Kit for detecting SNP (Single Nucleotide Polymorphism) of clopidogrel metabolism related gene and use method of kit

By designing specific primers and detection methods, and combining PCR amplification and flight mass spectrometry chip detection, the accuracy and cost issues of clopidogrel metabolism-related gene SNP polymorphism detection in existing technologies have been solved, enabling personalized medication guidance and improved drug treatment efficacy.

CN120905401APending Publication Date: 2025-11-07LANZHOU BAIYUAN GENE TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511131964.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-13
Publication Date
2025-11-07

AI Technical Summary

Technical Problem

Existing technologies are not very accurate in detecting SNP polymorphisms in clopidogrel metabolism-related genes, and the reagent costs are high when testing small numbers of samples, which cannot meet the needs of clinical testing.

Method used

A kit for detecting SNP polymorphisms in clopidogrel metabolism-related genes is provided, including specific upstream and downstream amplification primers and single-base extension primers. Combined with PCR amplification, SAP digestion, and flight-of-flight mass spectrometry chip detection, it enables rapid and accurate genotype interpretation.

Benefits of technology

It achieves highly sensitive, highly specific, and low-cost genotype identification, which can guide personalized medication and improve the safety and effectiveness of drug therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005546977670000051
    Figure BDA0005546977670000051
  • Figure BDA0005546977670000101
    Figure BDA0005546977670000101
  • Figure BDA0005546977670000102
    Figure BDA0005546977670000102
Patent Text Reader

Abstract

The invention discloses a kit for detecting SNP (Single Nucleotide Polymorphism) of clopidogrel metabolism related genes and a use method of the kit. The kit comprises the following components: c.681Ggt; a, c, 636Ggt; the method comprises the following steps: A, c.-806Cgt; an upstream and downstream amplification primer mixture and a single-base extension primer mixture of three sites of T and T; the c.681Ggt is selected from the group consisting of The sequence of an upstream amplification primer of the site A is shown as SEQ ID NO.1, the sequence of a downstream amplification primer of the site A is shown as SEQ ID NO.2, and the sequence of a single-base extension primer of the site A is shown as SEQ ID NO.3; the c is 636Ggt; the sequence of an upstream amplification primer of the site A is shown as SEQ ID NO.4, the sequence of a downstream amplification primer of the site A is shown as SEQ ID NO.5, and the sequence of a single-base extension primer of the site A is shown as SEQ ID NO.6; the c is-806Cgt; the sequence of an upstream amplification primer of the T site is as shown in SEQ ID NO.7, the sequence of a downstream amplification primer of the T site is as shown in SEQ ID NO.8, and the sequence of a single-base extension primer is as shown in SEQ ID NO.9. The CYP2C19 * 2, CYP2C19 * 3 and CYP2C19 * 17 site genotypes of the drug metabolic enzyme CYP2C19 gene are mutually verified through two detection results, the drug metabolic capability difference of an individual can be rapidly and accurately determined, scientific guidance is provided for drug selection and drug dosage control of anti-platelet drugs, and the method has the advantages that the method is simple and convenient to operate, and the application prospect is wide. The method is beneficial to non-invasive, miniaturized, time-saving, low-cost design, specificity and rapid detection of gene detection products, and is simple to operate and convenient for clinical application.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of gene detection, and particularly relates to a detection method for a gene related to metabolism of an anti-platelet drug clopidogrel and application thereof. BACKGROUND

[0002] With the development of human genomics, the field of pharmacogenomics has developed rapidly, and more and more pharmacogenomic biomarkers and their detection methods have emerged. Pharmacogenomics has become an important tool for guiding individualized drug use in clinical practice, assessing the risk of serious adverse drug reactions, guiding new drug research and development, and evaluating new drugs. Molecular detection of drug response-related genes and their expression products is a prerequisite for implementing individualized treatment. Drug individualization differences refer to the inconsistency of drug efficacy and safety among different individuals. The consequences of such differences may be suboptimal drug treatment, delayed optimal treatment time, or increased probability of adverse drug reactions, which seriously endanger the health and life of patients.

