge tube and ground into a powder state using a tissue grinder. This step aims to destroy the physical structure of the cigarette paper so that the trace contaminants and DNA wrapped therein can be fully exposed for extraction.

[0039] Total DNA can be extracted from the powdered sample using a suitable method.

[0040] Specifically, a variety of feasible methods can be adopted, including optimized CTAB method, centrifugal column method or using commercially available DNA extraction kit. The common goal of these methods is to efficiently lyse cells, remove impurities such as proteins, and ultimately obtain template DNA with high purity.

[0041] The fluorescence quantitative PCR amplification is the core of detection. The qPCR technology is used to perform exponential amplification on the trace target DNA possibly existing in the sample, and the fluorescence signal is monitored in real time.

[0042] According to the type of pests to be detected, corresponding specific primer pairs are selected. As described in the foregoing embodiments, these primer pairs are designed for specific target DNA sequences (such as COI gene) of tobacco beetles and / or tobacco mealworms, and have high specificity.

[0043] During the entire amplification process, the instrument monitors the fluorescence signal intensity in each reaction tube in real time. As the amplification product increases, the fluorescence signal will correspondingly increase, and the instrument will draw a real-time amplification curve accordingly.

[0044] Step S3, determining whether the spot sample contains insect stain contamination according to the analysis result.

[0045] This step is to interpret the data output by the qPCR instrument to make a final judgment.

[0046] In some embodiments, the reaction system of the fluorescence quantitative PCR amplification is shown in Table 2: Table 2, reaction system of fluorescence quantitative PCR amplification

[0047] In some embodiments, the amplification procedure of the fluorescence quantitative PCR amplification comprises: (1) pre-denaturation at 95℃ for 3 minutes; (2) 35 amplification cycles, and each of the amplification cycles comprises: denaturation at 95℃ for 30 seconds; annealing at 58℃-65℃ for 20 seconds (for example, it can be 58℃, 59℃, 60℃, 61℃, 62℃, 63℃, 64℃, 65℃, etc.); and elongation at 72℃ for 20-30 seconds (for example, it can be 20 seconds, 21 seconds, 22 seconds, 23 seconds, 24 seconds, 25 seconds, 28 seconds, 30 seconds, etc.).

[0048] (3) after the amplification cycle, elongation at 72℃ for 7 minutes.

[0049] In some embodiments, the step S3, determining whether the spot sample contains insect stain contamination according to the analysis result, comprises: determining whether the analysis result simultaneously satisfies all the following conditions: (1) the amplification curve is smooth S-shaped; (2) the melting curve is a single peak; (3) the Ct value is ≤ 35.

[0050] If yes, it is determined that the stain sample contains insect stain contamination; If no, it is determined that the stain sample does not contain insect stain contamination.

[0051] The above steps are the final determination link of the entire detection method, and the core is to establish a set of objective and clear standardized rules for interpreting the analysis results output by the fluorescence quantitative PCR instrument, so as to accurately determine whether there is insect stain contamination in the sample.

[0052] In order to ensure the reliability of the conclusion and avoid false positives or false negatives, the determination standard adopts a multi-dimensional and multi-condition comprehensive verification system, which requires that a sample must meet the above three core technical indicators at the same time to be identified as positive.

[0053] The above amplification curve is the most intuitive result display in real-time fluorescence quantitative PCR detection, which is plotted with PCR cycle number as abscissa and real-time fluorescence signal intensity as ordinate. A typical and efficient PCR reaction will have a very regular "S" shaped curve. This curve contains three stages: baseline period, reaction initial stage, amplification product is less, fluorescence signal is covered by background signal, curve shows a straight baseline; exponential growth period, with the increase of cycle number, amplification product increases exponentially, fluorescence signal rapidly increases, curve rises sharply; plateau period, due to factors such as consumption of reactants and decrease of enzyme activity, amplification efficiency decreases until stops, fluorescence signal no longer increases, curve enters a stable plateau area.

