Isothermal amplification primer and probe for detecting acinetobacter baumannii, isothermal amplification kit and detection method

By designing specific primers and probes combined with isothermal amplification technology and utilizing HybriDetect test strips, the problems of long detection time and complex equipment in existing Acinetobacter baumannii detection technologies have been solved, achieving rapid and accurate detection results.

CN120905409APending Publication Date: 2025-11-07QINGHAI UNIV AFFILIATED HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511016590.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-23
Publication Date
2025-11-07

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the rapid and accurate detection of Acinetobacter baumannii, especially in low-resource areas. Furthermore, traditional methods are time-consuming, require complex equipment, are costly, and struggle to distinguish between closely related species.

Method used

We designed specific primers and probes combined with isothermal amplification technology and used HybriDetect test strips for detection, achieving rapid and accurate point-of-care testing.

Benefits of technology

It enables rapid and accurate detection of Acinetobacter baumannii, with a sensitivity of 1 copy/reaction and a low detection limit, making it suitable for use in low-resource areas.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905409A_ABST
    Figure CN120905409A_ABST
Patent Text Reader

Abstract

The invention relates to the field of thallus detection, and particularly discloses an isothermal amplification primer, a probe and an isothermal amplification kit for detecting acinetobacter baumannii and a detection method of the acinetobacter baumannii. The invention provides an isothermal amplification primer and a probe for detecting acinetobacter baumannii. The sequences of the isothermal amplification primer and the probe for detecting acinetobacter baumannii are as follows: an upstream primer: 5 '-CAAGGTCGTTTAC AAGGCATATGACGGT-3'; the downstream primer is 5 '-GTTGCAATGCCGGGCCTTCATCC TCAATT-3', and the downstream primer is 5 '-GTTGCAATGCCGGGCCTTCCTCC The probe is characterized in that the sequence of the probe is 5 '-TAAAGCATTGAAGATCGTTTGGATCAAG CTAAG-THF-TAGTACCAGAACTTG-3', and the sequence of the probe is shown in the description. The combination of the primer and the probe is used for detecting the acinetobacter baumannii, and has the advantages of high specificity, high sensitivity and high accuracy.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of bacterial detection, in particular to a constant temperature amplification primer and probe for detecting Acinetobacter baumannii, a constant temperature amplification kit and a detection method. BACKGROUND

[0002] Acinetobacter baumannii is a gram-negative bacterium with a wide range of infections, including pneumonia, sepsis, urinary tract infection and wound infection. Studies have shown that patients infected with Acinetobacter baumannii can spread the pathogen to the air in the ICU, and still cause new infections after several months. The spread and prevalence of Acinetobacter baumannii in medical institutions benefit from its tolerance to dry and humid environments, resistance to disinfectants and antibiotics, and biofilm formation characteristics that lead to colonization of inert surfaces and medical devices, becoming an important medical-related pathogen. Therefore, quickly and accurately detecting the pathogenic bacteria infected by the patient plays a very important role in further diagnosis and treatment of the patient's condition.

[0003] In the medical and health system, Acinetobacter baumannii is usually identified by traditional methods such as phenotypic system and molecular method. These methods usually require several days of culture, and also have the defect of being difficult to distinguish between closely related species. Therefore, in the case of bacterial infection, these traditional methods are not fast and accurate enough. Due to the limitations of these techniques, some patients may miss the best treatment. Other conventional methods, such as polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA), also have the problems of long detection time, difficult result reading, and the need for complex thermal cycler instruments, enzyme labelers, and a large amount of consumables, which are not suitable for low-resource areas. In order to overcome the defects of the existing detection methods of Acinetobacter baumannii, it is urgent to develop a sensitive, selective and cost-effective detection tool or method to detect Acinetobacter baumannii. SUMMARY

[0004] In order to overcome the above-mentioned defects and deficiencies of the existing detection methods of Acinetobacter baumannii, the present application proposes a constant temperature amplification primer and probe for detecting Acinetobacter baumannii, a constant temperature amplification kit and a detection method.

[0005] In order to achieve the above-mentioned purpose, the present application adopts the following technical solutions:

[0006] A constant temperature amplification primer and probe for detecting Acinetobacter baumannii, the sequence of the primer is:

[0007] Upstream primer: 5'-CAAGGTCGTTTACAAGGCATCATCGACGGT-3';

[0008] Downstream primer: 5'-GTTGCAATGCCGGGGCCTTCATCCTCAATT-3';

[0009] The sequence of the probe is: 5'-TAAAGCATTTGAAGATCGTTTGGATCAAGCTAAG-THF-TAGTACCAGAACTTG-3'.

