KASP molecular marker related to drought resistance of sorghum, primer and application of KASP molecular marker

Abstract

The invention belongs to the technical field of sorghum molecular breeding, and particularly relates to a KASP molecular marker related to sorghum drought resistance, a primer and application, and the base sequence of the KASP molecular marker is as shown in SEQ ID NO.1. And the single nucleotide polymorphism of T / C exists at the 150th basic group of the sequence. The KASP molecular marker provided by the invention can be used for molecular identification of drought-enduring traits of sorghum. Carrying out fluorescence signal reading through a KASP genetic typing detection system, and if the FAM fluorescence signal of the sample is stronger, determining that the corresponding genotype is C / C, and determining that the germplasm is a drought-tolerant germplasm; if the HEX fluorescence signal is strong, the corresponding genotype is G / G, and the germplasm is determined to be a drought sensitive germplasm.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of sorghum molecular breeding, and particularly relates to a KASP molecular marker related to drought resistance of sorghum, a primer and application thereof. BACKGROUND

[0002] Sorghum (Sorghum bicolor (L.) Moench) is a typical C4 plant with high photosynthetic efficiency, water use efficiency and stress adaptation ability, and is an important food, feed and energy crop in the arid and semiarid regions of China. Sorghum bicolor Drought stress has become one of the primary abiotic factors limiting the yield and quality of sorghum worldwide, especially in the Loess Plateau and the inland of Northwest China and some countries in Africa, where frequent drought weather seriously threatens the safe production of crops.

[0003] The response of plants to drought is a complex process of coordinated regulation of multiple genes and multiple pathways, involving mechanisms such as osmoregulation, stomatal regulation, root architecture change and activation of antioxidant systems. Although traditional breeding has obtained a batch of drought-tolerant varieties through field screening, due to the strong uncertainty of drought occurrence, the large environmental difference, the low efficiency and poor stability of phenotypic evaluation, it is urgent to use molecular marker-assisted breeding technology to realize early, accurate and high-throughput identification and screening of drought tolerance traits.

[0004] In recent years, with the continuous deepening of sorghum whole genome sequencing and population genetic analysis, single nucleotide polymorphism (SNP) as the most abundant and stable genetic marker resource has been widely used in QTL positioning and functional gene mining of stress tolerance traits. KASP molecular markers developed based on SNP have great application potential in crop stress tolerance breeding due to their high-throughput, low-cost and easy-to-operate characteristics. KASP technology can quickly and efficiently genotype target SNP sites through specific primer recognition of different alleles combined with a fluorescence detection system. Compared with traditional markers such as SSR and InDel, KASP technology is simple to operate, highly sensitive and reproducible, and can be widely used in genotyping of large-scale populations and screening of core germplasm, significantly improving breeding efficiency and shortening breeding cycle. Therefore, developing a functional KASP marker closely related to drought tolerance traits of sorghum can provide a key tool for molecular assisted selection of drought-tolerant germplasm, improve the adaptability and yield level of sorghum in drought areas, and promote the sustainable development of dryland agriculture. SUMMARY

[0005] The purpose of the present application is to provide a KASP molecular marker related to drought resistance of sorghum, which can be used for early, efficient and low-cost assisted identification and screening of drought tolerance traits of sorghum, and significantly improve breeding efficiency.

[0006] The technical solution adopted by the present application is: The KASP molecular marker related to drought resistance of sorghum provided by the application has a base sequence as shown in SEQ ID NO. 1.

[0007] The second aspect of the application provides a primer set for amplifying the KASP molecular marker, which comprises a forward primer F1, a forward primer F2 and a universal reverse primer R. The sequence of the forward primer F1 is shown in SEQ ID NO. 3. The sequence of the forward primer F2 is shown in SEQ ID NO. 4. Preferably, the 5' end of the forward primer F1 is connected with 6-carboxyfluorescein. The 5' end of the forward primer F2 is connected with 6-carboxy-2', 4', 5', 7'-tetrachlorofluorescein.

