Chip for nucleic acid detection

By utilizing a specific binding mechanism between inorganic substrates and nucleic acid probes, the sensitivity of nucleic acid detection is improved, solving the problem of insufficient detection sensitivity in existing technologies and supporting accurate determination of plant growth status and optimization of cultivation conditions.

CN120917136APending Publication Date: 2025-11-07NAT UNIV CORP TOKAI NAT HIGHER EDUCATION & RES SYST
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202480021668.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-03-24
Filing Date
2024-03-22
Publication Date
2025-11-07

AI Technical Summary

Technical Problem

Existing technologies are insufficient for highly sensitive detection of nucleic acids, especially miRNA and mRNA, in plant samples.

Method used

The method of combining inorganic substrates with nucleic acid probes improves the detection efficiency of nucleic acid probes by linking amino groups on the inorganic substrate or by linking amino groups with active ester or carboxyl groups via amide bonds.

Benefits of technology

It achieves highly sensitive detection of nucleic acids in plant samples, especially efficient detection of miRNA and mRNA, supporting accurate determination of plant growth status and optimization of cultivation conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

Provided is a chip with which it is possible to detect a nucleic acid in a biological sample (in particular, a plant sample) with higher sensitivity. A chip for nucleic acid detection, which comprises an inorganic substrate and a nucleic acid probe, and wherein: (x) the nucleic acid probe is linked via an amino group linked to the inorganic substrate; and / or (y) the nucleic acid probe is linked to an amide bond of a nucleic acid probe having an active ester group or a carboxyl group via an amino group linked to the inorganic substrate.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a chip for nucleic acid detection or the like. BACKGROUND

[0002] Plants are inhibited in growth due to environmental stress such as deficiency of nutrients, infection of microorganisms, and the like. In addition, plants undergo phenomena important for the harvest of crops such as growth and thickening of stems and trunks, flowering and fruiting, growth of fruits, growth of tubers, roots, and the like during the growth thereof.

[0003] A chip capable of predicting the presence or absence of non-biostress such as environmental stress, biostress such as plant virus infection, occurrence of growth and physiological phenomena of plants such as flowering, and the like, and capable of more simply and efficiently performing the above-described determination, capable of performing the determination using the same while cultivating crops when necessary, and capable of performing the determination on the spot at the cultivation site when necessary is disclosed in Patent Literature 1. According to the technology, for example, nucleic acids such as miRNA, mRNA, and the like in a plant sample can be detected simply.

[0004] PRIOR ART DOCUMENTS PATENT LITERATURE Patent Literature 1: Japanese Patent Application Publication No. 2021-065112 SUMMARY

[0005] PROBLEMS TO BE SOLVED BY THE INVENTION The present application relates to a chip for nucleic acid detection or the like.

[0006] TECHNICAL SOLUTION TO THE PROBLEMS The present inventors have conducted intensive studies in view of the above-described background art and the above-described problems, and as a result, have found that the above-described problems can be solved if a chip for nucleic acid detection having an inorganic substrate and a nucleic acid probe, (x) the nucleic acid probe is linked via an amino group linked to the inorganic substrate, and / or (y) the nucleic acid probe is linked by an amide bond of an amino group linked to the inorganic substrate and a nucleic acid probe having a reactive ester group or a carboxyl group. The present inventors have further conducted studies based on this insight, and thus completed the present application. That is, the present application includes the following modes.

[0007] Item 1. A chip for nucleic acid detection, characterized by: having an inorganic substrate and a nucleic acid probe, (x) the nucleic acid probe is linked via an amino group linked to the inorganic substrate; and / or (y) the nucleic acid probe is linked by an amide bond of an amino group linked to the inorganic substrate and a nucleic acid probe having a reactive ester group or a carboxyl group.

[0008] Item 2. The chip for nucleic acid detection according to item 1, wherein (x1) a group represented by general formula (x1) is bound to the inorganic base material; and / or (y1) a group represented by general formula (y1) is bound to the inorganic base material, [In the formulae: R 1 and R 2 are the same or different and represent an alkyl group, a hydrogen atom, an alkoxy group, a halogen atom, a binding portion to a silane coupling agent, or a binding portion to an inorganic base material. R 3 represents a linking group. R 4A represents an oxygen atom or a single bond. L 1 represents a linking group. Probe represents a nucleic acid probe. * represents a binding portion to an inorganic base material. [In the formulae: L 2 represents a linking group. Probe represents a nucleic acid probe. * represents a binding portion to an inorganic base material. Item 3. The chip for nucleic acid detection according to item 1 or 2, wherein (xy) the nucleic acid probe is linked by an amide bond between an amino group of the inorganic base material and a nucleic acid probe having a reactive ester group or a carboxyl group.

[0009] Item 4. The chip for nucleic acid detection according to item 3, wherein (xy1) a group represented by general formula (xy1) is bound to the inorganic base material, [In the formulae: R 1 and R 2 are the same or different and represent an alkyl group, a hydrogen atom, an alkoxy group, a halogen atom, a binding portion to a silane coupling agent, or a binding portion to an inorganic base material. R 3 represents a linking group. R 4A represents an oxygen atom or a single bond. Probe represents a nucleic acid probe. * represents a binding portion to an inorganic base material. Item 5. The chip for nucleic acid detection according to item 4, wherein R 1 and R 2 are the same or different and represent an alkyl group.

[0010] Item 6. The chip for nucleic acid detection according to any one of items 1 to 5, wherein the nucleic acid probe is an mRNA and / or miRNA detection probe.

[0011] Item 7. The chip for nucleic acid detection according to any one of items 1 to 6, comprising: (A) a sample injection portion, and (C) a flow path connected to the sample injection section A and having a nucleic acid probe immobilization region.

[0012] Item 8. The chip for nucleic acid detection according to any one of items 1 to 7, which is used for detection of plant nucleic acids.

[0013] Item 9. A method for determining the state of a plant, comprising: (a) a step of bringing a plant sample into contact with the chip for nucleic acid detection according to any one of items 1 to 8; (b) a step of detecting a signal on the nucleic acid probe; and (c) a step of determining the state of the plant using the value of the signal as an index.

[0014] Item 10. A method for cultivating a plant, comprising: (a) a step of bringing a plant sample into contact with the chip for nucleic acid detection according to any one of items 1 to 8; (b) a step of detecting a signal on the nucleic acid probe; (c) a step of determining the state of the plant using the value of the signal as an index; and (d) a step of adjusting the cultivation conditions of the plant based on the result of the determination.

[0015] Item 11. A method for producing the chip for nucleic acid detection according to any one of items 1 to 8, comprising: (X) a step of reacting an inorganic substrate with a silane coupling agent; and / or (Y) a step of reacting an amino group linked to the inorganic substrate with a nucleic acid probe having a reactive ester group or a carboxyl group.

[0016] Effects of the Invention According to the present application, there are provided a chip capable of detecting nucleic acids in a biological sample (particularly, a plant sample) with higher sensitivity, a method for using the chip, and a method for producing the chip. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 Reaction scheme at the time of producing the amino-coated glass of Examples 1 and 2.

[0018] Figure 2 Reaction scheme for solidification of DNA probes of Example 3 (conventional method).

[0019] Figure 3 Reaction scheme for solidification of DNA probes of Example 3 (new method).

[0020] Figure 4 XPS measurement results of the glass surface produced in Example 1.

[0021] Figure 5 AFM observation results of the surfaces of the glasses produced in Example 1 and a commercially available glass.

[0022] Figure 6 XPS measurement results of the surfaces of the glasses produced in Example 2.

[0023] Figure 7 Results of detection signals of 1 nM of miR399 in a commercially available amino-coated glass and a self-made amino-coated glass (Example 3).

[0024] Figure 8 Results of comparison of the existing method with the method using NHS ester with respect to the method of solid-phase of DNA (Example 3).

[0025] Figure 9 Results of signal amplification experiment using biotinylated anti-streptavidin antibody using the solid-phase method using self-made amino-coated glass and NHS ester DNA (Example 4).

[0026] Figure 10 Growth state of tomato without stress treatment (Example 5).

[0027] Figure 11 Results of miR399 detection using the device with respect to tomato (Example 5).

[0028] Figure 12 Results of signals detected using the diagnostic device with respect to the sample of tomato after treatment of expression of each miRNA (Example 6).

[0029] Figure 13 Results of investigation of expression amount of target miRNA using qRT-PCR (Example 6). DETAILED DESCRIPTION

[0030] In the present specification, with respect to the expressions of "containing" and "including", the concepts of "containing", "including", "consisting essentially of", and "consisting of" are included.

[0031] 1. Chip for nucleic acid detection The present application relates, in one mode thereof, to a chip for nucleic acid detection having an inorganic substrate and a nucleic acid probe, (x) the nucleic acid probe is linked via an amino group linked to the inorganic substrate; and / or (y) the above-mentioned nucleic acid probe is linked by an amide bond of a nucleic acid probe having an active ester group or a carboxyl group through an amino group linked to the inorganic substrate (in the present specification, sometimes also referred to as "chip of the present application"). Hereinafter, this will be described.