[0010] Optionally, a fluorescent group is labeled at the 5' end of the probe sequence, and a phosphoramidite is modified at the 3' end.

[0011] Optionally, the fluorescent group is FAM, and the sequence of the probe after labeling the fluorescent group and modifying the phosphoramidite is 5'-[FAM]TAAAGCATTTGAAGATCGTTTGGATCAAGCTAAG[THF]TAGTACCAGAACTTG[C3spacer]-3'.

[0012] The application also provides a genomic isothermal amplification kit for Acinetobacter baumannii, wherein the kit comprises the primer and the probe.

[0013] Optionally, the genomic isothermal amplification kit for Acinetobacter baumannii further comprises a basic buffer, a magnesium acetate solution, a MIRA dry powder reagent and deionized water.

[0014] The application also provides a use method of the genomic isothermal amplification kit for Acinetobacter baumannii, wherein the use method comprises the following steps: extracting a genome of a to-be-detected Acinetobacter baumannii as a template, and performing recombinase-mediated isothermal nucleic acid amplification by using the kit.

[0015] Optionally, in the use method of the genomic isothermal amplification kit for Acinetobacter baumannii, the recombinase-mediated isothermal nucleic acid amplification system comprises the following reagents and dosages:

[0016]

[0017] Optionally, the amplification condition of the recombinase-mediated isothermal nucleic acid amplification system is 37-42℃ for 15-20 min.

[0018] Optionally, the amplification condition of the recombinase-mediated isothermal nucleic acid amplification system is 39℃ for 20 min.

[0019] The application also provides a detection method for Acinetobacter baumannii, wherein the detection method comprises the following steps: adding a genomic isothermal amplification product of Acinetobacter baumannii into a HybriDetect test strip, and reading a detection result after 15-20 min.

[0020] Compared with the prior art, the application has the following beneficial effects:

[0021] The isothermal amplification primer and probe for detecting Acinetobacter baumannii provided by the application are designed according to the AdeS gene of Acinetobacter baumannii, can specifically recognize the AdeS gene of Acinetobacter baumannii, and achieve the effect of accurately detecting Acinetobacter baumannii in a sample. Meanwhile, the primer and probe can achieve the effect of bedside detection by combining the HybriDetect test strip through the isothermal amplification technology.

[0022] In addition, the isothermal amplification primer and probe for detecting Acinetobacter baumannii provided by the application can realize accurate and obvious detection of a positive result at a low concentration of 6-10 ng / μL of the isothermal amplification product of the AdeS gene of Acinetobacter baumannii, and the detection limit can reach 1 copy / reaction by combining the detection method of the HybriDetect test strip. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 It is a detection result judgment standard chart of the HybriDetect test strip in the embodiment;

[0024] Figure 2 It is a detection result chart of the amplification product by using the HybriDetect test strip in the embodiment. DETAILED DESCRIPTION

[0025] The specific embodiments of the application will be further described in detail below in combination with the drawings and the embodiments. The following embodiments are used to illustrate the application, but are not used to limit the scope of the application.

[0026] Embodiment 1

[0027] 1.1 Materials

[0028] 1.1.1 Sample: clinical sample of patient alveolar lavage fluid.

[0029] 1.1.2 Instruments: Qubit fluorescence quantification instrument, constant temperature shaking metal bath, vortex oscillator, palm centrifuge.

[0030] 1.1.3 Reagent consumables: Amply Future DNA isothermal rapid amplification kit (item number WLN8203KIT), Amply Future HybriDetect test strip (item number WLFS8204), dsDNA quantification kit (Invitrogen Qubit dsDNA BR Assay Kit), high-purity nucleic acid purification kit (Roche High Pure PCR Template Preparation Kit). TM Qubit TM dsDNA quantification kit), high-purity nucleic acid purification kit (Roche High Pure PCR Template Preparation Kit).

[0031] 1.2 Method

[0032] 1.2.1 Bacterial nucleic acid extraction

[0033] The operation was performed using a high-purity nucleic acid purification kit (High Pure PCR Template Preparation Kit of Roche).