[0008] The third aspect of the application provides a KASP molecular marker detection kit, which comprises the primer set.

[0009] The fourth aspect of the application provides a method for identifying drought-tolerant varieties of sorghum, which comprises the following steps: (1) extracting genomic DNA of the sorghum to be tested; (2) using the primer set and / or the KASP molecular marker detection kit to perform PCR amplification on the genomic DNA of the sorghum as a template, and obtaining an amplification product; (3) detecting the fluorescence signal of the amplification product, when the fluorescence signal is 6-carboxyfluorescein, the sorghum to be tested is a drought-tolerant variety; when the fluorescence signal is 6-carboxy-2', 4', 5', 7'-tetrachlorofluorescein, the sorghum to be tested is a drought-sensitive variety.

[0010] Preferably, the reaction system for PCR amplification is as follows: 2xKASP Master Mix 10μL, 50ng / μL of genomic DNA 5μL, 10μM forward primer F1 0.2μL, 10μM forward primer F2 0.2μL, 10μM universal reverse primer 0.6μL, ddH2O to 20μL.

[0011] Preferably, the reaction procedure for PCR amplification is as follows: Pre-denaturation 95℃ 10min, 1 cycle; Denaturation 95℃ 15s, annealing and extension 62℃ 1min, 10 cycles; Denaturation 95℃ 15s, annealing and extension 57℃ 1min, 32 cycles.

[0012] Preferably, the genomic DNA of the sorghum to be tested is derived from the leaf of the sorghum.

[0013] The fifth aspect of the present application provides an application of the KASP molecular marker, the primer set or the KASP molecular marker detection kit, which is used in the screening and / or molecular identification of drought-resistant varieties of sorghum.

[0014] Compared with the prior art, the present application has the following beneficial effects: The present application provides a KASP molecular marker related to drought resistance of sorghum, and the base sequence of the KASP molecular marker is shown as SEQ ID NO. 1. The molecular marker of the present application is closely related to the drought resistance of sorghum. In practical application, only the leaf DNA of the drought-resistant germplasm is subjected to PCR amplification by using the KASP primer set developed by the present application, and the fluorescence signal is detected, so that the early assisted prediction and molecular identification of the drought resistance phenotype of sorghum can be realized. The method is simple in operation, economical and practical, high in screening efficiency, and can quickly identify potential high-quality drought-resistant single plants or a large number of offspring, thereby effectively shortening the breeding cycle of sorghum and improving the efficiency and accuracy of drought-resistant breeding.

[0015] In addition, compared with traditional molecular marker technologies such as SSR and InDel, the KASP molecular marker method provided by the present application only needs to be subjected to PCR amplification and fluorescence typing, without subsequent sequencing, silver staining or reading band and other complex steps, and has the significant advantages of simple operation, rapid detection and low cost, and is especially suitable for high-throughput breeding screening and large-scale identification of field materials. BRIEF DESCRIPTION OF DRAWINGS

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and those skilled in the art can also obtain other drawings according to these drawings without creative labor.

[0017] Figure 1 Phenotype of parents LNR-6 and 2381 under drought conditions, a is the single plant phenotype of LNR-6; b is the field phenotype of LNR-6; c is the single plant phenotype of 2381; d is the field phenotype of 2381.

[0018] Figure 2 QTL mapping diagram of F6 population of LNR-6 / 2381.

[0019] Figure 3KASP genotyping map of F6 population of LNR-6 / 2381 a is the genotyping map of KASP molecular marker DR1.1 in 48 single sorghum plants; b is the comparison of DI values of single plants of different genotypes under drought treatment. DETAILED DESCRIPTION

[0020] The application will be further described in the following specific examples without limiting the scope of the application. Details and forms of the technical solutions of the application can be modified or replaced without departing from the spirit and scope of the application, and these modifications or replacements all fall within the protection scope of the application.

