Molecular marker primer group for identifying macadimia nut variety JW, kit and application
DNA amplification and sequencing analysis of the macadamia nut variety JW using molecular marker primer sets and kits solved the problem of inaccurate variety identification, achieving efficient and accurate variety differentiation and supporting the healthy development of the macadamia nut industry.
Patent Information
- Application Number
- CN202511309735.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-15
- Publication Date
- 2025-11-07
AI Technical Summary
The identification of the macadamia nut variety JW in the existing technology is inaccurate, which restricts the development of the industry. In addition, there are cases of different species with the same name and different names for the same species, which affects the breeding of varieties and the protection of intellectual property rights.
This invention provides a molecular marker primer set and kit that amplifies the DNA of the sample to be tested, and uses next-generation high-throughput sequencing and alignment technology, combined with software analysis, to achieve accurate identification of macadamia nut variety JW and 29 other cultivars.
It enables accurate identification of the macadamia nut variety JW, with high distinguishing ability and is unaffected by environmental and human factors, thus improving identification efficiency and accuracy.
Smart Images

Figure CN120905435A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present disclosure relates to the field of molecular biology and genetic breeding, in particular to a molecular marker primer set for identifying Macadamia spp. variety JW, a kit and application thereof. BACKGROUND
[0002] Macadamia spp. is native to Australia and is recognized worldwide as a high-end edible nut and woody oil plant, earning the reputation of "King of Nuts". The kernel of Macadamia spp. is rich in nutrients, with a high fat content mainly composed of unsaturated fatty acids, which is beneficial to cardiovascular health. The market demand for Macadamia spp. is strong, but the global annual production is far lower than the market demand, resulting in a huge gap between supply and demand. Therefore, the development prospect of Macadamia spp. industry is very broad.
[0003] In recent years, China has become a major production area and important consumption market for Macadamia spp. globally, but the main varieties currently planted mainly rely on introduction from abroad. The poor climate adaptability of some introduced varieties leads to low yield, with unit area yield only 1 / 3-1 / 2 of that in the original habitat, seriously restricting the industrial benefits. At the same time, with the changes in international trade environment and the strengthening of protection of plant variety rights in the original habitat, the introduction of foreign Macadamia spp. varieties in China is limited, and new varieties with independent intellectual property rights and adapted to local environment are urgently needed.
[0004] Plant variety identification can be based on morphological characteristics, physiological and ecological characteristics, biochemical markers and molecular markers. Morphological characteristic identification is intuitive and simple, but it is easily affected by environment and human factors, has a long cycle and is seasonal to some extent. Molecular marker identification has significant advantages, is not affected by season and development stage, has rich polymorphism and strong specificity, is fast, efficient and high-precision, and has been applied to DUS testing and substantial derivative variety identification of various plants. At present, there are phenomena of "same name different things" and "same thing different names" in Macadamia spp., which hinders variety breeding, intellectual property protection and industry promotion. Impure or incorrect seedling varieties also damage the economic interests of practitioners and seriously affect the healthy development of Macadamia spp. industry.
[0005] JW is a new variety selected from the introduced Macadamia spp. population in Australia, which was identified by Guangxi Forestry and Grassland Bureau on March 29, 2023, with the identification number: GuiR-SC-MT-008-2022. The variety-related information can be found in Acta Horticulturae, 2023, 50(S2): 29-30. Accurate identification of Macadamia spp. variety JW is crucial for its popularization and application.
[0006] DISCLOSURE
[0007] In order to solve the problem of inaccurate identification of Macadamia spp. variety JW, the present disclosure provides a molecular marker primer set for identifying Macadamia spp. variety JW, a kit and application thereof. The technical solution is as follows:
[0008] In one aspect, the present disclosure provides a molecular marker primer set for identifying Macadamia integrifolia cultivar JW, which consists of four pairs of primers, each pair of primers consisting of an upstream primer and a downstream primer. The upstream primer of the first pair of primers is shown as SEQ ID NO: 1 in the sequence listing, the downstream primer of the first pair of primers is shown as SEQ ID NO: 2 in the sequence listing, the upstream primer of the second pair of primers is shown as SEQ ID NO: 3 in the sequence listing, the downstream primer of the second pair of primers is shown as SEQ ID NO: 4 in the sequence listing, the upstream primer of the third pair of primers is shown as SEQ ID NO: 5 in the sequence listing, the downstream primer of the third pair of primers is shown as SEQ ID NO: 6 in the sequence listing, the upstream primer of the fourth pair of primers is shown as SEQ ID NO: 7 in the sequence listing, and the downstream primer of the fourth pair of primers is shown as SEQ ID NO: 8 in the sequence listing.