[0003] Specifically, clopidogrel is a thienopyridine anti-platelet aggregation drug, which was recognized by the US FDA in 1997 as an ideal drug for secondary prevention of ischemic stroke, myocardial infarction and other diseases. After clopidogrel is metabolized by CYP450 enzymes, the active metabolite generated can irreversibly inhibit the binding of ADP to platelet P2Y12 receptors, thereby inhibiting platelet aggregation. About 4-30% of patients do not achieve the expected anti-platelet aggregation effect in clinical practice, and then cardiovascular adverse events occur. The body's platelets lack response or have reduced response to clopidogrel, which is called clopidogrel resistance or clopidogrel low response. CYP2C19 enzyme in the cytochrome P450 enzyme system is a key enzyme for the metabolism of clopidogrel in the body, and the activity of CYP2C19 enzyme is affected by CYP2C19 gene polymorphism. The polymorphism of the coding gene leads to individual differences in the activity of CYP2C19 enzyme, and different genotypes have different effects on the metabolic rate of the corresponding drug, thereby affecting drug efficacy or causing side effects. Therefore, it is of great significance to adjust the dosage of drugs according to the different genotypes in clinical practice to protect the health of patients, improve the safety and effectiveness of drug treatment, and improve cost-effectiveness.

[0004] Currently, there are many technologies for detecting gene polymorphisms, the most commonly used being polymerase chain reaction-restriction fragment length polymorphism analysis (PCR-RFLP), sequence-specific PCR, first-generation sequencing, second-generation sequencing, and gene chip methods. However, these technologies have their own application drawbacks, such as cumbersome operation, long detection cycle, inability to perform high-throughput simultaneous detection of multiple sites, low sensitivity, and poor specificity. As a result, these technologies are still not ideal for clinical use in gene polymorphism detection, and the reagent cost increases significantly when testing a small number of samples, which has not yet met the needs of clinical testing.

[0005] Based on the above, Chinese patent application CN 110241231 A discloses a composition, kit, method, and application for detecting CYP2C19 gene polymorphism. The polymorphism composition of this invention includes reagent A (primers and probes for wild-type detection of polymorphisms at positions 681, 636, and 806 of the CYP2C19 gene) and reagent B (primers and probes for mutant types). Multiplex detection is performed in a single PCR reaction tube, exhibiting high specificity, high sensitivity, and reproducibility. However, it cannot detect and determine heterozygous samples in the same reaction tube, and the result determination may result in missed detections.

[0006] Chinese patent application CN 110157795 A discloses a method for detecting gene polymorphisms in personalized medicine, which can improve the detection efficiency of CYP2C19 gene polymorphisms. However, it requires highly skilled operators and involves complex optimization processes for chromatographic and mass spectrometric conditions. Summary of the Invention

[0007] The purpose of this invention is to provide a kit and method for using the kit to detect SNP polymorphisms of clopidogrel metabolism-related genes, which effectively overcomes the shortcomings of existing gene SNP polymorphism detection methods, such as low accuracy and high reagent cost when testing a small number of samples, and provides accurate identification of the genotype for clopidogrel drug use.

[0008] To achieve its purpose, the present invention adopts the following technical solution:

[0009] This invention provides a kit for detecting SNP polymorphisms in clopidogrel metabolism-related genes, wherein the clopidogrel metabolism-related gene is the CPY2C19 gene, including three sites: c.681G>A, c.636G>A, and c.-806C>T.

[0010] The kit includes a mixture of upstream and downstream amplification primers for three sites and a mixture of single-base extension primers;

[0011] The upstream amplification primer sequence of the c.681G>A site is shown in SEQ ID NO. 1, the downstream amplification primer sequence is shown in SEQ ID NO. 2, and the single base extension primer sequence is shown in SEQ ID NO. 3;

[0012] The upstream amplification primer sequence of the c.636G>A site is shown in SEQ ID NO. 4, the downstream amplification primer sequence is shown in SEQ ID NO. 5, and the single base extension primer sequence is shown in SEQ ID NO. 6;

[0013] The upstream amplification primer sequence of the c.-806C>T site is shown in SEQ ID NO. 7, the downstream amplification primer sequence is shown in SEQ ID NO. 8, and the single base extension primer sequence is shown in SEQ ID NO. 9.

[0014] As a further preferred technical solution of the present application, the kit further comprises:

[0015] PCR amplification reagents: 10x PCR buffer, 25mM MgCl2, 25mM dNTP Mix, 5U / μL polymerase chain reaction enzyme;

[0016] SAP enzymolysis reaction reagent: SAP buffer, SAP enzyme (1.7U / μL);

[0017] Extension reaction reagent: extension buffer, extension enzyme, extension termination solution;

[0018] Nuclease-free water.

[0019] Further, the upstream and downstream amplification primer mixture is an equal volume mixture of the upstream and downstream amplification primers of the three sites, with a final concentration of 0.5-2μM; the single base extension primer mixture is an equal volume mixture of the upstream and downstream amplification primers of the three sites, with a final concentration of 5-10μM; and the solvent is TE buffer.