[0032] The inorganic substrate is not particularly limited as long as it can bind the nucleic acid probe and can be used as a chip for nucleic acid detection. As a material for the inorganic substrate, for example, glass, metal, and the like can be exemplified, and from the viewpoint of detection sensitivity and the like, glass is preferable. The shape of the inorganic substrate is not particularly limited, and for example, it can be plate-shaped (inorganic substrate), spherical, or the like.

[0033] The nucleic acid probe is a nucleic acid that can hybridize based on the formation of a complementary base pair with a nucleic acid of a detection target, and is not particularly limited as long as it is such a nucleic acid probe.

[0034] In the present specification, "nucleic acid" includes not only DNA and RNA, but also DNA and RNA in which a known chemical modification is implemented as exemplified below. In order to prevent decomposition due to hydrolytic enzymes such as nucleases, the phosphate residue (phosphoric acid ester) of each nucleotide can be replaced with a chemically modified phosphate residue such as phosphorothioate (PS), methylphosphonate, phosphorodithioate, and the like. In addition, the hydroxyl group at position 2 of the sugar (ribose) of each ribonucleotide can be replaced with -OR (R represents CH3(2'-O-Me), CH2CH2OCH3(2'-O-MOE), CH2CH2NHC(NH)NH2, CH2CONHCH3, CH2CH2CN, and the like). In addition, chemical modification can be implemented on the base moiety (pyrimidine, purine), and for example, introduction of a methyl group, a cationic functional group, or substitution of the carbonyl group at position 2 with a thiocarbonyl group, and the like at position 5 of the pyrimidine base can be exemplified. In addition, a residue obtained by modifying the phosphate moiety, the hydroxyl moiety, for example, with biotin, an amino group, a lower alkylamino group, an acetyl group, and the like can be exemplified, but is not limited thereto. In addition, BNA (LNA) in which the conformation of the sugar moiety is fixed to the N type by cross-linking the 2' oxygen and the 4' carbon of the sugar moiety of the nucleotide, and the like can also be used.

[0035] The nucleic acid of the detection target can be preferably an mRNA, an miRNA, or the like. More specifically, for example, there can be listed a group of molecules in vivo that are directly encoded by a group of environment-responsive genes, a group of genes related to the development and growth of an organ / tissue / cell, a group of stress-responsive genes, and the like, as a growth state indicator, an mRNA of a group of environment-responsive genes, a group of genes related to the growth of an organ / tissue / cell, a miRNA that controls the expression of these mRNAs, and the like, and more specifically, for example, a group of small RNAs such as miR399 (responding to the occurrence of phosphorus deficiency), miR395 (responding to the occurrence of sulfate deficiency), miR172 (occurring at the time of flowering (transition from the vegetative growth phase to the reproductive growth phase)), miR156 (occurring at the time of tuber formation), and the like, a group of mRNAs that migrate long distances within an individual, an mRNA of FT protein (florigen (as a florigen), tuberigen (as a tuberigen), regulation of the growth of dormant buds, and the like), an mRNA of TSF protein (a homolog of FT, having the same properties and functions as FT), an mRNA of Hd3a protein (a homolog of FT of rice), an mRNA of RFT1 protein (a homolog of FT of rice), an mRNA of ZCN8 protein (a homolog of FT of corn), an mRNA of AFT protein (as an anti-florigen to inhibit flowering), an mRNA of HY5 protein, an mRNA of CLAVATA3 / ESR-related (CLE) peptide (responding to an increase in the degree of symbiosis with rhizobium (utilization of nitrogen fixation by rhizobium) in leguminous plants), an mRNA of C-TERMINALLY ENCODED PEPTIDE (CEP) peptide (responding to the occurrence of nitrogen deficiency), an mRNA of CEP DOWNSTREAM (CEPD) protein (responding to the occurrence of nitrogen deficiency), and the like, a group of mRNAs of signal molecules that move throughout the body via the vascular bundle of a plant, i.e., the sieve tube and the conduit, and nucleic acids of viral origin and the like in the viewpoint of pathological diagnosis.

[0036] The nucleic acid probe includes a complementary region that hybridizes based on the formation of complementary base pairs with the nucleic acid of the detection target. The base sequence of the complementary region is complementary to all or a part of the nucleic acid of the detection target. The base length of the complementary base sequence is, for example, 8 base lengths or more, preferably 10 base lengths or more, and, in addition, 100% with respect to the base length of the nucleic acid of the detection target, for example, 5% or more, preferably 10% or more, more preferably 20% or more, further preferably 30% or more, and still further preferably 40% or more.

[0037] In the present specification, "complementary" includes not only a base-completely complementary relationship (completely complementary: for example, A and T or U, and G and C) but also a complementary relationship in the degree of hybridization under stringent conditions. The stringent conditions can be determined based on the melting temperature (Tm) of the nucleic acid as taught by Berger and Kimmel (1987, Guide to Molecular Cloning Techniques Methods in Enzymology, Vol. 152, Academic Press, San Diego CA). For example, as a washing condition after hybridization, a condition of the order of "1 x SSC, 0.1% SDS, 37°C" can be generally cited. It is preferable that the hybridization state be maintained even with such a condition. Although not particularly limited, as a more stringent hybridization condition, a washing condition of the order of "0.5 x SSC, 0.1% SDS, 42°C" can be cited, and as a still more stringent hybridization condition, a washing condition of the order of "0.1 x SSC, 0.1% SDS, 65°C" can be cited. Specifically, the base sequence of the complementary region is a base sequence having, for example, 85% or more identity, preferably 90% or more identity, more preferably 95% or more identity, further preferably 98% or more identity, still further preferably 99% or more identity, particularly preferably 100% identity, with respect to a base sequence completely complementary to all or a part of the nucleic acid of the detection target.

[0038] In the present specification, "identity" of a base sequence refers to the degree of agreement of two or more alignable base sequences with respect to each other. Thus, the higher the degree of agreement of two base sequences, the higher the identity or similarity of the sequences. The level of identity of a base sequence is determined, for example, using FASTA, which is a tool for sequence analysis, using default parameters. Alternatively, it can be determined using the algorithm BLAST of Karlin and Altschul (Karlin S, Altschul SF. "Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes" Proc Natl Acad Sci USA. 87: 2264-2268 (1990), Karlin S, Altschul SF. "Applications and statistics for multiple high-scoring segments in molecular sequences." Proc Natl Acad Sci USA. 90: 5873-7 (1993)). A program called BLASTN based on such a BLAST-based algorithm has been developed. The specific methods of such analysis methods are well known and can be referred to, for example, the website of the National Center of Biotechnology Information (NCBI) (http: / / www.ncbi.nlm.nih.gov / ).

[0039] The nucleic acid probe preferably has a linker region in addition to the complementary region. The linker region is not particularly limited as long as it does not substantially hinder the hybridization of the target nucleic acid and the nucleic acid probe, and can include, for example, a nucleic acid linker, an alkyl linker, a PEG (polyethylene glycol) polymer linker, or the like. As the linker region, a nucleic acid linker is preferred. When the linker region is a nucleic acid linker, the base length thereof is, for example, 5 bases or more, preferably 5 to 100 bases, more preferably 5 to 50 bases, further preferably 5 to 30 bases, and still further preferably 7 to 20 bases.

[0040] In the chip of the present application, in the mode (x), the nucleic acid probe is linked via an amino group linked to the inorganic substrate.

[0041] There are no particular limitations on the method for linking amino groups to an inorganic substrate, but the use of a silane coupling agent is preferred. When using a silane coupling agent containing an amino group, the amino group can be linked to the inorganic substrate by reacting the silane coupling agent with the inorganic substrate. Alternatively, when using a silane coupling agent with a reactive structure (e.g., Si-H bond, vinyl group, etc.), the amino group can be linked to the inorganic substrate by reacting the inorganic substrate with the silane coupling agent and then linking an amino-containing compound (e.g., a chain compound) via the reactive structure (e.g., using a hydrosilylation reaction, a thiol olefin reaction).

[0042] As a silane coupling agent, any silane coupling agent having an amino group (e.g., 1 to 3, preferably 1) or a reactive structure (e.g., Si-H bond, vinyl group, etc.) in the molecule that is chemically bonded to the inorganic substrate is acceptable, without particular limitation. Examples of reactive groups that chemically bond to the inorganic substrate include alkoxy groups and halogen atoms, with alkoxy groups being particularly preferred. Alkoxy groups can be either straight-chain or branched; from the viewpoint of reactivity, straight-chain alkoxy groups with 1 to 4 carbon atoms (particularly 1 to 2) are preferred. Compounds with the general formula (x2) are preferably listed as monofunctional silane coupling agents: [In the formula: R] 1 and R 2 Same or different, indicating alkyl, hydrogen, alkoxy, or halogen atom. R 3 Indicates a linking group or a single bond. R 4 This indicates an alkoxy or halogen atom. Y in R 3 When it is a linking group, it indicates an amino or vinyl group, in R 3 When represented by a hydrogen atom, it indicates an amino group, a vinyl group, or a hydrogen atom. R 1 Or R 2 The alkyl group shown can be either straight-chain or branched, preferably a straight-chain alkyl group with 1 to 4 carbon atoms (particularly preferably 1 to 2).