[0009] In another aspect, the present disclosure provides a kit for identifying Macadamia integrifolia cultivar JW, which comprises the above-mentioned molecular marker primer set.
[0010] In yet another aspect, the present disclosure provides an application of a molecular marker primer set for identifying Macadamia integrifolia cultivar JW, characterized in that the application comprises: amplifying a sample to be tested using the molecular marker primer set according to claim 1 to obtain an amplification product;
[0011] sequencing the amplification product by next-generation high-throughput sequencing to obtain sequencing data;
[0012] aligning the sequencing data to a Macadamia integrifolia reference genome to obtain sequencing results of the sample to be tested shown as SEQ ID NO: 9 in the sequence listing to SEQ ID NO: 55 in the sequence listing;
[0013] analyzing the sequencing results to obtain different sequence types;
[0014] when the sequence type is shown as SEQ ID NO: 20 in the sequence listing, SEQ ID NO: 22 in the sequence listing, SEQ ID NO: 24 in the sequence listing, SEQ ID NO: 25 in the sequence listing, SEQ ID NO: 34 in the sequence listing, SEQ ID NO: 40 in the sequence listing, SEQ ID NO: 45 in the sequence listing, and SEQ ID NO: 55 in the sequence listing, then the sample to be tested is identified as Macadamia integrifolia cultivar JW.
[0015] The application also includes: the molecular marker primer set distinguishes Macadamia cultivars 294, 344, 508, 660, 695, 762, 788, 791, 792, 800, 842, 863, 900, 951, A16, A4, D, D4, H2, O.C, O.V, Guang 11, Guire No. 1, Nanya 116, Nanya No. 1, Nanya No. 2, Nanya No. 3, Yunyan No. 10 and Yunyan No. 4.
[0016] The technical scheme provided by the embodiments of the present disclosure has the beneficial effects that: the embodiments of the present disclosure provide a molecular marker primer set for identifying Macadamia cultivar JW, a kit and an application. The molecular marker primer set is used to amplify the to-be-tested sample, the obtained amplification product is sequenced, and the cultivars are distinguished according to the sequencing results. There are multiple base differences between the sequences of different cultivars, including substitution, insertion, deletion and repetition, and the differences are used to accurately identify Macadamia cultivar JW. At the same time, the differences can be used to effectively distinguish JW and other 29 Macadamia cultivars 294, 344, 508, 660, 695, 762, 788, 791, 792, 800, 842, 863, 900, 951, A16, A4, D, D4, H2, O.C, O.V, Guang 11, Guire No. 1, Nanya 116, Nanya No. 1, Nanya No. 2, Nanya No. 3, Yunyan No. 10 and Yunyan No. 4. BRIEF DESCRIPTION OF DRAWINGS
[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the drawings needed in the embodiment description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present disclosure, and other drawings can be obtained by those skilled in the art without creative labor.
[0018] Figure 1 is a sequence alignment map of the first pair of primers provided in Embodiment Three of the present disclosure.
[0019] Figure 2 is a sequence alignment map of the second pair of primers provided in Embodiment Three of the present disclosure.
[0020] Figure 3 is a sequence alignment map of the third pair of primers provided in Embodiment Three of the present disclosure.
[0021] Figure 4 is a sequence alignment map of the fourth pair of primers provided in Embodiment Three of the present disclosure. DETAILED DESCRIPTION
[0022] In order to make the purpose, technical scheme and advantages of the present disclosure more clear, the embodiments of the present disclosure will be further described in detail.