[0020] The use method of the above-mentioned kit for detecting the SNP polymorphism of the clopidogrel metabolism-related gene comprises the following steps:

[0021] S1: using the DNA of the sample to be tested as a template, mixing the upstream and downstream amplification primer mixture with the PCR amplification reagent to form a PCR reaction system, performing multiplex PCR amplification, and obtaining an amplification product;

[0022] S2: using SAP enzyme to dephosphorylate the amplification product obtained in step S1 to obtain a dephosphorylated product; the SAP enzyme is shrimp alkaline phosphatase;

[0023] S3: a single base extension reaction is performed on the product obtained in step S2 using an extension reagent and a single base extension primer mixture to obtain an extension product;

[0024] S4: the extension product obtained in step S3 is desalted and purified using a desalting resin to remove salt ions in the reaction, thereby obtaining a purified extension product;

[0025] S5: the purified extension product obtained in step S4 is spotted on a flight mass spectrometry chip, and the presence or absence of a mutation in the CYP2C19 gene sequence is rapidly determined based on the difference in the mass-to-charge ratio of the nucleic acid fragments.

[0026] Further, in step S1, the multiple PCR amplification reaction conditions are as follows: 95°C for 2 min, 1 cycle; 95°C for 30 s, 60°C for 30 s, 72°C for 60 s, 45 cycles; 72°C for 5 min, 1 cycle; and 4°C constant temperature.

[0027] Further, in step S2, the dephosphorylation conditions are as follows: 37°C for 40 min; 85°C for 5 min; and 4°C constant temperature.

[0028] Further, in step S3, the single base extension reaction conditions are as follows: 95°C for 30 s, 1 cycle; 95°C for 5 s, 1 cycle; 48°C for 5 s, 80°C for 5 s, 5 internal cycles, 40 external cycles; 72°C for 3 min, 1 cycle; and 4°C constant temperature.

[0029] Further, the volume ratio of the amplification system in step S1, the dephosphorylation system in step S2, and the extension system in step S3 is 5:2:2.

[0030] The above-mentioned kit for detecting the SNP polymorphism of a clopidogrel metabolism-related gene can be used for clinical evaluation of the in-vivo metabolism state of clopidogrel.

[0031] The above-mentioned kit for detecting the SNP polymorphism of a clopidogrel metabolism-related gene can be used for guiding the application of individualized medication of clopidogrel in the clinic.

[0032] By using the above technical solution, the detection kit is applied to the detection of a platelet resistance clopidogrel metabolism-related gene.

[0033] As described above, due to the use of the above technical solution, the present application has the following advantages over the prior art:

[0034] 1. The present application uses genetic detection means to determine the genetic polymorphism of drug metabolism enzymes, guides medication according to individual genetic characteristics, and provides a corresponding treatment plan, thereby ultimately realizing the transition from "symptom-based medication" to "person-based medication" (individualized medication), which plays an extremely important role in improving drug efficacy and reducing adverse drug reaction events.

[0035] 2、The application takes fluorescent quantitative PCR as a control test method, and the control result shows that the method has the technical effects of high sensitivity, strong specificity and difficult-to-judge result, and can provide quick, efficient and easy-to-interpret medication guidance of clopidogrel for the clinic.

[0036] 3、The kit of the application is more simple in operation than the method in the prior art patent document CN 110241231 A, the sample can be directly loaded into the machine for purification, and automatic sample spotting is achieved, has the characteristics of short report cycle, high automation degree, high accuracy, high sensitivity, low cost, no need to match samples, compatible with various sample types, etc., can effectively overcome the defects of low accuracy of the existing method and high reagent cost when detecting a small amount of sample, and make accurate identification of the genotype of clopidogrel medication. BRIEF DESCRIPTION OF DRAWINGS

[0037] Figure 1 is the mass spectrum detection result of a heterozygous plasmid of the c.681G>A site;

[0038] Figure 2 is the mass spectrum detection result of a heterozygous plasmid of the c.636G>A site;

[0039] Figure 3 is the mass spectrum detection result of a heterozygous plasmid of the c.-806C>T site;

[0040] Figure 4 is the fluorescence PCR amplification curve graph of the CYP2C19 gene c.681G>A site of the application;

[0041] Figure 5 is the fluorescence PCR amplification curve graph of the CYP2C19 gene c.636G>A site of the application;

[0042] Figure 6 is the fluorescence PCR amplification curve graph of the CYP2C19 gene c.-806C>T site of the application;

[0043] Figure 7 is the product peak graph of the CYP2C19 gene multiple reaction sample detection of the application. DETAILED DESCRIPTION

[0044] In order to facilitate better understanding of the application, the technical solutions of the application will be described in detail below, but it cannot be understood as limiting the implementable scope of the application.