[0043] R 1 Or R 2 The alkoxy group shown is the same as the alkoxy group described above.

[0044] As R 1 Or R 2 The halogen atoms shown can be, for example, fluorine atoms, chlorine atoms, bromine atoms, iodine atoms, etc.

[0045] R 1 R 2R is preferably an alkyl group or a hydrogen atom, and is particularly preferably an alkyl group. That is, the silane coupling agent is particularly preferably a 1-functional silane coupling agent.

[0046] R 3 The linking group is not particularly limited, and is, for example, a divalent group having a straight chain or a branched chain with 1 to 8 main chain constituting atoms, and is preferably an alkylene group, an alkenylene group, in which the chain constituting carbon atom can be substituted with a hetero atom (S, O, N, etc.). 3 R is particularly preferably a hydrocarbon group.

[0047] R 3 The hydrocarbon group is a 2-valent hydrocarbon group, and is, for example, an alkylene group, an alkenylene group, an arylene group, or a combination thereof. The alkylene group and the alkenylene group can be either a straight chain or a branched chain, and are preferably a straight chain alkylene group or a straight chain alkenylene group having 1 to 8 carbon atoms (more preferably 2 to 6 carbon atoms, and particularly preferably 3 to 4 carbon atoms). The arylene group is, for example, a phenylene group, a naphthylene group, or the like, and is a 4- to 12-carbon arylene group. 3 R is preferably an alkylene group.

[0048] R 4 The alkoxy group is the same as the alkoxy group described above.

[0049] R 4 The halogen atom is the same as the halogen atom described above.

[0050] R 4 R is preferably an alkoxy group.

[0051] Y is particularly preferably an amino group. When Y is an amino group, the chip of the present application can be produced in fewer steps and more easily.

[0052] In mode (x), the silane coupling agent is linked to the inorganic base material, and the nucleic acid probe is linked via a reaction (as necessary, another reaction) with the amino group on the above-described silane coupling agent linked to the inorganic base material or the amino group linked by the silane coupling agent. In mode (x), more preferably (x1) a group represented by General Formula (x1) is bound to the inorganic base material: [In the formula, R 1 and R 2 are the same or different, and represent an alkyl group, a hydrogen atom, an alkoxy group, a halogen atom, a binding portion with a silane coupling agent, or a binding portion with an inorganic base material. 3 are the same as described above. 4A represents an oxygen atom or a single bond. L 1 represents a linking group. Probe represents a nucleic acid probe. * represents a binding portion with an inorganic base material. R 1 or R 2The alkyl group, the alkoxy group, and the halogen atom shown in the above are the same as described above.

[0053] In R 1 , R 2 The binding portion to the silane coupling agent shown in the above includes a silane coupling agent as an object, and also includes a silane coupling agent in a state of being linked to another substance (for example, the inorganic base material shown in the above).

[0054] L 1 The linking group shown in the above is a moiety formed by reaction (and, if necessary, another reaction) of the amino group of the above 1-functional silane coupling agent linked to the inorganic base material, and is not particularly limited as long as it is so. The linking group can be, for example, a chain structure (the main chain is constituted of, for example, carbon atoms, nitrogen atoms, sulfur atoms, oxygen atoms, and the like, for example, an alkylene group or a heteroalkylene group) of a straight chain or a branched chain (preferably a straight chain) having a carbon atom number of 1 to 50 (from the viewpoint of detection sensitivity and the like, preferably 1 to 20, more preferably 1 to 10, further preferably 1 to 5, and still further preferably 1 to 3) in the main chain. The linking group can be substituted with an oxo group and the like. The linking group can have -C(=O)- in the main chain.

[0055] The nucleic acid probe shown in the Probe is the same as the above nucleic acid probe.

[0056] The group shown in the general formula (x1) can be bound to an atom in the inorganic base material (when the inorganic base material is glass, to a silicon atom constituting the glass).

[0057] In the mode (x), the surface of the inorganic base material to which the nucleic acid probe is linked, that is, the inorganic base material linked by the silane coupling agent, is preferably more smooth from the viewpoint of detection sensitivity and the like. The height of the agglomerate on the surface can be preferably 30 nm or less, more preferably 20 nm or less, and further preferably 10 nm or less. The height of the agglomerate can be measured by AFM observation according to the method of Example 1.

[0058] In the mode (y) of the chip of the present application, the nucleic acid probe is linked by an amide bond of an amino group linked to the inorganic base material and a nucleic acid probe having an active ester group or a carboxyl group (preferably having at the terminal end or the linking group region, and particularly preferably at the terminal end of the linking group region) (preferably an active ester group).

[0059] The amino group linked to the inorganic base material is an amino group directly or indirectly (for example, via a linking group) linked to an atom constituting the inorganic base material.

[0060] As the active ester group, there is no particular limitation as long as it is an ester group capable of forming an amide bond with an amino group, and for example, a group that is a carboxyl group (-COOH) converted into an active ester group having high reactivity, such as an active ester group using N-hydroxysuccinimide (for example, -C(=0)OSu: Su is a succinimide group), a group in which a carboxylic acid is formed as a mixed anhydride (for example, -C(=0)OC(=0)R: R is a C1-C6 alkyl group), an acylimidazole group using carbonyldiimidazole (CDI) (for example, -C(=0)-Im: Im is a 1-imidazole group), and the like can be exemplified.

[0061] In the mode (y), more preferably (yl) the inorganic substrate has a group represented by General Formula (yl) bound thereto: [In the formula, L 2 represents a linking group. Probe and * are the same as described above.] L 2 The linking group represented by General Formula (y) is a moiety introduced when the amino group is linked to the inorganic substrate, and there is no particular limitation as long as this is the case. The linking group can be, for example, a linear or branched (preferably linear) chain structure having a carbon atom number of the main chain of 1 to 50 (from the viewpoint of detection sensitivity and the like, preferably 2 to 20, more preferably 3 to 10) (the atoms constituting the main chain are, for example, carbon atoms, silicon atoms, nitrogen atoms, sulfur atoms, oxygen atoms, and the like, for example, alkylene or heteroalkylene).

[0062] The group represented by General Formula (yl) can be bound to an atom in the inorganic substrate (when the inorganic substrate is glass, to a silicon atom constituting the glass).

[0063] From the viewpoint of detection sensitivity and the like, the chip of the present application preferably has the mode (x), and particularly preferably has both the mode (x) and the mode (y). When both are present, the (xy) nucleic acid probe is linked via an amide bond between the amino group linked to the inorganic substrate and the nucleic acid probe having an active ester group or a carboxyl group. In the mode (xy), more preferably (xyl) the inorganic substrate has a group represented by General Formula (xyl) bound thereto: [In the formula, R 1 , R 2 , R 3 , R 4A , Probe and * are the same as described above.] The chip of the present application can be manufactured by various methods. Preferably, the chip of the present application can be manufactured by a method including (X) a step of reacting the inorganic substrate and a silane coupling agent; and / or (Y) a step of reacting the amino group linked to the inorganic substrate and a nucleic acid probe having an active ester group or a carboxyl group.

[0064] <Step (X)> The inorganic substrate is subjected to surface modification treatment (for example, treatment for introducing hydroxyl groups by plasma treatment) as needed, so as to be able to react with the silane coupling agent.

[0065] The reaction of the inorganic substrate with the silane coupling agent is a reaction that enables the hydroxyl groups exposed on the surface of the inorganic substrate to react with the reactive groups (for example, alkoxy groups, etc.) of the silane coupling agent to form chemical bonds (for example, Si-O-Si), and is not particularly limited as long as this is so. As the reaction, either of a gas phase method and a liquid phase method can be employed, and from the viewpoints of convenience, further reduction in the amount of the silane coupling agent to be used, etc., the gas phase method is preferred.

[0066] The gas phase method is specifically performed, for example, in a closed reaction tank containing a carrier that holds the silane coupling agent and the inorganic substrate. The silane coupling agent and the carrier are not particularly limited as long as the silane coupling agent is able to volatilize, and for example, 3-aminopropyldimethylmethoxysilane (APDMMS), or 3-aminopropyldimethylmethoxysilane (APDMES) and filter paper can be used. The amount of the silane coupling agent is preferably 0.1 to 2 μL / cm 2 , more preferably 0.2 to 1 μL / cm 2 , with respect to the surface area of the inorganic substrate. The reaction conditions can be set to, for example, 10 to 50°C for 6 to 24 hours.

[0067] The liquid phase method is specifically performed in a state in which the inorganic substrate is in contact with (preferably, in a state of being impregnated with) a silane coupling agent solution. The concentration of the silane coupling agent in the silane coupling agent solution is preferably 1 to 15 mass%, more preferably 2 to 10 mass%. The solvent of the silane coupling agent solution can be appropriately selected, and for example, N,N-dimethylformamide can be used. The silane coupling agent solution preferably contains a base such as triethylamine, for example, at a concentration of 0.1 to 1 mass%. The reaction conditions can be set to, for example, 60 to 100°C for 6 to 24 hours.