[0023] Example 1
[0024] This embodiment provides a molecular marker primer set for identifying the macadamia nut variety JW. The molecular marker primer set consists of four pairs of primers, each pair consisting of an upstream primer and a downstream primer. The upstream primer of the first primer pair is shown in SEQ ID NO:1 of the sequence listing, specifically: GCAAA ATATTTCCCTTCAAGTGGCT; the downstream primer of the first primer pair is shown in SEQ ID NO:2 of the sequence listing, specifically: GATGAACT AGAGGTGATGCAAGTTG; the upstream primer of the second primer pair is shown in SEQ ID NO:3 of the sequence listing, specifically: CACTGGGGAAGGG ATATGTGATATT; the downstream primer of the second primer pair is shown in SEQ ID NO:4 of the sequence listing, specifically: TTATCTAAAGCAACAGA TCGACCCA; the upstream primer of the third primer pair is shown in SEQ ID NO:5 of the sequence listing, specifically: TGGTTTTTAGTAACTATGTG GGGGT; the downstream primer of the third primer pair is shown in SEQ ID NO:6 of the sequence listing, specifically: AACACTTGTTTCTTCCATATTTT GGAC; the upstream primer of the fourth primer pair is shown in SEQ ID NO:7 of the sequence listing, specifically: TCGGGTTCTTCACAGTAAAGAAG The downstream primers for the fourth primer pair are shown in SEQ ID NO:8 in the sequence listing, specifically: TGGCTTTTCAAGTCAAGTGTCAAAA. Information regarding the four primer pairs is shown in Table 1.
[0025] Table 1 shows the relevant information for the four pairs of primers.
[0026]
[0027] Example 2
[0028] This disclosure provides a kit for identifying the macadamia nut variety JW, which includes the molecular marker primer set provided in Example 1.
[0029] Example 3
[0030] This disclosure provides an application of a molecular marker primer set for identifying the macadamia nut variety JW, the application of which includes: using the molecular marker primer set provided in Example 1 to identify the macadamia nut variety JW.
[0031] Further, the application further comprises: using the molecular marker primer set provided in Embodiment One to effectively distinguish 29 macadamia cultivars 294, 344, 508, 660, 695, 762, 788, 791, 792, 800, 842, 863, 900, 951, A16, A4, D, D4, H2, O.C, O.V, Guang 11, Guire No. 1, Nanya 116, Nanya No. 1, Nanya No. 2, Nanya No. 3, Yunyan No. 10 and Yunyan No. 4.
[0032] Specifically, 30 macadamia cultivars are used as test samples, and the cultivar names are shown in Table 2. The 30 test samples are all from the Jinghong Macadamia Germplasm Resource Orchard of the agricultural department, which has perfect germplasm preservation conditions and standardized management measures, and all the macadamia cultivars involved in the present embodiment are planted and preserved in the orchard.
[0033] Table 2 shows the cultivar names of the 30 test samples
[0034]
[0035]
[0036] DNA of the above-mentioned 30 test samples is extracted. In practice, a new plant genomic DNA extraction kit produced by Tiangen Biosciences (Beijing) Co., Ltd. is used to extract the DNA of the test samples. The specific operation is performed according to the instructions of the new plant genomic DNA extraction kit.
[0037] The DNA of the 30 test samples is amplified using the molecular marker primer set provided in Embodiment One. Specifically, the amplification system comprises: 50 ng of DNA of the test sample, 0.5 μL of 10 mM dNTP (deoxy-ribonucleoside triphosphate), 0.5 μL of each upstream primer, 0.5 μL of each downstream primer, 2.5 μL of Tap Buffer buffer, 0.2 μL of Taq enzyme, and ddH2O is added to make up the amplification system to 20 μL. The amplification program comprises: 95℃ for 3 min; (95℃ for 30 sec, 60℃ for 30 sec) x 30 cycles; 72℃ for 6 min.
[0038] After amplification, the amplification product is obtained, and the amplification product is subjected to second-generation high-throughput sequencing to obtain sequencing data. The sequencing data is aligned to the macadamia reference genome (version number GWHBAUK00000000.1) using Bowtie2 software to obtain the sequencing results of each test sample.