[0045] The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials used in the following examples are all purchased from conventional biochemical reagent stores unless otherwise specified. The sequences of the primers and probes used are synthesized by Shanghai Generay Biotech Co., Ltd.; and the plasmids are synthesized by Anhui General Biotech Co., Ltd.

[0046] Example 1: Establishment of nucleic acid mass spectrometry detection method

[0047] The example provides a kit for detecting SNP polymorphism of clopidogrel metabolism related gene by mass spectrometry. The kit comprises PCR amplification reaction liquid, single base extension reaction liquid, 10x PCR buffer, 25mM MgCl2, 25mM dNTP Mix, 5U / μl polymerase chain reaction enzyme, SAP buffer, SAP enzyme (1.7U / μl), iPLEX buffer, iPLEX termination liquid, iPLEX enzyme, nuclease-free water, positive control, and negative control. The positive control is a mixture of wild type plasmid and mutant plasmid at c.681G>A site, c.636G>A site, and c.-806C>T site, and the concentration of each plasmid is 10 ng / μL, and the blank control is TE solution.

[0048] I. Design and synthesis of amplification primers and extension primers

[0049] SNP site query is performed by using the NCBI website to determine the wild type and mutant sequences of CYP2C19*2, CYP2C19*3 and CYP2C19*17 genes. The UEP primers for amplification and single base extension are designed by using Premier5 software. After the primers are designed, they are synthesized by Shengong Biotechnology (Shanghai) Co., Ltd. and purified by HPLC to obtain a quality inspection report. The amplification primers have a 10-base universal tag sequence (ACGTTGGATG) at the 5' end. The specific PCR amplification upstream / downstream primer sequences are shown in Table 1.

[0050] Table 1. PCR amplification upstream / downstream primer sequences

[0051]

[0052] The above synthesized primer dry powder is diluted with TE buffer to a 100 μM stock solution, which is stored at -20°C. The PCR amplification primer mixture is prepared by mixing the amplification primers of the three sites in equal volumes to obtain a mixture concentration of 1 μM.

[0053] The sequence of the single base extension primer is shown in Table 2:

[0054] Table 2. Sequence of single base extension primer

[0055] Gene site SEQ ID NO. Single base extension primer Wild type base Molecular weight Mutant base Molecular weight c.681 G>A SEQ ID NO. 3 5'-ATCATTGATTATTTCCC-3' G 5397.61 A 5381.61 c.636 G>A SEQ ID NO. 6 5'-ATTGTAAGCACCCCCTG-3' G 5417.61 A 5401.61 c.-806 C>T SEQ ID NO. 9 5'-TGTCTTCTGTTCTCAAAG-3' C 5702.81 T 5782.71

[0056] The above synthesized primer dry powder is diluted with TE buffer to a 100 μM stock solution, which is stored at -20°C.

[0057] Mixing the extension primers in equal volume to make the concentration of the extension primer mixture 8 μM.

[0058] II. Nucleic acid mass amplification reagent

[0059] In one system, the multiplex PCR amplification is performed with the amplification primer mixture, and then the single base extension reaction is performed with the extension primer mixture to detect the SNP site. The specific operation steps are as follows:

[0060] (1) Preparation of multiplex PCR amplification reaction system

[0061] The multiplex PCR amplification reaction system is shown in Table 3.

[0062] Table 3 Multiplex PCR amplification reaction system

[0063] Reagent Loading amount μL 10x PCR Buffer 0.6 25 mM MgCl2 0.4 25mM dNTP Mix 1.0 1 μM primer mix 1.0 5 U / μl PCR enzyme 0.1 Nuclease-free water 0.9 Total volume 4

[0064] The mixture is shaken and mixed, centrifuged, and then 4 μL is added to each well of a 96-well plate, followed by the addition of 1 μL of the sample DNA to be tested. The wells are sealed with sealing film, shaken and mixed for 30 s, and centrifuged at 2000 rpm for 30 s. The liquid on the wall of the tube is completely spun to the bottom of the tube.

[0065] The multiplex PCR amplification reaction conditions are as follows: 95°C, 2 min, 1 cycle; (95°C, 30 s; 60°C, 30 s; 72°C, 1 min) 45 cycles; 72°C, 5 min, 1 cycle; 4°C, ∞, storage. After the reaction is completed, the 96-well plate is removed and centrifuged at 2000 rpm for 30 s.

[0066] (2) SAP enzymolysis reaction

[0067] The SAP enzymolysis reagent is removed, and the phosphodiesterase is placed on an ice box. The other reagents are melted at room temperature. The SAP enzyme reaction solution is prepared according to Table 4, and 2 μL of the SAP enzyme reaction solution is added to the PCR reaction system product after centrifugation. The wells are sealed with sealing film, shaken and mixed for 30 s, and centrifuged at 2000 rpm for 30 s. The PCR amplification is performed in a PCR instrument with the following amplification program: 37°C, 40 min; 85°C, 5 min, 4°C, constant temperature.