[0054] The determination standard requires that the amplification curve must be "smooth S-shaped", which is a basic verification of the effectiveness of the amplification reaction. If the curve has no obvious growth, fluctuation or abnormal shape, it indicates that the PCR reaction itself may be inhibited or there are other problems, and the subsequent data (such as Ct value) will lose its meaning.

[0055] Secondly, the melting curve analysis is an additional verification step after the end of PCR amplification cycle, which is used to test the specificity of the amplification product. The principle is that the temperature is slowly raised, and the change of fluorescence signal in the process of double-stranded DNA melting (melting) is monitored. When the temperature reaches the melting temperature (Tm value) of the specific amplification product, double-stranded DNA will be largely melted into single-stranded, resulting in a sharp drop in fluorescence signal, which appears as a peak in the-dF / dT versus temperature graph.

[0056] The criterion requires that the melting curve must be a "single peak". The significance of this requirement is that it tests for specificity: a single, sharp peak indicates that the PCR reaction has produced only one uniform DNA product, i.e. the target fragment that we expect.

[0057] If multiple peaks or a ragged shoulder peak appear, it indicates that non-specific amplification (e.g. primers amplify other sequences) or by-products such as primer dimers have occurred. In this case, even if the Ct value is very low, the result is unreliable because the source of the fluorescence signal cannot be determined.

[0058] Therefore, a single peak is the gold standard for confirming the uniqueness and specificity of the amplification product.

[0059] The Ct value (Cycle threshold) is the cycle number at which the fluorescence signal begins to enter the exponential growth phase on the amplification curve and intersects with the set fluorescence threshold line. It is the core parameter used for quantitative analysis in fluorescence quantitative PCR, and the size of the Ct value is inversely proportional to the content of the initial template DNA in the sample, i.e. the more the initial template, the smaller the Ct value.

[0060] The criterion sets a clear threshold: "Ct value not greater than 35". The setting of this cutoff value is based on experimental verification and industry practice, and its significance is to define the positive limit, i.e. Ct value ≤ 35 is considered a reliable positive signal, indicating that the sample contains a sufficient amount of target DNA to be effectively detected within 35 cycles; and to exclude false positives, when the cycle number is very high (e.g. greater than 35), even if there is no real template, a weak fluorescence signal may appear due to random events, causing the instrument to give a very high Ct value. Setting 35 as the limit can effectively exclude false positive results caused by background noise or non-specific amplification.

[0061] In conclusion, only when a sample's test results meet all three conditions, i.e. a smooth S-shaped amplification curve, a single melting peak, and a Ct value not greater than 35, can it be finally determined that the sample contains the corresponding insect stain contamination. If any of the conditions is not met, for example, the Ct value is greater than 35 or the melting curve has multiple peaks, it is determined that the sample does not contain the insect stain contamination being tested. This strict multiple verification criterion ensures the high accuracy and reliability of the entire detection method.

[0062] In some embodiments, the step of extracting DNA from the spot sample on the surface of the cigarette to be tested to obtain template DNA further comprises: Extracting DNA from a blank area on the surface of the cigarette to be tested as a blank control.

[0063] In the above step, while extracting the DNA of the spot sample, DNA can also be extracted from a blank area (i.e. an area without spots) on the surface of the same cigarette to be tested, and used as a blank control sample. The introduction of this step is a key quality control measure to ensure the accuracy and reliability of the results in molecular diagnostic experiments.

[0064] The application provides an application of the primer group as described in the foregoing embodiments in the preparation of a kit for detecting spot insect stain pollution on the surface of a cigarette.

[0065] The application provides an application of the primer group as described in the foregoing embodiments or the kit as described in the foregoing embodiments in the detection of the source of spot insect stain pollution on the surface of a cigarette.

[0066] The application provides an application of the method for detecting spot insect stain pollution on a cigarette as described in the foregoing embodiments in the detection of the source of spot insect stain pollution on the surface of a cigarette.

[0067] The application will be further described in detail through specific embodiments. It should be understood that the embodiments are merely used for a more detailed description and should not be understood as limiting the application in any form.

[0068] Embodiment 1 In this embodiment, the insect stain pollution of the cigarette to be tested is analyzed.