[0068] Cleaning is preferably performed after Step (X). The cleaning method is not particularly limited, and for example, ultrasonic cleaning in an organic solvent can be performed.

[0069] When a substance that does not have an amino group is used as the silane coupling agent, a reaction for linking an amino group can be further performed after Step (X). As the reaction, for example, a hydrosilylation reaction, a thiol-ene reaction, more specifically, for example, a reaction system in accordance with the following or a reaction based thereon can be used. <Step (Y)> The reaction is a reaction capable of reacting the amino group linked to the inorganic substrate with the nucleic acid probe having a reactive ester group or a carboxyl group to form an amide bond, and is not particularly limited as long as it is such a reaction. The reaction can be performed by bringing the inorganic substrate having the amino group linked thereto into contact with a solution containing the nucleic acid probe.

[0070] The concentration of the nucleic acid probe in the solution containing the nucleic acid probe is preferably 0.5 to 10 μM, more preferably 1 to 5 μM. The solvent of the solution containing the nucleic acid probe is usually water. The solution containing the nucleic acid probe preferably contains a buffer such as MOPS. The pH of the solution containing the nucleic acid probe is preferably in the vicinity of neutral (for example, 6.0 to 8.0). The solution containing the nucleic acid probe preferably contains a condensing agent (in this case, the concentration of the condensing agent is preferably 10 to 100 mM).

[0071] As the condensing agent, there is no particular limitation, and for example, a triazine-based condensing agent (for example, 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMT-MM), trifluoromethanesulfonic acid (4,6-dimethoxy-1,3,5-triazin-2-yl)-(2-octyloxy-2-oxoethyl)dimethylammonium (interfacial DMT-MM)), a carbodiimide-based condensing agent (for example, N,N'-dicyclohexylcarbodiimide imidazole (DCC), N,N'-diisopropylcarbodiimide, 1-ethyl-3-dimethylaminopropylcarbodiimide hydrochloride (EDCI)), a uranium-based condensing agent (for example, 1-[bis(dimethylamino)methylene]-1H-benzotriazolium 3-oxide tetrafluoroborate (TBTU), 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide tetrafluoroborate (TATU)), a chloroformate-based condensing agent (for example, ethyl chloroformate, isobutyl chloroformate), an oxyl halide-based condensing agent (for example, pivaloyl chloride), an imidazole-based condensing agent (for example, 1,1'-carbonyldiimidazole (CDI)), a phosphonium-based condensing agent (for example, (benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate (PyBOP (registered trademark)), bromotripyrrolidinophosphonium hexafluorophosphate (PyBrop (registered trademark))), and the like can be exemplified.

[0072] After the step (Y), washing is preferably performed. As the method of washing, there is no particular limitation, and for example, a washing operation of bringing it into contact with a washing buffer and incubating it for a prescribed time and then removing the washing buffer can be performed.

[0073] The following is a reaction scheme illustrating the case where a nucleic acid probe having an active ester group is used in Step (Y). Also, the same structure is formed when a nucleic acid probe having a carboxyl group is used. In the prior art, the active ester group is disposed on the substrate side, whereas in Step (Y), the feature is that the active ester group or the carboxyl group is disposed on the nucleic acid probe side. Thus, a structure in which -C(=O)-, -NH- are disposed in this order from the nucleic acid probe side is formed. In a preferred embodiment of the present application, the chip of the present application is a nucleic acid detection chip having a group represented by General Formula (xy1) bound to an inorganic substrate. [In the formula, R 1 and R 2 are the same or different and represent an alkyl group or a hydrogen atom. R 3 represents a linking group. R 4A represents an oxygen atom or a single bond. Probe represents a nucleic acid probe. * represents a binding site to an inorganic substrate. The chip of the present application preferably includes (A) a sample injection portion, and (C) a flow path having a nucleic acid probe immobilization region connected to the above-described sample injection portion A.

[0074] A polymer resin or the like is preferably used in the formation of a flow path for sample delivery, and the flow path chip of the present application is preferably configured from these functional sites. In particular, a resin substrate having high transparency, such as a PDMS resin substrate, a COC resin substrate, a PMMA resin substrate, or the like is preferably used among polymer resin substrates. In addition, an inorganic substrate such as glass or metal can also be used.

[0075] The size of the flow path chip of the present application is not particularly limited, and is preferably small in order to be easy to handle and convenient to use at a cultivation site or the like. Typically, the length x width is 1 to 20 cm x 1 to 20 cm, and is preferably 1 to 5 cm x 1 to 5 cm. For example, a size on the order of a glass slide is preferable.

[0076] The thickness of the flow path chip of the present application can be appropriately set in consideration of the molding method of the flow path chip, the depth of the flow path described later, and the like.

[0077] The sample is a sample prepared from a living organism, an environment (soil, rivers, ponds, lakes, oceans, sewage, and the like), or the like, and is used directly or used after being appropriately purified, and is not particularly limited as long as it is a sample from which a substance in the sample can be detected, and an appropriate sample can be used depending on the substance to be detected. The raw material is particularly preferably a plant sample. As a plant sample, for example, a crushed liquid of a plant tissue such as a bud, a leaf, a stem, a flower, a root, a fruit, a seed, or the like, an extract, a sieve tube liquid, a vessel liquid, a sap, a juice from a drainage tissue, or the like can be cited.

[0078] The sample injection portion A is a site provided on the flow path chip of the present application, and is a site for introducing a sample into a flow path described later. The shape and structure of the sample injection portion A are not particularly limited, and are generally a hole shape. The number of sample injection portions A included in the flow path chip of the present application can be one or a plurality.

[0079] The flow path chip of the present application preferably further includes a sample discharge portion B. The sample discharge portion B is a region provided on the flow path chip of the present application, and is a region for discharging a sample from a flow path described later. The shape and structure of the sample discharge portion B are not particularly limited, and are generally a hole shape. The sample discharge portion B can be formed in a shape that discharges a solution to the outside of the flow path chip, or can be formed in a shape that does not discharge a solution so that the solution does not be discharged to the outside of the flow path chip. When formed in a shape that discharges a solution to the outside, a structure in which a catheter or the like is inserted can be prepared, and a shape in which a solution is discharged to the outside through a catheter or the like can be formed. When formed in a shape that does not discharge a solution to the outside, for example, an internal space of a prescribed area is provided in the sample discharge portion B, and the internal space is preliminarily formed in a vacuum state or a negative pressure state, whereby it is also possible to cause a sample solution, a buffer, or the like from the flow path C to remain in the internal space after discharging the internal space. At this time, the sample discharge portion B can not necessarily be open to the outside. In addition, for example, by preparing a fine passage that connects a part of the internal space of the sample discharge portion B to the outside and connecting it to a pump or the like, the internal space is preliminarily formed in a negative pressure, or is formed in a negative pressure during the operation of the flow path chip, whereby it is possible to discharge a solution from the flow path C to the internal space of the sample discharge portion B and cause it to remain, and in the case where a solution is not discharged to the outside of the flow path chip, it is also possible to form a shape in which the sample discharge portion B is open to the outside. The number of sample discharge portions B included in the flow path chip of the present application can be one or a plurality.

[0080] The flow path C is provided on the flow path chip of the present application, and is connected to the sample injection portion A. That is, the sample injection portion A and the flow path C are connected in such a manner that a sample introduced from the sample injection portion A flows through the flow path C, or are provided in a state capable of being adjusted to be connected. As an example of the latter case, for example, a case in which a flow path switching portion is provided on the flow path C, and the state in which the sample injection portion A and the flow path C are not connected and the state in which they are connected are switched by the flow path switching portion can be cited.

[0081] In one embodiment of the flow path C, the flow path C links the sample injection portion A and the sample discharge portion B. That is, the sample injection portion A, the sample discharge portion B, and the flow path C are connected in such a manner that the plant sample introduced from the sample injection portion A can reach the sample discharge portion B through the flow path C, or are arranged in a state capable of being adjusted to be connected. As an example of the latter case, there can be cited a case where a flow path switching portion is provided on the flow path C, and the sample injection portion A, the sample discharge portion B, and the flow path C are switched between a state where they are not connected and a state where they are connected by the flow path switching portion.

[0082] The number of the flow path C included in the flow path chip of the present application can be one or a plurality.

[0083] The flow path C can exist on the chip in various manners. For example, a groove formed on the surface of the chip can be used as the flow path. Alternatively, a pipe-like flow path formed inside the chip can be used as the flow path.

[0084] The shape of the flow path C is not particularly limited, and as a cross-sectional shape of a plane orthogonal to the flow of the sample in the flow path, for example, a circular shape, a semicircular shape (with the chord as the upper portion), a quadrangular shape (with one side as the upper portion), a triangular shape (with one side as the upper portion), or the like can be used. In view of the easiness of manufacturing processing of the flow path, the easiness of manufacturing of the detection region possessed by the flow path, and the like, a semicircular shape or a quadrangular shape is preferred.