[0068] Table 4 SAP enzymolysis reaction system

[0069] Reagent Loading amount μL SAP buffer 0.17 SAP enzyme 0.3 Nuclease-free water 1.53 Total volume 2

[0070] After the reaction is completed, the 96-well plate is removed and centrifuged at 2000 rpm for 30 s.

[0071] (3) Extension reaction

[0072] The reagents of the extension reaction were taken out, the reaction catalytic enzyme was placed on an ice box, the other reagents were melted at room temperature, and the extension reaction system was prepared according to the number of samples to be detected, as shown in Table 5 below.

[0073] Table 5 Extension reaction system

[0074] Reagent Loading amount μL Extension buffer 0.2 Extension enzyme 0.15 Extension termination solution 0.2 Extension primer mix 0.94 Nuclease-free water 0.51 Total volume 2

[0075] In the above SAP enzymolysis reaction product, 2 μL of single base extension reaction mixture was added, sealed with sealing film, shaken and mixed for 30 s, centrifuged at 2000 rpm for 30 s, and placed in a PCR instrument for amplification. The amplification procedure was as follows: 95℃, 30 s, 1 cycle; 95℃, 5 s (48℃, 5 s; 80℃, 5 s, 5 internal cycles) 40 external cycles; 72℃, 3 min, 1 cycle; 4℃, constant temperature. After the reaction was completed, the 96-well plate was taken out and centrifuged at 2000 rpm for 30 s.

[0076] III. Establishment of nucleic acid mass spectrometry detection method

[0077] The detection method of the c.681G>A, c.636G>A and c.-806C>T sites in the CYP2C19 gene comprises the following steps:

[0078] (1) Extraction of the genomic DNA of the sample to be detected: A commercial magnetic bead genomic DNA extraction kit was used, and the extracted genomic DNA met the following conditions: OD260 / 280 was 1.7-2.0; the DNA concentration was 5 ng / μL≤DNA concentration≤100 ng / μL.

[0079] (2) Multiplex PCR amplification: The PCR amplification mixture was shaken and mixed, centrifuged, and then 4 μL was added to each well of a 96-well plate, and 1 μL of the DNA of the sample to be detected was added. The well was sealed with sealing film, shaken and mixed for 30 s, centrifuged at 2000 rpm for 30 s, and the liquid on the wall of the tube was completely thrown to the bottom of the tube. The tube was placed in a PCR instrument for PCR amplification;

[0080] (3) SAP reaction: 2 μL of the prepared SAP reaction solution was added to the above-mentioned PCR reaction system solution, sealed with sealing film, shaken and mixed for 30 s, centrifuged at 2000 rpm for 30 s, and the liquid on the wall of the tube was completely thrown to the bottom of the tube. The tube was placed in a PCR instrument for PCR amplification;

[0081] (4) Single base extension reaction: 2 μL of the single base extension reaction mixture was added to the SAP reaction product, sealed with sealing film, shaken and mixed for 30 s, centrifuged at 2000 rpm for 30 s, and placed in a PCR instrument for amplification.

[0082] (5) After the reaction, centrifuge at 2000 rpm, add 30 μL of purified water to each well, and seal the 96-well plate with a new membrane. Shake the plate on a shaker, hold the 96-well plate with your hand during shaking, mix, and centrifuge at 2000 rpm.

[0083] (6) Import the edited site Assay into the analysis software, select the reaction well position of the sample to be detected, then import the sample name of the corresponding 96-well plate, place the 96-well plate and the detection chip in the corresponding position of the Gene-TOF2100 mass spectrometer, and then run the time-of-flight mass spectrometry detection.

[0084] (7) Interpretation of detection results: The single-base extension product is analyzed by mass spectrometry to detect the time of flight of the extension product in the vacuum tube, thereby calculating the molecular weight of the extension product. Then, the analysis software compares the molecular weight of the extension product with the pre-set molecular weight in the software to determine whether the peak of the extension product is wild type, heterozygous mutant or homozygous mutant. The judgment criteria are as follows:

[0085] a: If the mass spectrometry peaks corresponding to the wild type and the variant do not appear, whether the mass spectrometry peak corresponding to the extension primer exists or not, it is judged as experimental failure;

[0086] b: If the mass spectrometry peak corresponding to the wild type or the variant appears only one, it is judged as the homozygous genotype of the corresponding genotype;

[0087] c: If the mass spectrometry peaks corresponding to the wild type and the variant both appear, it is judged as the heterozygous type.