[0039] Based on the upstream and downstream primer sequences of the molecular marker primer pairs, e-PCR was performed using TBtools software to verify that all four primer pairs were for specific amplification. Based on the upstream and downstream primer sequences of the molecular marker primer pairs and the relevant information in Table 1, the target sequences of the four primer pairs on the reference genome were extracted using TBtools software and represented by the numbers 01, 02, 03 and 04, respectively.
[0040] The sequencing results were analyzed using Microsoft Office Excel software. The first primer pair contained 14 different sequence types. These 14 different sequence types were named a1, b1, c1, d1, e1, f1, g1, h1, i1, j1, k1, l1, m1, and n1, as shown in SEQ ID NO:9 to SEQ ID NO:22 in the sequence listing.
[0041] Sequence alignment was performed using the software DNAMAN. The sequence alignment results are as follows: Figure 1 As shown, in Figure 1 In the sequence, the number 01 represents the target sequence of the first pair of primers on the reference genome, specifically: GCAAAATATTTCCCTTCAAGTGGCTTCCTTGAGGCACAACCTACTACTCGATG TTCTTGGAGCTGGAAGAGTATTCTACATGGTAGAGATCTATTGCTCAAGGTTCTACGTTGCAGAATTGGCGA CGACCGTACCACAAATATCATCTAGGATCCCTAGGTCCCCTTCCTTCCCAATGGAAAAATTACTAGCTCTTCG AGACAACTTGCATCACCTCTAGTTCATC (as shown in SEQ ID NO:13 in the sequence listing), where sequence e1 is the same as the target sequence 01 on the reference genome, and the remaining sequences are different.
[0042] The second primer pair contains 10 different sequence types, which are named a2, b2, c2, d2, e2, f2, g2, h2, i2, and j2, as shown in SEQ ID NO:23 to SEQ ID NO:32 in the sequence listing.
[0043] Sequence alignment was performed using the software DNAMAN. The sequence alignment results are as follows: Figure 2As shown, the number 02 represents the target sequence of the second pair of primers on the reference genome, specifically: CACTGGGGAAGGGATATGTGATATTCCAATTCCAATGTGAGGGAGACAAAGCAGTGGTTT GGAGGAGAAGCCCTTTAAGGATCGGTGAGCAGTAGATTCGATTCCAGCATTGGAAATCGGATTCCAACATT CATGAGAAACAGTCTCTTACAAAGCTGGTTTGGATTCTTCTGCCGGACCTCCCTGTGGAGTATTGGCATGAA AACATGCTTTTATCCATTGCTAAGGCTATGGGTCGATCTGTTGCTTTAGATAA (as shown in SEQ ID NO: 31 in the Sequence Listing), wherein the sequence i2 is the same as the target sequence 02 on the reference genome, and the rest of the sequences are different.
[0044] The third pair of primers has 11 different sequence types, which are named a3, b3, c3, d3, e3, f3, g3, h3, i3, j3 and k3 respectively, as shown in SEQ ID NO: 33-SEQ ID NO: 43 in the Sequence Listing.
[0045] The sequence alignment is performed by using the software DNAMAN, and the sequence alignment result is shown in Figure 3 As shown, the number 03 represents the target sequence of the third pair of primers on the reference genome, specifically: TGGTTTTTAGTAACTATGTGGGGGTAGGAAACACAGCCTTCAAGAGTACCATGTTCAATA AATTTTCCAATGGATTTATATGTTTCATTAATAGAAAGTTTTGGACGTAGTGAGAAATAGGCTCGGGTTGTTT TTCGTTCAAGAATTCTTGTTTAGGCAGTGTATACCGTCCATGCATAGTGTTTTGATCTAAGATTTCAATTCTTC CATGTTTCGGTAGTAGCATATTGTTTGATGGAGCAAAGGTCCAAAATATGGAAGAAACAAGTGTT (as shown in SEQ ID NO: 38 in the Sequence Listing), wherein the sequence f3 is the same as the target sequence 03 on the reference genome, and the rest of the sequences are different.