[0085] The shape of the flow path axis of the flow path C is not particularly limited as long as the flow of the sample does not stagnate when the sample flows in the flow path, and for example, a linear shape, a curved shape, or the like can be used, with a linear shape being preferred. This is because the flow of the sample is least likely to stagnate. Furthermore, the flow path axis refers to the axis of the flow direction of the fluid (sample) in the flow path. A plurality of flow path axes can be branched from the sample injection portion A, and detection sites can be prepared at the front ends of the branches, and detection can be performed in parallel at a plurality of sites. By repeatedly performing the detection reaction a plurality of times, a result with high reproducibility can also be obtained.

[0086] The size of the flow path C is not particularly limited, and generally, the width thereof is several μm or more and several thousand μm or less, and the depth thereof is several μm or more and several thousand μm or less. The flow path C is preferably a micro flow path. The width and the height of the flow path C can be appropriately set within the above-mentioned ranges according to the purpose or the like. The width of the flow path is, for example, 10 to 2000 μm, preferably 100 to 1000 μm, more preferably 300 to 700 μm, and further preferably 400 to 600 μm. In addition, the height of the flow path is 1 to 200 μm, 5 to 100 μm, 10 to 50 μm, or 15 to 25 μm.

[0087] The flow path C has a nucleic acid probe immobilization region on its flow path. In this region, a nucleic acid probe is bound to the inner wall of the flow path. As for the binding method, the above-described method (x) and / or method (y) is used. The number of nucleic acid probe immobilization regions included in one flow path C can be one or plural. When immobilizing the probe, the probe can be immobilized in a specific region using a probe immobilization device, and a calibration mark can be provided on the device as an index to grasp the position of the probe immobilization. In addition, the number of immobilized nucleic acid probes included in one flow path C can be one or plural.

[0088] In one embodiment of the present application, the flow path chip of the present application preferably has a nucleic acid probe non-immobilization region on the flow path C, and / or includes a flow path D having a nucleic acid probe non-immobilization region. When the flow path C is plural, it is preferable that the corresponding flow path D is included in the plural flow paths C. In addition, it is preferable that the flow path is designed in such a manner that the same plant sample passes through the flow path D and the flow path C. Specifically, for example, it is preferable that both the flow path C and the flow path D are connected from one sample injection portion A.

[0089] When RNA is used as the detection target (particularly when a plant sample is used), the degree of purification of the sample is low (for example, when a broken solution of a plant tissue or the like is used), and the RNA detection sensitivity and the detection accuracy are reduced due to the influence of RNA-degrading enzymes or the like. At this time, by using a plant sample that has been filtered using a filter (particularly a protein-removing filter), the RNA detection sensitivity and the detection accuracy can be greatly improved simply. The MWCO of the filter is preferably 5 to 100 K, more preferably 5 to 70 K, further preferably 10 to 50 K, more further preferably 15 to 40 K, and particularly preferably 20 to 35 K. The filter can be provided on the flow path chip of the present application as described later. The passage of the filter can be performed by suction or centrifugation as needed.

[0090] The nucleic acid probe immobilized on the flow path of the flow path chip of the present application can be one kind alone or two or more kinds in combination. A plurality of them can be arranged in one dimension, or can be arranged in two dimensions. From the viewpoint that a carefully selected plant substance can be easily collected and used conveniently at a cultivation site or the like, the number of nucleic acid probes immobilized on the flow path of the flow path chip of the present application is preferably 1 to 200, more preferably 1 to 100, and further preferably 1 to 20.

[0091] As a more specific embodiment of the flow path chip of the present application and a production method thereof, the method of Patent Literature 1 can be used.

[0092] 2. Apparatus The present application relates to an apparatus having the chip of the present application (preferably the flow path chip of the present application) in one embodiment thereof (in the present specification, also referred to as "the apparatus of the present application"). Hereinafter, this will be described.

[0093] The device of the present application preferably has various devices, sites, etc. for detection of a sample in addition to the chip of the present application. As such devices, for example, there can be listed a liquid (e.g. a buffer, a washing solution, etc.) reservoir, a conduit that moves a liquid from the reservoir to the flow path chip of the present application, etc., a vacuum pump, a photographing section, a plant sample collection section, a plant sample crushing section, a plant sample preparation section, a plant sample purification section, a temperature adjusting machine, a voltage current adjusting machine, a magnetic force adjusting machine, etc. In addition, for example, there can be listed a device that has a part of the above functions (a liquid (e.g. a buffer, a washing solution, etc.) reservoir, a conduit that moves a liquid from the reservoir to the flow path chip of the present application, etc., a vacuum pump, a plant sample collection section, a plant sample preparation section, a plant sample purification section).

[0094] The sample purification section is not particularly limited as long as it is a site that can purify a sample, and can be, for example, a site provided with a carrier for chromatography. In addition, from the viewpoint of being able to easily improve the sensitivity and accuracy of RNA detection, the plant sample purification section preferably includes the filter described above.

[0095] The device of the present application is used, for example, by the method of the present application described later ("4. Method"), and can be used, for example, as a sample injection device, a detection device, a plant state determination device, etc.

[0096] As a more specific mode of the device of the present application, a manufacturing method, the mode of Patent Literature 1 can be adopted.

[0097] 3. Kit The present application relates to a kit including the chip of the present application (preferably the flow path chip of the present application) and / or the device of the present application (in the present specification, sometimes also referred to as "the kit of the present application") in one mode thereof. Hereinafter, this will be described.

[0098] The kit of the present application preferably includes various reagents, instruments, etc. for detection of a sample. As such reagents, for example, there can be listed a buffer, a washing solution, an instrument for preparing a sample, a reagent for preparing a sample, an instrument for purifying a sample, a reagent for purifying a sample, a label (e.g. a labeled nucleic acid) having binding property (preferably specific binding property) to a target substance, a reagent necessary for detection of labeling of the label, an instrument necessary for detection of labeling of the label, a reagent necessary for denaturation of an unnecessary component, an instrument necessary for denaturation of an unnecessary component, etc.

[0099] The kit of the present application is used, for example, by the method of the present application described later ("4. Method"), and can be used, for example, as a plant substance detection kit, a plant state determination kit, etc.

[0100] 4. Method The present application relates to a method (in the present specification, sometimes also referred to as "the method of the present application") including (a) a step of bringing a plant sample into contact with the chip of the present application (preferably, the nucleic acid probe immobilization region of the flow path chip of the present application), and (b) a step of detecting a signal on the nucleic acid probe. Hereinafter, this will be described.

[0101] In the step a, the manner of bringing the plant sample into contact with the nucleic acid probe immobilization region is not particularly limited. Typically, by injecting the plant sample from the sample injection portion A, introducing the plant sample into the flow path C, and bringing it into contact by allowing it to freely diffuse in the nucleic acid probe immobilization region within the flow path C or by setting a flow rate, it can be performed in a low amount and in a short time.

[0102] In the step a, the plant sample brought into contact with the nucleic acid probe immobilization region is preferably a plant sample obtained by filtering with a filter (particularly, a protein removal filter) from the viewpoint of RNA detection sensitivity and detection accuracy. The filtration with the filter can be performed in the sample purification portion in the flow path chip of the present application, or can be performed before injecting the flow path chip of the present application.

[0103] The method of injecting the plant sample into the sample injection portion A is not particularly limited, and can be performed using a pipette, a micropipette, a syringe, or the like, a device preferred for the injection of a small amount of a solution sample, or a site formed on a device corresponding to these structures.

[0104] The method of introducing the injected plant sample into the flow path C is not particularly limited, and can be performed by, for example, operating air pressure, capillary phenomenon, centrifugal force, voltage, electric current, osmotic pressure, magnetism, or the like. As a specific method, for example, in the case of operating air pressure, for example, adjustment of the air pressure using a vacuum pump installed in the flow path C or the sample discharge portion B, or the like can be exemplified, in the case of using capillary phenomenon, for example, the size of the flow path C can be exemplified, in the case of using centrifugal force, for example, centrifugation of the flow path chip of the present application using a centrifuge, or the like can be exemplified, in the case of operating voltage, for example, adjustment of the voltage between the sample injection portion A and the flow path C or the sample discharge portion B, or the like can be exemplified, in the case of operating electric current, for example, the flow of electric current between the sample injection portion A and the flow path C or the sample discharge portion B, or the like can be exemplified, in the case of operating osmotic pressure, for example, adjustment of the osmotic pressure between the sample injection portion A and the flow path C or the sample discharge portion B, or the like can be exemplified, and in the case of operating magnetism, for example, suspension of a magnetic body between the sample injection portion A and the flow path C or the sample discharge portion B and adjustment of the magnetism, or the like can be exemplified.

[0105] The plant sample that has passed through the flow path C reaches the sample discharge portion B on the flow path C (for example, the end portion on the flow path C on the side opposite to the plant sample injection portion). The plant sample that has reached there can be left as it is, for example, or can be appropriately recovered, reused, or discarded, and the like, thereafter. The recovery method is not particularly limited, and a small amount of solution sample can be recovered using a pipette, a micropipette, a syringe, or the like, or an appropriate tool. Alternatively, in a case where the sample discharge portion B is shaped to have an internal space of a prescribed area, or the like, a part or all of the plant sample that has passed through the flow path C can be left inside the device after being discharged to the sample discharge portion B.