[0088] The mass spectrometry results of the multiple system are shown in Figure 1-3 , where the horizontal coordinate unit is molecular weight, and the vertical coordinate is peak intensity. Figure 1 is the detection result of the c.681G>A heterozygous plasmid; Figure 2 is the detection result of the c.636G>A heterozygous plasmid; Figure 3 is the detection result of the c.-806C>T heterozygous plasmid.

[0089] The detection method of Example 1 does not contain primers and probes for internal reference gene detection, reducing the operation in the experimental process and avoiding experimental errors caused by excessive operations. At the same time, the system without internal reference also reduces the experimental cost.

[0090] Comparative Example 1: Establishment of Fluorescent Quantitative PCR Detection Method

[0091] The present comparative example provides a kit for detecting SNP polymorphism of clopidogrel metabolism related gene by fluorescent quantitative PCR method. It comprises three kinds of PCR premix reaction liquid, positive control and blank control. Among them, the PCR premix reaction liquid comprises PCR buffer, site-specific primer and probe; the positive control is c.681G>A site wild type plasmid, mutant plasmid, c.636G>A site wild type plasmid and mutant plasmid, and c.-806C>T site wild type plasmid and mutant plasmid, and the concentration of each plasmid is 10 ng / μL, and the blank control is TE solution.

[0092] I. Design and synthesis of amplification primer and probe

[0093] Based on the region of c.681G>A, c.636G>A and c.-806C>T sites in CYP2C19 gene, amplification primers and high-specificity probes for fluorescent quantitative PCR analysis were designed, and the probes were two probes for wild type and mutant of gene polymorphism site respectively, wherein the primer sequence and the probe sequence are as follows:

[0094] Upstream primer of 681G>A site: CTTAGATATGCAATAATTTTCCCAC (SEQ ID NO. 10);

[0095] Downstream primer of 681G>A site: TCCATCGATTCTTGGTGTTCTT (SEQ ID NO. 11);

[0096] Wild type probe of 681G>A site: 5'-GATTATTTCCCAGGAACC-3' (SEQ ID NO. 12);

[0097] Mutant probe of 681G>A site: 5'-TGATTATTTCCCAGGAACC-3' (SEQ ID NO. 13);

[0098] Upstream primer of c.636G>A site: AACATCAGGATTGTAAGCACCC (SEQ ID NO. 14);

[0099] Downstream primer of c.636G>A site: GTACTTCAGGGCTTGGTCAAT (SEQ ID NO. 15);

[0100] Wild type probe of c.636G>A site: 5'-ACCCCCTGGATCCA-3' (SEQ ID NO. 16);

[0101] c. Mutant probe for site c.636G>A: 5'-AGCACCCCCTGAATCC-3' (SEQ ID NO. 17);

[0102] c. Upstream primer for site c.-806C>T: TTTGGAAGTTGTTTTGTTTTGC (SEQ ID NO. 18);

[0103] c. Downstream primer for site c.-806C>T: CTGAGGTCTTCTGATGCCCA (SEQ ID NO. 19);

[0104] c. Wild-type probe for site c.-806C>T: 5'-TGTTCTCAAAGCATCTCTGA-3' (SEQ ID NO. 20);

[0105] c. Mutant probe for site c.-806C>T: 5'-TCTCAAAGTATCTCTGA-3' (SEQ ID NO. 21)

[0106] The 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a non-fluorescent quencher group and connected with a MGB modification group. The fluorescent reporter group of the wild-type gene probe is selected from FAM group; and the fluorescent reporter group of the mutant gene probe is selected from MGB group.

[0107] II. PCR amplification reaction reagent

[0108] The PCR amplification reaction reagent includes the amplification primer and probe described above, and further includes other matching reagents required for the PCR amplification reaction system. The other matching reagents include PCR Buffer, Mg 2+ , dNTP, Taq enzyme. In a specific PCR amplification reaction system, the fluorescence quantitative PCR detection is carried out according to the following reagents and amounts (Tables 6-8):

[0109] Table 6 c.681G>A reaction solution

[0110] Component Amount (μL) 10x buffer (Mg 2+ )]]> 2 μL MgCl2(25 mM) 3 μL dNTP (10 mM) 2 μL Taq enzyme (5 U / ul) 0.1 μL c.681 G>A-F (10 uM) 0.4 μL c.681 G>A-R (10 uM) 0.4 μL c.681 G>A-WP (10 uM) 0.2 μL c.681 G>A-MP (10 uM) 0.1 μL Template 1 μL ddH2O Make up to 20 μL

[0111] The reaction condition of the site is: 95℃ for 30s, 95℃ for 10s, 62℃ for 30s; 40 cycles.

