Soybean saline-alkaline tolerance related SNP (Single Nucleotide Polymorphism) site and application thereof

Abstract

The invention discloses a soybean saline-alkaline tolerance related SNP (Single Nucleotide Polymorphism) site and application thereof, and relates to the technical field of soybean saline-alkaline tolerance gene breeding, the key points of the technical scheme are as follows: the invention provides the SNP site based on GmRfg1 (Glyma. 20G212300), the site can divide a soybean material into E and Q amino acid residue types, and the Q amino acid residue type shows higher saline-alkaline tolerance. The breeding of the Q amino acid residue type (C nucleotide type) soybean variety has important significance for improving the saline-alkaline tolerance of the soybeans and increasing the planting area of the soybeans in saline-alkali soil.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of soybean salt-tolerant gene breeding, more particularly, it relates to a soybean salt-tolerant related SNP site and application thereof. BACKGROUND

[0002] In China, the total area of saline-alkali soil is about 9913 million mu, accounting for about 10% of the total area of China and 79% of the total cultivated land area of China. Saline-alkali soil has seriously hindered the growth and yield of soybeans and has become a major challenge to global agricultural progress. Therefore, it is crucial to analyze the mechanism of soybean salt-tolerance, improve the salt-tolerance of soybeans, and fully utilize saline-alkali soil for soybean cultivation to increase soybean yield.

[0003] Rhizosphere microorganisms that promote plant growth (PGPR) have shown great potential in alleviating salt stress in plants. These PGPR, which exist in the rhizosphere along with root exudates, can provide various benefits to plants, such as nutrients, growth hormones, antioxidants, and systemic resistance, especially in high salt concentration environments. Therefore, PGPR derived from saline-alkali environments have the ability to mitigate the negative effects of salt on crops, thereby improving crop productivity in saline-alkali soil conditions. In addition, specific plants and growth conditions are associated with different microorganisms, indicating the existence of diverse microbe-host associations. Among the numerous PGPR, rhizobia, as a special class of bacteria, not only form root nodules on legume roots and fix atmospheric nitrogen to provide nutrients for plants, but also some rhizobium species have been found to promote the growth of non-legume plants in saline-alkali environments, showing great potential in improving the productivity of saline-alkali soils. These findings emphasize the importance of in-depth research and utilization of PGPR, especially rhizobia, for improving crop yield in saline-alkali soils and sustainable agricultural development. SUMMARY

[0004] The purpose of the present application is to provide a soybean salt-tolerant related SNP site and its application, which can divide soybean materials into E and Q amino acid residue types, and the Q amino acid residue type shows higher salt-tolerant ability.

[0005] The above technical purpose of the present application is realized by the following technical scheme: a soybean salt-tolerant related SNP site, which is located in the soybean gene Glyma.20G212300, and the salt-tolerant related amino acid residue is 730; the polymorphism is C / G, when the SNP site is C nucleotide, the corresponding amino acid residue at 730 is Q (glutamine); when the SNP site is G nucleotide, the corresponding amino acid residue at 730 is E (glutamic acid).

[0006] The application further provides a primer combination capable of amplifying the nucleotide sequence encoding the amino acid residue at position 730, and the primer combination is as follows:

[0007] Gm16G212300-seq-F16: GGCAGATGTTCGTAAATCTAAG;

[0008] Gm16G212300-seq-R8: GATCGAACCACTCTGGAATCC.

[0009] The application further provides a kit for detecting the salt-tolerant ability of soybeans, and the kit comprises the primer combination.

[0010] The application further provides application of the SNP site or the primer combination in preparation of a kit for identifying the salt-tolerant ability of soybeans.

[0011] The application further provides application of the SNP site or the primer combination in screening of soybean varieties with salt-tolerant ability.

[0012] The application further provides application of the SNP site or the primer combination in breeding of soybean varieties with Q amino acid residue type (C nucleotide type).

[0013] The application further provides a method for identifying the salt-tolerant ability of soybeans, and the specific steps of the method are as follows:

[0014] Step 1: extracting DNA of the soybean to be detected;

[0015] Step 2: performing PCR reaction by using the primer combination to detect the genotype of the soybean to be detected.

[0016] Further, the PCR reaction condition in step 2 is as follows: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 58℃ recombination for 5s, 72℃ extension for 15s, totally 35 cycles; 72℃ terminal extension for 5min; and the PCR amplification system is as follows: 2x Rapid Taq MasterMix 7.5μL, F 0.5μL, R 0.5μL, DNA template 1μL and ddH2O 7.5μL.