[0106] After the process a, the flow path C, particularly the plant substance detection probe immobilization region, is washed as necessary. The washing is performed, for example, by introducing water, a buffer, or the like into the flow path C in the same manner as described above, and then discharging it to the outside from the sample discharge portion B, or discharging it to the internal space of the sample discharge portion B.

[0107] In the process b, the detection signal is not particularly limited. For example, in a case where the detection target (plant substance) in the plant sample is labeled in advance, the signal from the labeling can be detected. In a case where the detection target (plant substance) in the plant sample is not labeled in advance, the plant substance on the nucleic acid probe immobilization region can be labeled after the process a, and then the signal from the labeling can be detected. Alternatively, the intermolecular interaction between the molecule as the detection target and the probe molecule can be detected as a change in the resistance of the reaction region. The labeling can be performed according to the type of the label, and in a known manner. The labeling can be performed by directly binding the label to the plant substance, or can be performed by indirectly binding the label to the plant substance via another substance.

[0108] As the label, for example, a fluorescent label, a peroxidase label, an alkaline phosphatase label, a β-galactosidase label, a glucose oxidase label, a urease label, a biotin label, a streptavidin label, a magnetic particle label, a gold-colloidal gold label, a radioactive substance label, a quantum dot label, and the like can be used. As the fluorescent substance used for the fluorescent label, for example, a fluorescent compound sold by a reagent company, such as a phycobiliprotein, various fluoresceins, various anthocyanin pigments, and the like can be used, and of course, a fluorescent protein such as GFP can be appropriately selected and used.

[0109] The plant substance can be detected by the method of the present application including the process a and the process b described above.

[0110] The method of the present application does not require cooling conditions even in the case of a readily decomposable detection target such as RNA. According to the method of the present application, by using a plant sample filtered with a filter, a readily decomposable detection target such as RNA can be detected with higher sensitivity and accuracy even under non-cooling conditions (e.g., 10 to 35°C, 15 to 30°C, 15 to 25°C).

[0111] In addition, the method of the present application can determine the state of the plant in the case where the process c: (c) determining the state of the plant based on the value of the signal is included.

[0112] The state of the plant includes not only the present state but also the past and future states. As the state of the plant to be determined, for example, the deficiency of a nutrient component (e.g., phosphorus, sulfuric acid, nitrogen, etc.), the infection of a disease, the flowering period, the tuber formation period, the growth period of a dormant bud, the degree of rhizobium symbiosis, etc. can be listed.

[0113] Specifically, for example, by comparing the value of the signal with a cutoff value, the state can be determined. The cutoff value can be appropriately set from the viewpoint of sensitivity, specificity, positive predictive value, and negative predictive value by those skilled in the art, for example, can be set to an optional value or a predetermined value based on the signal value in a control plant sample prepared from a plant cultivated with a medium sufficient in a nutrient component, etc. The cutoff value can be set, for example, based on the signal value of the control plant sample, the average value, the median value, etc. of the signal values in the case where the detection target is plural.

[0114] In addition, the method of the present application can also be used as a plant cultivation method, which includes, in addition to the process c, a process d: (d) adjusting the cultivation conditions of the plant based on the result of the above determination.

[0115] As the adjustment of the cultivation conditions, for example, the application of a fertilizer containing a nutrient component such as phosphorus or the increase of the application amount can be listed in the case where the result of the process c is determined to be the deficiency of the nutrient component. The application of an agricultural chemical such as a fungicide or the removal of the infection site from the individual part or the removal of the infected individual from the cluster, thereby suppressing the spread of the infection of the disease, etc. can be listed in the case where it is determined to be the infection of the disease. Thereby, the cultivation and production of the crop can be more stably performed, and the productivity of the crop can be further improved.

[0116] Examples Hereinafter, the present application will be described in detail based on examples, but the present application is not limited by these examples.

[0117] Example 1. Preparation of amino-coated glass by a liquid phase method The glass surface of a commercially available glass slide was surface-treated with a silane coupling agent, thereby producing a glass having an amino group modified on the glass surface. The reaction scheme is shown in Figure 1 Specifically, the following method was performed.

[0118] (1) The glass surface of a glass slide was washed with acetone, and the surface was plasma-treated (5 mA, 45 sec).

[0119] (2) After the plasma treatment, the glass was quickly immersed in N,N-dimethylformamide (DMF), and a silane coupling agent (3-aminopropyl dimethyl methoxysilane (APDMMS) or 3-aminopropyl dimethyl ethoxysilane (APDMES)) was added at a final concentration of 5%, and triethylamine (TEA) was added at a final concentration of 0.3%.

[0120] (3) The reaction solution in which the glass was immersed was allowed to react at 80°C for 11 hours or more.

[0121] (4) After the reaction was completed, the reaction solution was cooled to room temperature, and the glass was immersed in chloroform and washed with an ultrasonic cleaner for 10 minutes. The chloroform was changed, and the same washing was repeated three times.

[0122] (5) The glass was dried by air-drying.

[0123] The results of XPS measurement of the surface of the produced glass are shown in Figure 4 From the fact that a peak of an amino group was found around 401 eV, it was shown that an amino group was modified on the surface of the glass. The surface of the glass was observed with an AFM, and as a result, the commercially available amino-coated glass was confirmed to have agglomerates of about 100 nm in height and about 100 nm in width on the entire surface Figure 5 On the other hand, the height of the agglomerates on the surface of the glass coated with the self-made glass was 10 nm or less, and the surface structure was flat Figure 5 The results show that the surface structure of the self-made coated glass is flatter than that of the commercially available glass, and is expected to be a platform for performing a miRNA detection reaction with higher sensitivity and stability.

[0124] Example 2. Production of an amino-coated glass by a vapor phase method In order to perform the amino-coating reaction of the glass surface with a silane coupling agent at a lower cost and with high efficiency, an amino-coated glass was produced by a vapor phase method. The reaction scheme is shown in Figure 1 Specifically, the following was performed.

[0125] (1) A piece of filter paper was disposed at the end of a glass-made reaction tank.

[0126] (2) A glass substrate that had just been subjected to ozone washing was disposed at the center of the reaction tank.

[0127] (3) The pieces of filter paper were dropped with a silane coupling agent (3-Aminopropyldimethylmethoxysilane (APDMMS) or 3-Aminopropyldimethylmethoxysilane (APDMES)) in an amount of 0.625 μl / cm2relative to the surface area of the glass. 2

[0128] (4) After the rapid capping, it was left overnight at room temperature.

[0129] (5) After the reaction was completed, the glass was immersed in chloroform and cleaned with an ultrasonic cleaner for 10 minutes. The chloroform was changed and the same cleaning was repeated 3 times.

[0130] (6) The glass was dried by air-drying.

[0131] The glass coated by the vapor phase method was subjected to XPS analysis, and as a result, a peak of the amino group was confirmed near 401 eV as with the liquid phase method ( Figure 6 ). From this result, an amino-coated glass was also produced by the vapor phase reaction.

[0132] Example 3. Solid-phase of DNA using NHS ester and mounting of detection device In order to confirm the solid-phase of the DNA probe ( Figure 2 or Figure 3 ) and the quality of the amino-coated glass, a PDMS device (straight PDMS device) having a flow path (flow path width: 500 μm, flow path height: 100 μm) with a liquid introduction port and a liquid suction port was used. The introduction of the liquid into the flow path was performed by introducing the liquid into the introduction port with a pipette, and the passage was performed. Specifically, it was performed as follows.

[0133] (1) The DNA probe solid-phase PDMS device was mounted on the amino-introduced glass slide glass (commercially available glass or self-made glass).

[0134] (2) 2 μM of the NHS-based modified DNA probe (NHS-DNA-miR399: NHS-TTTTTTTTTTTTTTTCAGGGCAACT (SEQ ID NO: 1)), 50 mM of 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMT-MM) were prepared with 100 mM MOPS buffer (pH 7.0), and incubated overnight at 25 degrees.

[0135] ​(3) The glass surface was cleaned by introducing a cleaning buffer (0.5x SSC, 0.1% SDS) for DNA probe solid phase using a PDMS-made device.

[0136] (4) A blocking solution (1x Blocking Solution (DIG Wash and Block Buffer Set, Roche)) was introduced into the flow path, and incubated at room temperature for 60 minutes.

[0137] (5) A sample solution (composition: miR399 (UGCCAAAGGAGAGUUGCCCUG (SEQ ID NO: 2)) (0 nM or 1 nM), biotin-labeled DNA probe (CTCCTTTGGCA (SEQ ID NO: 3) - [biotin]) (0.4 μM), buffer (1x TE, 1x PBS), dithiothreitol (1 mM)) was prepared in a test tube.

[0138] (6) 10 μl of the sample solution was introduced into the flow path of the detection device, and hybridized for 30 minutes.

[0139] (7) 20 μl of streptavindin Alexa Flour 555 conjugate (500x) was introduced into the flow path, and incubated at room temperature for 15 minutes.

[0140] (8) 40 μl of a washing buffer (1x Washing Buffer (DIG Wash and Block Buffer Set, Roche)) was introduced into the flow path, and the flow path was washed.