[0021] In order to enable those skilled in the art to better understand the technical solutions of the application and implement the same, the application will be further described in conjunction with specific examples. In the description of the application, if not specifically stated, the reagents used are commercially available, and the methods used are conventional techniques in the art.

[0022] The abbreviation table of the application is shown in Table 1.

[0023] Table 1: Abbreviation table of the application Example 1 A KASP molecular marker related to drought resistance of sorghum, a primer and an application thereof are as follows: 1. Evaluation method of drought resistance of sorghum.

[0024] The application evaluates the drought resistance of sorghum through field tests, and the tests are carried out in a film greenhouse to effectively isolate the consistency interference of natural precipitation on water treatment. Two treatment conditions of normal irrigation and drought stress are set, and yield difference is used as the main evaluation index. The test uses a drip irrigation mode for water management.

[0025] The normal irrigation treatment starts the first drip irrigation on May 10, and then drip irrigation is carried out every 10 days, and the irrigation amount of each time is 900m 3 / hm 2 , and the cumulative irrigation amount in the whole growth period is 4500m 3 / hm 2 . The drought stress treatment does not carry out regular irrigation in the whole growth period, and after the field soil water content is reduced to below 30%, the water stress state is maintained for 14 days, and then rewatering is carried out. The cumulative irrigation amount of the treatment in the whole growth period is 3780m 3 / hm 2 After the crops are mature and harvested, the yield data of each variety under the two water treatment conditions are counted respectively, and the drought resistance is evaluated in combination with the drought resistance index proposed by Lajusheng. The calculation formula is as follows:

[0026] .

[0027] wherein: DI i Yi represents the drought resistance index of the i th material; Y di Yi represents the yield of the i th material under drought stress conditions; Y ci Yi represents the yield of the i th material under normal irrigation conditions; Yi represents the average yield of all test materials under drought treatment.

[0028] The method comprehensively considers the absolute yield performance of the material under drought stress and its stability under control conditions, and can objectively reflect the drought tolerance level of the material, and is suitable for high-throughput drought resistance identification and screening of excellent drought-tolerant germplasm.

[0029] 2. Positioning of QTL and determination of molecular markers.

[0030] 2.1, Construction of population.

[0031] Based on the above evaluation criteria of sorghum drought resistance, drought-resistant germplasm LNR-6 and drought-sensitive germplasm 2381 were screened from existing resources, as shown in Figure 1 At the same time, starting from 2021, through emasculation hybridization, the RIL population of the two was constructed, and Table 2 shows the process of obtaining the family.

[0032] Table 2 Process of obtaining family 2.2, Field test and phenotype statistics.

[0033] The F6 population was planted in Shenyang experimental base in May 2024, and the specific planting method referred to the aforementioned planting method, and the phenotype identification method referred to the aforementioned evaluation method of sorghum drought resistance.

[0034] 2.3, Positioning of QTL.

[0035] Based on the above evaluation system of sorghum drought resistance, the present application screens 30 plants with strong drought resistance and 30 plants with weak drought resistance, constructs a drought-tolerant pool and a non-drought-tolerant pool respectively, and carries out whole genome resequencing analysis combined with the parent materials. Sequencing uses the Illumina platform, and after strict quality control, a total of 68.08 Gb of high-quality Clean data is obtained. The sequencing data is aligned to the sorghum reference genome BTx623-T2T Genome v1.0 using Burrows-Wheeler Aligner, and the results show that the sequencing depth of the parents is about 10x, the average coverage depth of the pool samples is about 30x, and the 1x genome coverage in the samples is more than 90%, as shown in Table 3.

[0036] Subsequent variation detection was performed using the Genome Analysis Toolkit, and SNP screening was performed based on the following parameters: QD < 2.0, MQ < 40.0, FS > 60.0, SOR > 3.0, MQRankSum < -12.5, and ReadPosRankSum < -8.0. A total of 2116830 single nucleotide polymorphism sites and 206941 insertion-deletion variations were finally identified.