[0017] In summary, the application has the following beneficial effects:

[0018] The application provides a SNP molecular marker based on GmRfg1 (Glyma.20G212300), which can divide the soybean materials into E and Q amino acid residue types, and the Q amino acid residue type shows higher salt-tolerant ability. Breeding of the soybean variety with Q amino acid residue type (C nucleotide type) is of great significance for improving the salt-tolerant ability of soybeans and increasing the planting area of soybeans. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 is the plant and nodule phenotype of different soybean varieties inoculated with and without SinorSAS under mixed salt-alkali treatment in embodiments of the present application;

[0020] Figure 2 is the nodule phenotype of different soybean varieties inoculated with SinorSAS in embodiments of the present application;

[0021] Figure 3 is the cloning of genes that improve the salt-alkali tolerance of soybeans after inoculation with SinorSAS in embodiments of the present application;

[0022] Figure 4 is the plant and nodule phenotype of wild type and mutants after inoculation with SinorSAS in embodiments of the present application;

[0023] Figure 5 is the structure and amino acid polymorphism of the Rfg1 gene in Chinese soybean core germplasm resources;

[0024] Figure 6 is the phenotype of HN55 hairy roots after modification of the 730th amino acid residue in embodiments of the present application;

[0025] Figure 7 Electrophoresis map of different soybean materials using F16 / R8 amplification

[0026] Figure 8 Results of different genotypes of soybean materials using F16 sequencing

[0027] Figure 9 is the mixed salt-alkali treatment of different haplotype soybean varieties in embodiments of the present application. DETAILED DESCRIPTION

[0028] The following will be described in detail below in conjunction with the accompanying Figures 1-9 The present application will be further described in detail.

[0029] Embodiments:

[0030] We designed two experiments after the germination of soybean seeds. One group was irrigated with only 150 mM mixed salt-alkali solution (MSAS), and the other group was irrigated with 150 mM MSAS and inoculated with SinorSAS at the same time. Compared with irrigation with only 150 mM MSAS, some soybean varieties did not appear to be senescent or wilted after inoculation with rhizobium at the same time, but instead remained in a healthier state for a longer period of time.

[0031] Different soybean varieties exhibited different nodule and nitrogen fixation phenotypes after inoculation with SinorSAS. Some soybean varieties could produce a large number of normal nodules, while others did not form nodules or only formed nodule-like structures. Identification after inoculation with rhizobium showed that some varieties (such as JY202 and HN55) could form normal nodules, while others (such as Wm82, ZD41 and XCD26) produced nodule-like structures or did not form nodules at all Figure 3 , 4) To mine the genes that improve the salt-tolerant ability of soybeans after inoculation with SinorSAS under mixed salt-alkali treatment, we selected a recombinant inbred line (RIL) population that was phenotypically and nodule phenotypically separated. We performed SNP-Index analysis on resequenced strains from ZD41 x HD18 RIL F8, ZD41 x JY202 RIL F8 and ZD41 x ZJD RIL F8. The results showed that significant peaks appeared on chromosome 16 in all three populations, and these peak intervals overlapped Figure 3 g) We believe that these overlapping intervals may be candidate intervals containing related genes. The interval is located at Chr16: 35,861,124... 37,917,613, with a length of 4.05 Mb, and contains 251 genes.

[0032] To further narrow down the candidate interval, we combined the single nucleotide polymorphism (SNP) markers obtained by resequencing with the phenotype data, and used the QTLiciMapping software (version 4.2.53) to calculate the recombination rate between SNPs to screen markers associated with phenotypes. We found a significant peak between SNP2902 and 2904, and the reported host incompatibility gene Rj2 / Rfg1 is located near these two markers Figure 3 h).

[0033] In addition, we treated Wm82 and rfg1 mutants with 150 mM MSAS and SinorSAS at the same time. After 18 days of inoculation, Wm82 did not produce nodules, but the rfg1 mutant produced normal nodules. Further, after 28 days of treatment, Wm82 wilted, while the rfg1 mutant continued to grow normally Figure 5 a, b) In summary, we believe that the gene that improves the salt-tolerant ability of soybeans after inoculation with SinorSAS is GmRfg1.

[0034] In the reference genome Glycine max Wm82.a2.vl, GmRfgl (Glyma.16G212300) consists of five exons, encoding a protein containing 1052 amino acids, which contains TIR, NB-ARC and LRR domains. Among them, the amino acid residues of the 730, 735, 742, 755 and 757 sites affecting the function of GmRfgl are located on the 4th exon Figure 6 a) We sequenced the nucleotide sequence of the fourth exon region of 312 Chinese soybean germplasm resources and found seven nucleotide haplotypes, corresponding to seven amino acid combination types. Among them, in addition to the two previously reported amino acid residue combinations, five new amino acid residue combination types were first discovered Figure 6 b) Therefore, we speculate that there may be new amino acid residue combinations affecting the function of GmRfgl.