[0141] (9) 20 μl of a biotinylated anti-streptavidin antibody (7.5 μg / ml) was introduced into the flow path, and incubated at room temperature for 10 minutes.

[0142] (10) 20 μl of streptavindin Alexa Flour 555 conjugate (500x) was introduced into the flow path, and incubated at room temperature for 10 minutes.

[0143] (11) 40 μl of a washing buffer (1x Washing Buffer (DIG Wash and Block Buffer Set, Roche)) was introduced into the flow path, and the flow path was washed.

[0144] A fluorescent image of the flow path chip was obtained using a fluorescence microscope.

[0145] (13) The amount of fluorescence was quantified based on the fluorescent image (image analysis software ImageJ, National Institutes of Health, USA).

[0146] In Figure 7The middle indicates the results of comparing the detection signal of 1 nM of miR399 on the commercially available amino-coated glass and the self-made amino-coated glass. The detection amount of the commercially available glass and the self-made glass was compared, and as a result, the brightness value of the commercially available glass was 91.9, and in comparison, the brightness value of the self-made glass was 211.4, and the detection amount was significantly increased (Welch's t test: p<0.05). This result indicates that when the self-made glass is used as a glass substrate, the detection sensitivity is high.

[0147] In Figure 8 The middle indicates the results of comparing the detection signal of 1 nM of miR399 on the commercially available amino-coated glass and the self-made amino-coated glass. The detection amount of the commercially available glass and the self-made glass was compared, and as a result, the brightness value of the commercially available glass was 91.9, and in comparison, the brightness value of the self-made glass was 211.4, and the detection amount was significantly increased (Welch's t test: p<0.05). This result indicates that when the self-made glass is used as a glass substrate, the detection sensitivity is high.

[0148] Example 4. Detection of the detection surface signal when signal amplification is performed Using the self-made amino-coated glass and the DNA probe solid phase method using the NHS ester DNA, a signal amplification experiment was performed using a biotinylated anti-streptavidin antibody. A PDMS-made device (DNA probe solid phase PDMS-made device) having a flow path (flow path width: 500 μm, flow path height: 20 μm) with a liquid injection port and a liquid suction port was used, and the DNA probe was solidified on the amino-introduced glass slide. For the glass slide on which the DNA was solidified, a diagnostic device was fabricated by mounting a PDMS-made device (detection PDMS-made device) having six flow paths (flow path width: 500 μm, flow path height: 20 μm) including a liquid injection port, a liquid suction port, and a flow path connecting them. Using the fabricated detection device, artificial miR399 detection and signal amplification were performed. By introducing the liquid into the injection port with a pipette, the liquid was sucked from the suction port with a syringe pump, thereby introducing and passing the liquid into the flow path.

[0149] (1) 1 nM of miR399 (UGCCAAAGGAGAGUUGCCCUG (SEQ ID NO: 2)), a sample solution (biotin-labeled DNA probe (CTCCTTTGGCA (SEQ ID NO: 3) - [biotin]) (0.4 μM), a buffer (1xTE, 1xPBS), dithiothreitol (1 mM)) (5 μl) were mixed.

[0150] (2) 10 μl of the sample solution was introduced into the flow path of the detection device, and hybridization was performed (pump: 0.3 μl / min, 30 minutes).

[0151] (3) Streptavindin Alexa Flour 555 conjugate, Thermo) was introduced into the flow path (pump: 1.5 μl / min, 15 minutes).

[0152] (4) The flow path was washed with a washing buffer (1 x washing buffer (DIG wash and block buffer set, Roche)) (pump: 0.3 μl / min, 15 minutes).

[0153] (5) Biotinylated anti-streptavidin antibody (7.5 μg / ml) was introduced into the flow path (pump: 1.5 μl / min, 10 minutes).

[0154] (6) Streptavindin Alexa Flour 555 conjugate, Thermo) was introduced into the flow path (pump: 1.5 μl / min, 10 minutes).

[0155] (7) The flow path was washed with a washing buffer (1 x washing buffer (DIG wash and block buffer set, Roche)) (pump: 0.3 μl / min, 10 minutes).

[0156] (8) Signal amplification was performed by introducing the above-mentioned biotinylated anti-streptavidin antibody, streptavindin Alexa, and washing buffer 5 times.

[0157] (9) A fluorescent image of the flow path chip was obtained using a fluorescence microscope.

[0158] (10) The amount of fluorescence was quantified based on the fluorescent image (image analysis software ImageJ, National Institutes of Health, USA).

[0159] The results are shown in Figure 9 . The 1 nM of miR399 was detected with a significant difference (Welch's t test: p<0.05) compared with the value of the blank (0 nM) sample on both the commercially available glass and the self-made glass. On the other hand, as a result of signal amplification on the sample not containing miR399, the signal rise of the detection surface caused by the signal amplification process was specific on the self-made glass, whereas a strong non-specific signal was found from the detection surface on the commercially available glass. This result shows that the detection of non-specific signal is less on the self-made amino-coated glass, and the correct detection of miR399 can be performed.

[0160] Example 5. Detection of stress factors of tomatoes using diagnostic technology The miR399 of the tomato sample was detected using a detection device. A DNA probe was immobilized on an amino-introduced glass slide using a PDMS-made device with 10 flow paths (flow path width: 200 μm, flow path height: 20 μm) having a liquid injection port and a liquid suction port. For the glass slide on which the DNA was immobilized, a diagnosis device was prepared by mounting a PDMS-made device (detection PDMS-made device) having 12 flow paths (flow path width: 500 μm, flow path height: 20 μm) including a liquid injection port, a liquid suction port, and a flow path connecting them. By introducing a liquid into the injection port with a pipette, the liquid was sucked from the suction port with a syringe pump, whereby the introduction of the liquid into the flow path was performed.

[0161] (1) The same weight of 100 mM DTT / 90 mM Tris-HCl (pH 7.6) buffer was added to the true leaves of the tomato, and the mixture was crushed with a pestle.

[0162] (2) The tomato crushed liquid was centrifuged at 14,000 rpm at 4°C for 10 minutes, and the supernatant was recovered.

[0163] (3) The tomato supernatant was subjected to rough purification by passing through a filter (Nanosecp: MWCO 30K).

[0164] (4) A sample solution was prepared in a test tube (5 μl of the tomato rough purification sample, biotin-labeled DNA probe (CTCCTTTGGCA (SEQ ID NO: 3) - [biotin]) (0.4 μM), buffer (1x TE, 1x PBS), dithiothreitol (1 mM)).

[0165] (5) 10 μl of the sample solution was introduced into the flow path of the detection device, and hybridization was performed (pump: 0.3 μl / min, 30 minutes).

[0166] (6) Streptavindin Alexa Flour 555 conjugate, Thermo) (500x) was introduced into the flow path (pump: 1.5 μl / min, 15 minutes).

[0167] (7) The flow path was washed with a washing buffer (1x washing buffer (DIG Wash and Block Buffer Set, Roche)) (pump: 0.3 μl / min, 15 minutes).

[0168] (8) Biotinylated anti-streptavidin antibody (7.5 μg / ml) was introduced into the flow path (pump: 1.5 μl / min, 10 minutes).

[0169] (9) Introduce streptavindin-Alexa Flour 555 conjugate (Thermo Fisher Scientific) (500x) into the flow path (pump: 1.5 μl / min, 10 min).

[0170] (10) Clean the flow path with cleaning buffer (1 x cleaning buffer (DIG cleaning and blocking buffer kit, Roche)) (pump: 0.3 μl / min, 10 min).

[0171] (11) Signal amplification was achieved by introducing the above-mentioned biotinylated anti-streptavidin antibody, streptavidin-Alexa, and washing buffer five times.

[0172] Fluorescence images of the flow path chip were obtained using a fluorescence microscope.

[0173] (13) Quantify the fluorescence amount based on the fluorescence image (ImageJ image analysis software, National Institutes of Health).

[0174] exist Figure 10 The image shows the growth status of tomatoes that have undergone stress treatment. Tomatoes subjected to 7 days of stress treatment showed no difference in plant size compared to normally growing tomatoes, making it difficult to determine the stress level by appearance. Figure 11 The results of miR399 detection in these tomatoes using equipment are presented. Compared to tomatoes that underwent 7 days of normal growth, the brightness values ​​of tomato samples subjected to 7 days of stress treatment were significantly increased (Welch's t test: p<0.05). This result shows that miR399, which is highly expressed due to stress treatment, can be detected by diagnostic equipment. The same result was also shown in qRT-PCR used to detect miRNA. For tomatoes diagnosed as stressed, they were rescued from the stress environment by switching to normal growth conditions. After rescue treatment, tomatoes grown for 2 days were diagnosed. The results showed no significant difference in brightness values ​​compared to those under normal treatment; however, tomatoes subjected to continuous stress treatment showed significantly increased brightness values ​​(Welch's t test: p<0.05). This result shows that stopping the stress response by rescuing from stress treatment can be detected by diagnostic equipment. qRT-PCR also showed a decrease in miR399 expression levels after rescue. Tomatoes rescued from stress treatment after diagnosis had the same plant size as normally grown tomatoes after 14 days, while tomatoes subjected to continuous stress treatment for 14 days showed inhibited growth due to stress disorder. Figure 10 Thus, this technology can prevent stress disorders by detecting miR399 as a stress factor, and can be used as a simple diagnostic device for cultivation management.