[0046] The fourth primer pair has 12 different sequence types, which are named a4, b4, c4, d4, e4, f4, g4, h4, i4, j4, k4 and l4, as shown in SEQ ID NO:44 to SEQ ID NO:55 in the sequence listing.
[0047] Sequence alignment was performed using the software DNAMAN. The sequence alignment results are as follows: Figure 4 As shown, number 04 represents the target sequence of the fourth pair of primers on the reference genome, specifically: TCGGGTTCTTCACAGTAAAGAAGATTGTTACCAGGTTGAATTTTGATTTGAAAAGAAACC ACCCAAACCTAGAATTAGAGAAAAGTAGTTTACTTCGGTTATTGATGCAATATTCCCGGATTTGTGTTTTAGA TGTGAATCAGCCCAAGGGACTGTACTCTCTACCTGCTCTCACCAGCTGGAGTTTCCCAAACCCTAACTACC CTCTCTAACCGTTACTTAATACTTTTGACACTTGACTTGAAAAGCCA (as shown in SEQ ID NO:44 in the sequence listing), where sequence a4 is the same as the target sequence 04 on the reference genome, and the remaining sequences are different.
[0048] The specific genotypes of the 30 samples to be tested are shown in Table 3. To improve the efficiency of variety identification, identical genotypes of the same primer pair are not listed; that is, duplicate values in the same column of genotypes in Table 3 have been removed and are only displayed as blank spaces. The only unique genotype amplified by the same primer pair, i.e., the non-blank unique value in the same column of genotypes in Table 3, is considered as the specific genotype.
[0049] Table 3 lists the specific genotypes of the 30 samples to be tested.
[0050]
[0051]
[0052] As shown in Table 3, each of the 30 samples has at least one specific genotype, indicating that the molecular marker primer set provided in Example 1 of this invention can distinguish the 30 samples to be tested.
[0053] Specifically, sample number 4, which is also variety 660, has one and only one specific genotype, namely e2i2, a specific genotype of the second primer pair. Sample number 20, which is also variety JW, has a specific genotype of b2c2 for the second primer pair. e2i2 is different from b2c2, indicating that the second primer pair can distinguish between variety 660 and JW.
[0054] For example, sample No. 20 is also variety JW, which is different from the specific genotypes of the third pair of primers of sample Nos. 2, 5, 7, 8, 11, 12, 13, 14, 15, 17, 18, 23, 25, 28 and 29, indicating that the third pair of primers can distinguish sample No. 20 which is also variety JW from sample Nos. 2, 5, 7, 8, 11, 12, 13, 14, 15, 17, 18, 23, 25, 28 and 29.
[0055] JW has four specific genotypes, and the specific genotype combination is l1n1+b2c2+b3h3+b4l4, so that the accurate identification of JW can be realized. According to the different specific genotypes and combinations, the other 29 macadamia nut varieties 294, 344, 508, 660, 695, 762, 788, 791, 792, 800, 842, 863, 900, 951, A16, A4, D, D4, H2, O.C, O.V, Guang 11, Guire No. 1, Nanya 116, Nanya No. 1, Nanya No. 2, Nanya No. 3, Yunyan No. 10 and Yunyan No. 4 can be effectively distinguished.
[0056] Accuracy analysis of molecular marker primer set identification
[0057] Two reproducible experiments are used for accuracy analysis, and in this embodiment, two independent experiments are carried out by different personnel, different batches of reagents and different laboratories, so as to simulate the identification of different batches of macadamia nuts, and a high reproducibility rate means that the identification results of different laboratories can be accurately compared with each other.
[0058] The 30 samples to be tested for reproducible experiments are: 294, 344, 508, 660, 695, 762, 788, 791, 792, 800, 842, 863, 900, 951, A16, D, D4, H2, JW, O.C, O.V, S, Guang 11, Guire No. 1, Nanya 116, Nanya No. 1, Nanya No. 2, Nanya No. 3, Yunyan No. 10, Yunyan No. 4 and Yunyan No. 9. The specific genotypes and combinations of each result are recorded, and the specific results are shown in Table 4.