[0035] Among the newly discovered amino acid residue combination types, the A05 amino acid residue combination type (E730, E735, P742, E755, R758) is different from the previously reported Rfg1 only at the 730th amino acid residue. Therefore, we inoculated SinorSAS to the material containing A05 amino acid residue type (XCD26) after salt-alkali treatment and conducted nodule phenotype identification. We found that although only the 730th amino acid residue was changed, the nodule phenotype of the plant was consistent with GmRfgl.

[0036] To determine whether the change of the 730th amino acid residue affects the salt-alkali tolerance of the plant, we modified the 730th amino acid residue Q to E in Gmrfg1 and conducted a hairy root transformation experiment in soybean material HN55 with rfg1 amino acid residue type. After inoculation with SinorSAS for 21 days, nodule phenotype identification was conducted. We found that after modifying the 730th amino acid residue Q to E, the number of root nodules was significantly reduced Figure 7 ), and the salt-alkali tolerance was weakened. In summary, we believe that the 730th amino acid residue is essential for GmRfgl to recognize SinorSAS and perform symbiotic nitrogen fixation, and is essential for improving the salt-alkali tolerance of soybean.

[0037] According to the above results, we designed a pair of PCR amplification primers on both sides of the SNP corresponding to the 730th amino acid. This pair of primers can amplify the target sequence to obtain the target fragment, and then use Sanger sequencing to sequence the target fragment to identify the SNP type of the material. The amplification sequence primer is:

[0038] Gm16G212300-seq-F16: GGCAGATGTTCGTAAATCTAAG

[0039] Gm16G212300-seq-R8:GATCGAACCACTCTGGAATCC

[0040] The amplification procedure is as follows: using PCR amplification was performed using the Flash Master Mix high-fidelity PCR kit (Novozymes). The PCR reaction conditions were: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 56℃ annealing for 5s, 72℃ extension for 15s, for a total of 35 cycles; final extension at 72℃ for 5min. The PCR amplification system consisted of 7.5μL of 2×Rapid Taq MasterMix, 0.5μL of F, 0.5μL of R, 1μL of DNA template, and 7.5μL of ddH2O. The fragment length was 965bp.

[0041] We used this primer pair to identify soybean resource materials and evaluated their salt tolerance by salt treatment and inoculation with SinoSAS for soybeans with different amino acid residue types. We found that the Q amino acid residue type (nucleotide base C) had higher salt tolerance. Figure 9 ).

[0042] This specific embodiment is merely an explanation of the present invention and is not intended to limit the invention. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A soybean salt-tolerant related SNP site, characterized in that: The SNP site is located in Glyma.20G212300 of soybean, and the salt-tolerant related amino acid residue is 730; the polymorphism is C / G, and when the SNP site is C nucleotide, the amino acid residue at 730 is Q (glutamine); and when the SNP site is G nucleotide, the amino acid residue at 730 is E (glutamic acid). 2.A primer combination capable of amplifying the nucleotide sequence encoding the amino acid residue at 730 according to claim 1, wherein the primer combination is: Gm16G212300-seq-F16: GGCAGATGTTCGTAAATCTAAG; Gm16G212300-seq-R8: GATCGAACCACTCTGGAATCC.

3. A kit for detecting salt-alkali tolerance of soybean, characterized in that: The nucleotide sequence encoding the amino acid residue at 730 according to claim 2 can be detected. 4.The SNP site according to claim 1 or the primer combination according to claim 2 is applied to prepare a salt-tolerant soybean identification kit. 5.The SNP site according to claim 1 or the primer combination according to claim 2 is applied to screen salt-tolerant soybean varieties. 6.The SNP site according to claim 1 or the primer combination according to claim 2 is applied to breed soybean varieties with Q amino acid residue type (C nucleotide type). 7.A method for identifying the salt-tolerance of soybean, comprising the following steps: The specific steps of the method are as follows: Step 1: extracting the DNA of the soybean to be detected; Step 2: performing PCR reaction using the primer combination according to claim 2 to detect the genotype of the soybean to be detected; 8. The method for identifying salt-alkali tolerance of soybean according to claim 7, characterized in that: The PCR reaction conditions in step 2 are as follows: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 56℃ annealing for 5s, 72℃ extension for 15s, a total of 35 cycles; and 72℃ final extension for 5min; The PCR amplification system is as follows: 2×Rapid Taq Master Mix 7.5μL, F 0.5μL, R 0.5μL, DNA template 1μL and ddH2O 7.5μL.

Images