[0037] By calculating the SNP-index and InDel-index of the offspring pool between the parents, Δ(SNP-index) and Δ(InDel-index) distribution maps were further constructed, and the Gprime analysis function was used to detect significant regions based on the non-parametric weighted G' statistics. The results showed that the key QTL region controlling drought resistance of sorghum was located in the 64.56Mb~67.25Mb segment of chromosome 5, and was named Drought Resisting1 , and was named DR1 , see Figure 2 .

[0038] Table 3 QTL mapping 2.4, Development of markers.

[0039] According to the physical positioning information of the DR1 site, the VCF variation data of the corresponding region of chromosome 5 Chr05:66157724 was extracted, and it was found that the site had SNP differences between the parent materials and had clear allelic distinction characteristics, which was suitable for molecular marker development. Based on this variation site, a KASP marker was designed, named DR1.1.

[0040] The nucleotide sequence corresponding to the marker DR1.1 is shown as SEQ ID NO. 1 and SEQ ID NO. 2, wherein the 150bp bold in SEQ ID NO. 1 and SEQ ID NO. 2 is a C / G base polymorphism site. The sequence is as follows:

[0041] SEQ ID NO. 1: CCCTTGCACCCATAGTAGAAGGCGGTCAACGCACAGTCTTGGAACAACTCCACGGCGGCCATCTGGACGGCGTACAAGACTCCCAGGAGCAGAGCCCCCGACGCCATGTCGCTACGGGCGCATATCTTGGCCTGCCAGTAAATCGGCCTCAATATGGCGGCGAGCACGCTCATCACGGAAACAAAGAGCATGGCACGCCTCCGCCTGCCCTTCACCAGCTGCCACGCCCGCCTGACTGCTGCACCAGCGCCATGGCGGTGCCTAGCTGCAGCTGCAGATTCATCCAGGGCCACGATGACG.

[0042] SEQ ID NO. 2: CCCTTGCACCCATAGTAGAAGGCGGTCAACGCACAGTCTTGGAACAACTCCACGGCGGCCATCTGGACGGCGTACAAGACTCCCAGGAGCAGAGCCCCCGACGCCATGTCGCTACGGGCGCATATCTTGGCCTGCCAGTAAATCGGCCTGAATATGGCGGCGAGCACGCTCATCACGGAAACAAAGAGCATGGCACGCCTCCGCCTGCCCTTCACCAGCTGCCACGCCCGCCTGACTGCTGCACCAGCGCCATGGCGGTGCCTAGCTGCAGCTGCAGATTCATCCAGGGCCACGATGACG.

[0043] Wherein, when the genotype is CC, the sorghum is a drought-resistant variety; when the genotype is GG, the sorghum is a drought-sensitive variety.

[0044] 3. Design of the molecular marker primer set.

[0045] The molecular marker primer set is composed of forward primer F1, forward primer F2 and universal reverse primer R. The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO. 3; the nucleotide sequence of the forward primer F2 is shown in SEQ ID NO. 4; and the nucleotide sequence of the universal reverse primer R is shown in SEQ ID NO. 5. The detailed sequences are shown in Table 4 below.

[0046] Table 4 Design of the molecular marker primer set Note: In Table 3, the lowercase parts are the connector sequences FAM and HEX.

[0047] 4. Correlation analysis between KASP fluorescent gene typing and drought resistance phenotype in sorghum.

[0048] 4.1 To verify the association between the developed KASP marker and drought resistance in sorghum, 48 individual plant samples were randomly selected. Leaf samples approximately 1 cm in length and width were collected during the seedling stage and placed in 2 mL 96-well deep-well plates for freeze-drying. Steel balls were then added, and the mixture was thoroughly ground into powder at 50 Hz.

[0049] 4.2 Genomic DNA was extracted from the samples using a modified CTAB method.