[0112] Table 7 c.636G>A reaction solution

[0113] Component Amount (μL) 10x buffer (Mg 2+ )]]> 2 μL MgCl2(25 mM) 3 μL dNTP (10 mM) 2 μL Taq enzyme (5 U / ul) 0.1 μL c.636 G>A-F (10 uM) 0.4 μL c.636 G>A-R (10 uM) 0.4 μL c.636 G>A-WP (10 uM) 0.2 μL c.636 G>A-MP (10 uM) 0.2 μL Template 1 μL ddH2O Make up to 20 μL

[0114] The reaction condition of the site is: 95℃ for 30s, 95℃ for 10s, 62℃ for 30s; 40 cycles.

[0115] Table 8c. -806C>T reaction solution

[0116] Component Amount (μL) 10 x buffer (Mg 2+ )]]> 2 μL MgCl2(25 mM) 3 μL dNTP (10 mM) 2 μL Taq enzyme (5 U / ul) 0.1 μL c.-806 C>T-F (10 uM) 0.4 μL c.-806 C>T-R (10 uM) 0.4 μL c.-806 C>T-WP (10 uM) 0.15 μL c.-806 C>T-MP (10 uM) 0.1 μL Template 1 μL ddH2O Make up to 20 μL

[0117] Reaction conditions for this site: 95°C for 30 s, 95°C for 10 s, 65°C for 30 s; 40 cycles.

[0118] III. Establishment of a fluorescent quantitative PCR detection method for detecting the c.681G>A, c.636G>A, and c.-806C>T sites in the CYP2C19 gene The detection method for the c.681G>A, c.636G>A, and c.-806C>T sites in the CYP2C19 gene comprises the following steps:

[0119] (1) Extraction of the genomic DNA of the sample to be tested: Commercially available magnetic bead-based genomic DNA extraction kits are used, and the extracted genomic DNA meets the following conditions: OD260 / 280 is 1.7-2.0; 5 ng / μl≤DNA concentration≤100 ng / μl.

[0120] (2) Preparation of the PCR reaction solution: The reaction solution is prepared according to the reaction system for each polymorphic site; the same sample DNA is added to the mutation site system detection system, centrifuged briefly, and mixed uniformly;

[0121] (3) Fluorescent quantitative PCR detection: The prepared PCR system is placed in a fluorescent PCR instrument, and fluorescent quantitative PCR amplification (Table 9) is performed to detect the polymorphism of the CYP2C19 gene c.681G>A, c.636G>A, and c.-806C>T sites.

[0122] (4) Result interpretation: The detection results of different genotypes of plasmids are shown in Table 9. Figure 1-3

[0123] Table 9. Amplification results

[0124]

[0125] Example 2: Verification experiment

[0126] This example provides two verification experiments for the effect of the two kits for detecting the SNP polymorphism of the clopidogrel metabolism gene, and the experimental process is as follows:

[0127] Five venous blood samples to be tested were detected using the method of Example 1 and Comparative Example 1, and the amplification product of Comparative Example 1 was sent to Shanghai Generay Biotech for Sanger sequencing. The fluorescence PCR amplification Ct value results of the sample detected by Comparative Example 1 are shown in Table 10; the detection results of the sample using the method of Example 1 are shown in Table 11. Figure 7

[0128] Table 10. Fluorescent PCR amplification results of samples​​

[0129]

[0130]

[0131] The results show that the coincidence rate of the detection results of the nucleic acid mass spectrum kit with the results of the fluorescent quantitative PCR method and Sanger sequencing is 100%.

[0132] In conclusion, the kit can detect multiple samples simultaneously, has the advantages of low cost, strong universality, high accuracy, etc., and can judge and guide clinical medication according to genotypes.

[0133] The above-described embodiments only express the specific implementation of the present application, which is described in detail, but should not be construed as a limitation on the protection scope of the present application. It should be noted that, for ordinary skilled persons in the art, without departing from the technical concept of the present application, a number of modifications and improvements can be made, which are all within the protection scope of the present application.