[0059] Table 4 is the results of two repeated experiments
[0060]
[0061]
[0062] As shown in Table 4, the specific genotypes and combinations of the two repeated experiments are the same. Therefore, the accuracy rate of the molecular marker primer set provided by the present application is 100%.
[0063] The variety identification conclusion of the embodiment three of the present application has high consistency between different laboratories or different batches in the same laboratory, so that parallel experiments do not have to be used to reduce experimental errors, which provides great convenience for macadamia variety identification.
[0064] The present application provides a molecular marker primer group for identifying macadamia variety JW, a kit and application thereof. The molecular marker primer group is used for amplifying a to-be-tested sample, the amplification product is sequenced, and the variety is distinguished according to the sequencing result. There are multiple base differences between sequences of different varieties, including substitution, insertion, deletion and repetition, and the differences are used for accurate identification of the macadamia variety JW. Meanwhile, the differences are used for effective differentiation of JW and other 29 macadamia cultivated varieties 294, 344, 508, 660, 695, 762, 788, 791, 792, 800, 842, 863, 900, 951, A16, A4, D, D4, H2, O.C, O.V, Guang 11, Guire No. 1, Nanya 116, Nanya No. 1, Nanya No. 2, Nanya No. 3, Yunyan No. 10 and Yunyan No. 4, and the identification result is not affected by environment and other human factors.
[0065] The present application amplifies the target sequence by using the high polymorphism molecular marker primer group, and compares the base differences between different varieties, so that efficient macadamia variety identification is realized, and the reproducibility experiment further verifies the accuracy and reliability of the technology.
[0066] The above only describes optional embodiments of the present application, and does not limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. A molecular marker primer set for identifying macadamia cultivar JW, characterized in that, The molecular marker primer set consists of four pairs of primers, each pair consisting of an upstream primer and a downstream primer, the upstream primer of the first pair being as set forth in SEQ ID NO: 1 of the sequence listing, the downstream primer of the first pair being as set forth in SEQ ID NO: 2 of the sequence listing, the upstream primer of the second pair being as set forth in SEQ ID NO: 3 of the sequence listing, the downstream primer of the second pair being as set forth in SEQ ID NO: 4 of the sequence listing, the upstream primer of the third pair being as set forth in SEQ ID NO: 5 of the sequence listing, the downstream primer of the third pair being as set forth in SEQ ID NO: 6 of the sequence listing, the upstream primer of the fourth pair being as set forth in SEQ ID NO: 7 of the sequence listing, and the downstream primer of the fourth pair being as set forth in SEQ ID NO: 8 of the sequence listing.
2. A kit for identifying Macadamia integrifolia cultivar JW, characterised in that, The kit comprises the molecular marker primer set of claim 1.
3. Use of a molecular marker primer set for identifying Macadamia integrifolia cultivar JW, characterized in that, The application comprises: amplifying the sample to be tested using the molecular marker primer set of claim 1 to obtain an amplification product; sequencing the amplification product by second-generation high-throughput sequencing to obtain sequencing data; aligning the sequencing data to the macadamia reference genome to obtain the sequencing result of the sample to be tested; analyzing the sequencing result to obtain different sequence types; when the sequence type is as set forth in SEQ ID NO: 20 of the sequence listing, as set forth in SEQ ID NO: 22 of the sequence listing, as set forth in SEQ ID NO: 24 of the sequence listing, as set forth in SEQ ID NO: 25 of the sequence listing, as set forth in SEQ ID NO: 34 of the sequence listing, as set forth in SEQ ID NO: 40 of the sequence listing, as set forth in SEQ ID NO: 45 of the sequence listing, and as set forth in SEQ ID NO: 55 of the sequence listing, then the sample to be tested is identified as macadamia cultivar JW.
4. Use according to claim 3, characterized in that, The application further comprises: using the molecular marker primer set to distinguish between macadamia cultivars 294, 344, 508, 660, 695, 762, 788, 791, 792, 800, 842, 863, 900, 951, A16, A4, D, D4, H2, O.C, O.V, Guang 11, Guire No. 1, Nanya 116, Nanya No. 1, Nanya No. 2, Nanya No. 3, Yunyan No. 10, and Yunyan No. 4.