[0050] 4.3. Allele-specific PCR amplification was performed using a set of KASP molecular marker primers designed for the DR1.1 site. The PCR reaction system is shown in Table 5, and the PCR procedure is shown in Table 6.

[0051] Table 5 PCR reaction system Table 6 PCR reaction procedure 4.4 The amplified products were read for fluorescence signals by the KASP genotyping detection system. Cluster analysis was performed based on the FAM and HEX fluorescence intensity distributions to determine the genotype. Figure 3 The results showed that 22 of the materials exhibited HEX fluorescence signals, with a genotype of G / G; and 26 materials exhibited FAM fluorescence, with a genotype of C / C.

[0052] Further one-way ANOVA showed that the drought resistance index of the C / C genotype was significantly higher than that of the G / G genotype. Figure 3 The result of b indicates that materials carrying the C allele exhibit stronger drought resistance. Therefore, this KASP marker DR1.1 demonstrates good predictive ability for drought resistance phenotypes in sorghum, showing its potential application in molecular-assisted selection breeding.

[0053] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0054] The above embodiments only express several implementation manners of the present application, and the description is more specific and detailed, but it should not be understood as a limitation on the scope of the patent. It should be noted that for ordinary skilled in the art, without departing from the concept of the present application, several modifications and improvements can be made, which are within the scope of protection of the present application.

Claims

1. A KASP molecular marker associated with drought tolerance in sorghum, characterized in that, The base sequence of the KASP molecular marker is shown as SEQ ID NO.

1.

2. A primer set for amplifying the KASP molecular marker of claim 1, characterized in that, The primer set comprises a forward primer F1, a forward primer F2 and a universal reverse primer R; The sequence of the forward primer F1 is shown as SEQ ID NO.

3. The sequence of the forward primer F2 is shown as SEQ ID NO.

4. The sequence of the universal reverse primer R is shown as SEQ ID NO.

5.

3. The primer set of claim 2, wherein The 5' end of the forward primer F1 is connected with 6-carboxyfluorescein; The 5' end of the forward primer F2 is connected with 6-carboxy-2', 4', 5', 7'-tetrachlorofluorescein.

4. A KASP molecular marker detection test kit characterized in that, The KASP molecular marker detection kit comprises the primer set of claim 2.

5. A method for identification of drought tolerant varieties of sorghum, characterized by, The method comprises the following steps: (1) extracting the genomic DNA of the to-be-tested sorghum; (2) using the primer set of claim 2 and / or the KASP molecular marker detection kit of claim 4 to perform PCR amplification on the genomic DNA of the sorghum as a template, to obtain an amplification product; (3) detecting the fluorescence signal of the amplification product, when the fluorescence signal is 6-carboxyfluorescein, the to-be-tested sorghum is a drought-tolerant variety; when the fluorescence signal is 6-carboxy-2', 4', 5', 7'-tetrachlorofluorescein, the to-be-tested sorghum is a drought-sensitive variety.

6. The method of claim 5, wherein, The reaction system for PCR amplification is as follows: 2xKASP Master Mix 10 μL, 50 ng / μL of genomic DNA 5 μL, 10 μM forward primer F1 0.2 μL, 10 μM forward primer F2 0.2 μL, 10 μM universal reverse primer 0.6 μL, and ddH2O to 20 μL.

7. The method of claim 5, wherein, The reaction program for PCR amplification is as follows: Pre-denaturation 95℃ 10min, 1 cycle; Denaturation 95℃ 15s, annealing and extension 62℃ 1min, 10 cycles; Denaturation 95℃ 15s, annealing and extension 57℃ 1min, 32 cycles.

8. The method of claim 5, wherein, The genomic DNA of the to-be-tested sorghum is derived from the leaves of the sorghum.

9. Use of the KASP molecular marker of claim 1, the primer set of claim 2 or the KASP molecular marker test kit of claim 4, characterized in that, The application refers to the application in the screening and / or molecular identification of drought-tolerant varieties of sorghum.

Images