Claims

1. A kit for detecting a SNP polymorphism of a gene related to clopidogrel metabolism, characterized by comprising: a primer set for detecting a SNP polymorphism of a gene related to clopidogrel metabolism; and a probe for detecting a SNP polymorphism of a gene related to clopidogrel metabolism. The clopidogrel metabolism-related gene is CPY2C19 gene, including c.681G>A, c.636G>A, and c.-806C>T three sites; The kit comprises upstream and downstream amplification primer mixtures and single base extension primer mixtures of the three sites; The upstream amplification primer sequence of the c.681G>A site is shown as SEQ ID NO. 1, the downstream amplification primer sequence is shown as SEQ ID NO. 2, and the single base extension primer sequence is shown as SEQ ID NO. 3; The upstream amplification primer sequence of the c.636G>A site is shown as SEQ ID NO. 4, the downstream amplification primer sequence is shown as SEQ ID NO. 5, and the single base extension primer sequence is shown as SEQ ID NO. 6; The upstream amplification primer sequence of the c.-806C>T site is shown as SEQ ID NO. 7, the downstream amplification primer sequence is shown as SEQ ID NO. 8, and the single base extension primer sequence is shown as SEQ ID NO.

9.

2. The kit for detecting the SNP polymorphism of the clopidogrel metabolism-related gene according to claim 1, wherein the SNP polymorphism is selected from the group consisting of the SNP polymorphisms of the genes listed in Table 1. The kit further comprises: PCR amplification reagents: 10x PCR buffer, 25mM MgCl2, 25mM dNTP Mix, 5U / μL polymerase chain reaction enzyme; SAP enzymolysis reagents: SAP buffer, SAP enzyme (1.7U / μL); Extension reagents: extension buffer, extension enzyme, extension termination solution; Nuclease-free water.

3. The kit for detecting the SNP polymorphism of the clopidogrel metabolism-related gene according to claim 2, wherein the SNP polymorphism is selected from the group consisting of the SNP polymorphisms of the genes listed in Table 1. The upstream and downstream amplification primer mixtures are equal-volume mixtures of the upstream and downstream amplification primers of the three sites, and the final concentration is 0.5-2μM; the single base extension primer mixture is an equal-volume mixture of the upstream and downstream amplification primers of the three sites, and the final concentration is 5-10μM; and the solvents are TE buffers.

4. The method of using a kit for detecting the SNP polymorphism of the clopidogrel metabolism-related gene according to any one of claims 1 to 3, wherein the SNP polymorphism is rs 16865147. The method comprises the following steps: S1: using the DNA of the sample to be tested as a template, mixing the upstream and downstream amplification primer mixtures with the PCR amplification reagents to form a PCR reaction system, performing multiplex PCR amplification, and obtaining an amplification product; S2: using SAP enzyme to dephosphorylate the amplification product obtained in step S1, and obtaining a dephosphorylated product; S3: using extension reagents and a single base extension primer mixture to prepare an extension reaction system, performing single base extension reaction on the product obtained in step S2, and obtaining an extension product; S4: using desalting resin to purify the extension product obtained in step S3, removing salt ions in the reaction, and obtaining a purified extension product; S5: performing flight mass spectrometry chip spotting on the purified extension product obtained in S4, using the difference in the mass-to-charge ratio of nucleic acid fragments as a result detection signal, and rapidly judging whether the CPY2C19 gene sequence has a mutation.

5. The method of using the kit for detecting SNP polymorphisms of clopidogrel metabolism-related genes as described in claim 4, characterized in that, In step S1, the multiplex PCR amplification reaction conditions are as follows: 95℃ for 2min, 1 cycle; 95℃ for 30s, 60℃ for 30s, 72℃ for 60s, 45 cycles; 72℃ for 5min, 1 cycle; and 4℃ constant temperature.

6. The method of using the kit for detecting SNP polymorphisms of clopidogrel metabolism-related genes as described in claim 5, characterized in that, In step S2, the dephosphorylation conditions are as follows: 37℃ for 40min; 85℃ for 5min; and 4℃ constant temperature.

7. The method of using the kit for detecting SNP polymorphisms of clopidogrel metabolism-related genes as described in claim 6, characterized in that, In step S3, the single base extension reaction conditions are: 95℃ 30s for 1 cycle; 95℃ 5s for 1 cycle, 48℃ 5s, 80℃ 5s for 5 internal cycles, 40 external cycles; 72℃ 3min for 1 cycle; 4℃ constant temperature.

8. The method of using a kit for detecting a SNP polymorphism of a clopidogrel metabolism-related gene according to claim 7, wherein The volume ratio of the amplification system in step S1, the dephosphorylation system in step S2 and the extension system in step S3 is 5:2:

2.

9. Use of the kit for detecting SNP polymorphism of clopidogrel metabolism related gene in claim 1-3 in clinical evaluation of clopidogrel in vivo metabolism state.

10. Use of the kit for detecting SNP polymorphism of clopidogrel metabolism related gene in claim 1-3 in guiding clopidogrel clinical individualized medication.

Citation Information

Patent Citations

  • Detection method for individualized medication gene polymorphism

    CN110157795A

  • Composition, kit and method for detecting CYP2C19 gene polymorphism and application

    CN110241231A