[0034] ① In a 1.5 mL centrifuge tube, resuspend the bacterial body (Acinetobacter baumannii pure strain) using 200 μL of PBS, add 5 μL of lysozyme, and treat at 37°C for 15 min on a constant-temperature shaking metal bath;

[0035] ② Add 200 μL of Binding Buffer and 40 μL of proteinase K to the above centrifuge tube, mix, and treat at 70°C for 10 min on a constant-temperature shaking metal bath, and add 100 μL of isopropanol;

[0036] ③ Place the adsorption column into a collection tube, and transfer the liquid in the above centrifuge tube into the adsorption column, and centrifuge at 8000 x g for 1 min;

[0037] ④ Discard the liquid in the collection tube, add 500 μL of Inhibitor Removal Buffer to the adsorption column, and centrifuge at 8000 x g for 1 min;

[0038] ⑤ Discard the liquid in the collection tube, add 500 μL of Wash Buffer to the adsorption column, centrifuge at 8000 x g for 1 min, and repeat the step once;

[0039] ⑥ Discard the liquid in the collection tube, centrifuge at 13000 x g for 1 min to remove residual Wash Buffer, and place the adsorption column into a new 1.5 mL centrifuge tube;

[0040] ⑦ Add 100 μL of Elution Buffer to the adsorption column, centrifuge at 8000 x g for 1 min to collect the nucleic acid liquid.

[0041] 1.2.2 Nucleic acid quantification

[0042] The operation was performed using a dsDNA quantification kit (Invitrogen TM Qubit TM dsDNA quantification kit).

[0043] ① Prepare 0.5 ml of thin-walled centrifuge tubes (thin-walled centrifuge tubes = sample number to be tested + 2 standard samples) needed for detection, and label the thin-walled centrifuge tubes with sample numbers;

[0044] ② Preparation of working solution: use a new plastic tube to mix Reagent The dsDNA HS Buffer is diluted at a ratio of 1:200 and vortexed until uniform;

[0045] ③ Add 190 μL of the working solution to two thin-walled centrifuge tubes for the standard, and then add 10 μL of Qubit dsDNA HS Standard #1 and Qubit dsDNA HS Standard #2, respectively, and vortex until uniform; The working solution is divided into two thin-walled centrifuge tubes for the standard, and then 10 μL of Qubit dsDNA HS Standard #1 and Qubit dsDNA HS Standard #2 are added, respectively, and vortexed until uniform;

[0046] ④ Test sample: according to the actual amount needed, divide the working solution to ensure that the measurement volume is 200 μL; The working solution is divided to ensure that the measurement volume is 200 μL;

[0047] ⑤ Add the test sample to the corresponding test tube to ensure that the final volume is 200 μL; vortex until uniform;

[0048] ⑥ Place the prepared standard and sample at room temperature for 3 min and then test;

[0049] ⑦ Detect and record the sample (nucleic acid template) mass concentration by Qubit fluorometer.

[0050] 1.2.3 Reaction system preparation and amplification:

[0051] ① Take out the liquid components of the DNA constant-temperature rapid amplification kit in advance, melt at room temperature, and ensure that the liquid components are shaken and mixed uniformly;

[0052] ② According to the experimental needs, take out the corresponding number of dry powder reaction tubes, and add 29.4 μL of A buffer to each dry powder reaction tube;

[0053] ③ Add 2 μL of 10 μM upstream primer and 10 μM downstream primer, respectively, and 0.6 μL of probe to each reaction tube;

[0054] ④ Add 5 μL of nucleic acid template and 8.5 μL of ultrapure water to the reaction tube, respectively;

[0055] ⑤ Finally, add 2.5 μL of B buffer to the reaction tube and mix;

[0056] ⑥ After mixing, centrifuge the reaction solution to the bottom of the tube, and then immediately place the reaction tube in a constant-temperature device, incubate at 39°C for 20 min, and the constant-temperature amplification system is shown in Table 1.

[0057] Table 1 Constant-temperature amplification system

[0058]

[0059] 1.2.4 Sample detection

[0060] ①According to the number of detections, the corresponding HybriDetect test strip is taken out and marked to distinguish the experimental group. Each test strip can only be used for one detection;

[0061] ②Take 10 μL of nucleic acid constant temperature amplification product in a centrifugal tube and dilute it 10 times with sterile ddH2O, and mix well;

[0062] ③Take 80 μL of diluted reaction product and drop it into the sample well. Record the detection results in the judgment area within 15 min;

[0063] The detection result judgment standard is shown in Figure 1 .

[0064] 1.3 Detection results

[0065] 1.3.1 Target gene selection and primer and probe design

[0066] In this study, AdeS gene was used as the target gene for detection, and primers and probes were designed. The specificity of the primers and probes was tested. The designed primer and probe sequences are shown in Table 2.