[0069] 1. Experimental method: (1) Yellow spot cigarettes (cigarette brand and specifications: ZL-M) in the cigarette production process were collected, and cigarette paper MB covering the surface spots and blank cigarette paper MK near the spots were cut off using a sample cutter and stored in a low-temperature environment at -20°C; (2) The samples stored at low temperature in the above step were respectively placed in two centrifugal tubes, ground into powder state using a tissue grinder, and the sample DNA was extracted using a centrifugal column method; (3) The COI gene sequences of workshop tobacco pests (Lasioderma serricorne and Ephestia elutella) were obtained through the Genebank database, sequence analysis and comparison were performed using DNAMAN software, specific primers for tobacco pests were designed, and were respectively marked as H1 and H2, and the specific primers for fluorescent quantitative PCR were confirmed using conventional PCR amplification technology; wherein the specific primer sequence (5' to 3') H1 of Lasioderma serricorne is: Upstream primer L-F: GGTGCCCCTGATATAGCTTTTCCTC; Downstream primer L-R: TGTTCATCCTGTACCAGCTCCATTG.

[0070] The specific primer sequence (5' to 3') H2 of Ephestia elutella is: Upstream primer E-F: GGAGCTCCTGATATAGCTTTCCC; Downstream primer E-R: GTTCATCCAGTTCCGCACCA.

[0071] (4) Preparation of a fluorescent quantitative PCR reaction system: The template DNA and blank sample extract obtained in step (2) are subjected to fluorescent quantitative PCR amplification using the primers designed and synthesized in step (3).

[0072] The system and procedure of the fluorescent quantitative PCR amplification are as follows: The reaction system is a total of 20 μL, including 0.5 μL of template DNA, 0.5 μL of specific upstream and downstream primers, 8.5 μL of ddH2O, and 10 μL of 2x Taq Plus Master Mix II.

[0073] The reaction procedure is as follows: 95 °C pre-denaturation for 3 minutes; 95 °C denaturation for 30 seconds, 60 °C annealing for 20 seconds, and 72 °C extension for 20 seconds; 35 cycles, and finally 72 °C extension for 7 minutes.

[0074] (5) According to the real-time monitoring results of step (4), the amplification curve and the melting curve (as shown in Figure 2 and Figure 3 ) are drawn, the Ct value is calculated, and the presence or absence of corresponding insect stain pollution in the spot cigarette paper is determined according to the response value change of the curve.

[0075] The judgment basis is as follows: the PCR amplification curve is smooth S-shaped, the melting curve is single-peaked, and the Ct value is ≤ 35, indicating that there is insect stain pollution, otherwise, indicating that there is no insect stain pollution.

[0076] 2. Experimental results: As shown in Figure 2 , the fluorescent quantitative PCR amplification curve of the sample for the tobacco beetle primer is smooth S-shaped, the Ct value is less than 35, and Figure 3 the melting curve is single-peaked, indicating that there is tobacco beetle stain pollution in the yellow spot pollution, but there is no tobacco powder moth stain pollution.

[0077] Example 2 In this example, the analysis of insect stain pollution is carried out for another cigarette to be tested (ZL-HY).

[0078] 1. Experimental method: The sample DNA extraction method is the optimized CTAB method, and the fluorescent quantitative PCR amplification procedure is as follows: 95 ℃ pre-denaturation for 3 minutes; 95 ℃ denaturation for 30 seconds, 65 ℃ annealing for 20 seconds, and 72 ℃ extension for 20 seconds; 35 cycles, and finally 72 ℃ extension for 7 minutes.

[0079] 2. Experimental results: from Figure 4 It can be seen that the fluorescent quantitative PCR amplification curve of the sample on the tobacco beetle and tobacco powder moth primer is a straight line, and Figure 5 The melting curve of the sample does not show a peak, indicating that the cigarette yellow spot pollution does not contain tobacco beetle and tobacco powder moth insect stain pollution.

[0080] Example 3 In this embodiment, the insect stain pollution of another cigarette to be tested (ZL-ZP) is analyzed.

[0081] 1. Experimental method: The fluorescent quantitative PCR amplification procedure is as follows: 95 ℃ pre-denaturation for 3 minutes; 95 ℃ denaturation for 30 seconds, 60 ℃ annealing for 20 seconds, and 72 ℃ extension for 30 seconds; 35 cycles, and finally 72 ℃ extension for 7 minutes.

[0082] 2. Experimental results: from Figure 6 It can be seen that the fluorescent quantitative PCR amplification curve of the sample on the tobacco powder moth primer is smooth S-shaped, the Ct value is less than 35, and Figure 7 The melting curve of the sample is a single peak, indicating that the yellow spot pollution has tobacco powder moth insect stain pollution, but no tobacco beetle insect stain pollution.

[0083] Finally, it should be noted that: the above embodiments are only used to illustrate the technical solutions of the present application, but not to limit them; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or make equivalent replacement for part or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. A primer set, characterized by, The primer set comprises at least one of the following primer pairs: A. a first primer pair capable of specifically amplifying a target DNA sequence of the Lasioderma serricorne; B. a second primer pair capable of specifically amplifying a target DNA sequence of the Lasioderma serricorne; Preferably, the first primer pair comprises: an upstream primer having a nucleotide sequence as shown in SEQ ID NO. 1; a downstream primer having a nucleotide sequence as shown in SEQ ID NO. 2; Preferably, the second primer pair comprises: an upstream primer having a nucleotide sequence as shown in SEQ ID NO. 3; a downstream primer having a nucleotide sequence as shown in SEQ ID NO.

4.

2. A kit characterized in that, The primer set of claim 1.

3. A method for detecting contamination of cigarette spots by cigarette beetles, characterized in that, It comprises: extracting DNA from a spot sample on the surface of a cigarette to be tested to obtain template DNA; performing fluorescent quantitative PCR amplification on the template DNA using the primer set of claim 1 to obtain an analysis result; determining whether the spot sample contains insect stain contamination according to the analysis result.

4. The method for detecting cigarette spot and insect stain contamination as described in claim 3, characterized in that, The reaction system of the fluorescent quantitative PCR amplification is 20 μL in total, comprising: 0.5 μL of the template DNA, 0.5 μL of each of the upstream and downstream primers in the primer pair; 8.5 μL of ddH2O; 10 μL of 2x Taq Plus Master Mix II.

5. The method for detecting cigarette spot and insect stain contamination as described in claim 3, characterized in that, The amplification procedure of the fluorescent quantitative PCR amplification comprises: pre-denaturation at 95°C for 3 minutes; 35 amplification cycles, each comprising denaturation at 95°C for 30 seconds, annealing at 58°C-65°C for 20 seconds, and elongation at 72°C for 20-30 seconds; 7 minutes of elongation at 72°C after the amplification cycles.

6. The method for detecting cigarette spot and insect stain contamination as described in claim 3, characterized in that, The step of determining whether the spot sample contains insect stain contamination according to the analysis result comprises: determining whether the analysis result simultaneously satisfies all of the following conditions: the amplification curve is a smooth S-type; the melting curve is a single peak; and the Ct value is not greater than 35; if yes, determining that the spot sample contains insect stain contamination; if no, determining that the spot sample does not contain insect stain contamination.

7. The method for detecting cigarette spot and insect stain contamination as described in claim 3, characterized in that, The step of extracting DNA from a spot sample on the surface of a cigarette to be tested to obtain template DNA further comprises: extracting DNA from a blank area on the surface of the cigarette to be tested as a blank control.

8. Use of the primer set of claim 1 in the preparation of a kit for detecting insect stain contamination on a spot on the surface of a cigarette.

9. Use of the primer set of claim 1 or the kit of claim 2 in the detection of a source of insect stain contamination on a spot on the surface of a cigarette.

10. Use of the method of claim 3-7 for detecting insect stain contamination on a spot on the surface of a cigarette in the detection of a source of insect stain contamination on a spot on the surface of a cigarette.

Images