[0067] Table 2 Primer and probe sequences for detection of Acinetobacter baumannii

[0068]

[0069] 1.3.2 Sensitivity test of primers and probes

[0070] Qubit quantified Acinetobacter baumannii nucleic acid was used to dilute the nucleic acid to 4-10 ng / μL, 5-10 ng / μL, and 6-10 ng / μL. Since the genome of Acinetobacter baumannii is about 4 Mbp, when the nucleic acid concentration is 6-10 ng / μL, it is equivalent to adding about 1 copy of template in each reaction. The detection results of HybriDetect test strip show that the combination of Aba-AdeS-F2 and Aba-AdeS-R2 has very high sensitivity, as shown in Figure 2 ( Figure 2 B, E, and H in the middle mark three test strips, respectively, to detect the constant temperature amplification product obtained by the combination of Aba-AdeS-F2 and Aba-AdeS-R2. B adds 5 μL of 4-10 ng / μL nucleic acid template, E adds 5 μL of 5-10 ng / μL nucleic acid template, and H adds 5 μL of 6-10 ng / μL nucleic acid template), as shown in the table, the detection limit can reach 1 copy / reaction.

[0071] 1.3.3 Clinical sample test

[0072] Using 200 clinical samples for testing, 19 of which are positive for Acinetobacter baumannii, and the rest of the samples are negative for Acinetobacter baumannii. The above detection method is used for detection by combining the primers and the probe provided by the application with the HybriDetect test strip. Among the 19 positive samples, only one is weakly positive, and the rest are positive. Among the 181 negative samples, one is positive, and the rest are negative. The detection sensitivity is 94.74%, the specificity is 99.45%, and the total coincidence rate is 99%, which has a very high accuracy in the early detection of Acinetobacter baumannii.

Claims

1. An isothermal amplification primer and probe for detecting Acinetobacter baumannii, characterized by: The sequence of the primer is: Upstream primer: 5'-CAAGGTCGTTTACAAGGCATCATCGACGGT-3'; Downstream primer: 5'-GTTGCAATGCCGGGGCCTTCATCCTCAATT-3'; The sequence of the probe is: 5'-TAAAGCATTTGAAGATCGTTTGGATCAAGCTAAG-THF-TAGTACCAGAACTTG-3'.

2. The isothermal amplification primer and probe for detecting Acinetobacter baumannii according to claim 1, characterized by: A fluorescent group is labeled at the 5' end of the probe sequence, and a phosphoramidite is modified at the 3' end.

3. The isothermal amplification primer and probe for detecting Acinetobacter baumannii according to claim 2, characterized by: The fluorescent group is FAM, and the sequence of the probe after labeling the fluorescent group and modifying the phosphoramidite is 5'-[FAM]TAAAGCATTTGAAGATCGTTTGGATCAAGCTAAG[THF]TAGTACCAGAACTTG[C3spacer]-3'.

4. A genomic isothermal amplification kit for Acinetobacter baumannii, characterized by comprising: The kit comprises the primer and the probe according to any one of claims 1-3.

5. The genomic isothermal amplification kit of Acinetobacter baumannii according to claim 4, characterized in that: It also comprises a basic buffer solution, a magnesium acetate solution, a MIRA dry powder reagent, and deionized water.

6. A method of using a genomic isothermal amplification kit for Acinetobacter baumannii, characterized by: The genome of the Acinetobacter baumannii to be tested is extracted as a template, and the kit according to claim 4 or 5 is used for recombinase-mediated isothermal nucleic acid amplification.

7. The method of using the genomic amplification kit of Acinetobacter baumannii according to claim 6, characterized in that: The recombinase-mediated isothermal nucleic acid amplification system comprises the following reagents and amounts:

8. The method of using the genomic amplification kit of Acinetobacter baumannii according to claim 6, characterized in that: The amplification conditions of the recombinase-mediated isothermal nucleic acid amplification system are 37-42℃, 15-20min.

9. The method of using the genomic amplification kit of Acinetobacter baumannii according to claim 8, characterized in that: The amplification conditions of the recombinase-mediated isothermal nucleic acid amplification system are 39℃, 20min.

10. A method of detecting Acinetobacter baumannii, comprising: The isothermal amplification genomic product of Acinetobacter baumannii is added to the HybriDetect test strip, and the detection result is read after 15-20min.