[0175] Example 6. Simultaneous diagnosis of multiple items using multiple channels Using the present technology, in order to verify whether miRNAs other than miR399 can be detected, miRNAs of a tomato sample were detected using NHS-DNA probes of different sequences from miR399. When the DNA probes were solidified, simultaneous diagnosis of other targets was performed using a PDMS-made device including a flow path (flow path width: 200 μm, flow path height: 20 μm) having a liquid addition port and a liquid suction port. For the glass slide on which the DNA was solidified, a diagnosis device was fabricated by mounting a PDMS-made device (diagnosis-use PDMS-made device) including a flow path (flow path width: 200 μm, flow path height: 20 μm) having a liquid addition port, a liquid suction port, and a flow path connecting them.

[0176] (1) The 10-column DNA probe solidification-use PDMS device was mounted on the amino-introduced glass slide.

[0177] (2) 2 μM of NHS group-modified DNA probes (NHS-DNA-miR395: NHS- TTTTTTTTTTTTTTTGAGTCCCCC (SEQ ID NO: 4), NHS-DNA-miR164: NHS- TTTTTTTTTTTTTTTTGCACGTGCC (SEQ ID NO: 5), NHS-DNA-miR319: NHS- TTTTTTTTTTTTTTTAGGGAGCTCC (SEQ ID NO: 6), NHS-DNA-miR171: NHS- TTTTTTTTTTTTTTTTGATATTGGCG (SEQ ID NO: 7), NHS-DNA-miR168: NHS- TTTTTTTTTTTTTTTTTTCCCGACCT (SEQ ID NO: 8)), 50 mM of 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMT-MM), were prepared in 100 mM MOPS buffer (pH 7.0) and incubated overnight at 25 degrees. At this time, the region on the glass slide where the DNA probes were solidified was marked from the back of the glass slide using a marker pen.

[0178] (3) The DNA probe solidification-use PDMS device was immersed in a washing buffer (0.5xSSC, 0.1% SDS) in a state where it was peeled off, and the glass surface was washed. The washed glass was washed twice with ultrapure water, and excess water was removed using a hair dryer.

[0179] (4) The PDMS device for detection was mounted on the DNA probe solidified glass slide, and degassed for 15 minutes. At this time, the DNA probe solidification column was mounted in a manner orthogonal to the flow path of the PDMS device for detection, based on the pre-marked imprint before peeling.

[0180] (5) The blocking solution (1x blocking solution (DIG wash and block buffer set, Roche)) was introduced into the flow path, and incubated at room temperature for 60 minutes.

[0181] (6) The same weight of 100 mM DTT / 90 mM Tris-HCl (pH 7.6) buffer was added to the true leaves of the tomato, and crushed with a pestle.

[0182] (7) The tomato crushed solution was centrifuged at 14,000 rpm and 4°C for 10 minutes, and the supernatant was recovered.

[0183] (8) The tomato supernatant was subjected to rough purification by a filter (Nanosecp: MWCO 30K).

[0184] (9) The sample solution was prepared in a test tube (5 μl of tomato rough purification sample, biotin-labeled DNA probe (CTCCTTTGGCA (SEQ ID NO: 3) - [biotin]) (0.4 μM), buffer (1x TE, 1x PBS), dithiothreitol (1 mM)).

[0185] (10) 10 μl of the sample solution was introduced into the flow path of the detection device, and hybridization was performed (pump: 0.3 μl / min, 30 minutes).

[0186] (11) Streptavindin Alexa Flour 555 conjugate, Thermo) (500x) was introduced into the flow path (pump: 1.5 μl / min, 15 minutes).

[0187] (12) The flow path was washed with a washing buffer (1x washing buffer (DIG wash and block buffer set, Roche)) (pump: 0.3 μl / min, 15 minutes).

[0188] (13) Biotinylated anti-streptavidin antibody (7.5 μg / ml) was introduced into the flow path (pump: 1.5 μl / min, 10 minutes).

[0189] (14) Streptavindin Alexa Flour 555 conjugate, Thermo) (500x) was introduced into the flow path (pump: 1.5 μl / min, 10 minutes).

[0190] (15) The flow path was washed with a washing buffer (1x washing buffer (DIG wash and block buffer set, Roche)) (pump: 0.3 μl / min, 10 minutes).

[0191] (16) Signal amplification was performed by performing the introduction of the biotinylated anti-streptavidin antibody, streptavidin-Alexa, and washing buffer 5 times.

[0192] A fluorescent image of the flow path chip was obtained using a fluorescence microscope.

[0193] (18) The amount of fluorescence was quantified from the fluorescent image (image analysis software ImageJ, National Institutes of Health, USA).

[0194] In Figure 12 The results of signal detection by the diagnostic device for the sample subjected to the treatment for expressing each miRNA with respect to the tomato are shown. The signal of the tomato subjected to the stress treatment was significantly increased as compared with the tomato not subjected to the treatment (Welch's t test: p<0.05). In fact, the expression amount of these target miRNAs was investigated by qRT-PCR, and it was found that the expression amount of all the target miRNAs was significantly increased (Welch's t test: p<0.05) (FIG. 6). Figure 13 Thus, it was shown that the present technology can also detect targets other than miR399.

Claims

1. A nucleic acid detection chip characterized by comprising: an inorganic substrate; and a nucleic acid probe, wherein (x) the nucleic acid probe is linked via an amino group linked to the inorganic substrate; and / or (y) the nucleic acid probe is linked by an amide bond of a nucleic acid probe having a reactive ester group or a carboxyl group via an amino group linked to the inorganic substrate.

2. The nucleic acid detection chip according to claim 1, wherein (xl) a group represented by general formula (xl) is bound to the inorganic substrate; and / or (yl) a group represented by general formula (yl) is bound to the inorganic substrate.

3. The nucleic acid detection chip according to claim 1, wherein (xy) the nucleic acid probe is linked by an amide bond of a nucleic acid probe having a reactive ester group or a carboxyl group via an amino group linked to the inorganic substrate.

4. The nucleic acid detection chip according to claim 3, wherein (xyl) a group represented by general formula (xyl) is bound to the inorganic substrate.

5. The nucleic acid detection chip according to claim 4, wherein 6. The nucleic acid detection chip according to claim 1, wherein the nucleic acid probe is an mRNA and / or miRNA detection probe.

7. The nucleic acid detection chip according to claim 1, comprising: (A) a sample injection portion; and (C) a flow path linked to the sample injection portion A and having a nucleic acid probe immobilization region. In formula (x1), R 1 and R 2 are the same or different and represent an alkyl group, a hydrogen atom, an alkoxy group, a halogen atom, a bonding portion to a silane coupling agent, or a bonding portion to an inorganic base material, R 3 represents a linking group, R 4A represents an oxygen atom or a single bond, L 1 represents a linking group, and Probe represents a nucleic acid probe, and * represents a bonding portion to an inorganic base material. In formula (y1), L 2 represents a linking group, Probe represents a nucleic acid probe, and * represents a binding portion to an inorganic substrate.

8. The nucleic acid detection chip according to claim 1, wherein the nucleic acid detection chip is used for detection of a plant nucleic acid.

9. A method for detecting a plant nucleic acid, comprising: (a) a step of bringing a plant sample into contact with the nucleic acid detection chip according to any one of claims 1 to 8; (b) a step of detecting a signal on the nucleic acid probe; and (c) a step of determining a state of the plant based on a value of the signal.

10. A method for detecting a plant nucleic acid, comprising: (a) a step of bringing a plant sample into contact with the nucleic acid detection chip according to any one of claims 1 to 8; (b) a step of detecting a signal on the nucleic acid probe; (c) a step of determining a state of the plant based on a value of the signal; and (d) a step of adjusting a cultivation condition of the plant based on a result of the determination.

11. A method for producing a nucleic acid detection chip, comprising: (X) a step of reacting an inorganic substrate with a silane coupling agent; and / or (Y) a step of reacting an amino group linked to the inorganic substrate with a nucleic acid probe having a reactive ester group or a carboxyl group. In formula (xy1), R 1 and R 2 are the same or different and represent an alkyl group, a hydrogen atom, an alkoxy group, a halogen atom, a bonding portion to a silane coupling agent, or a bonding portion to an inorganic base material, R 3 represents a linking group, R 4A represents an oxygen atom or a single bond, Probe represents a nucleic acid probe, and * represents a bonding portion to an inorganic base material. ​ R 1 and R 2 are identical or different, and represent alkyl. ​ ​ 7. The chip for nucleic acid detection according to claim 1, wherein ​ ​ ​ ​ ​ 9. A method for determining the state of a plant, characterized by, ​ ​ ​ ​ ​ 10. A method for cultivating a plant, characterized by, ​ ​ ​ ​ ​ ​ 11. A method for manufacturing the nucleic acid detecting chip according to any one of claims 1 to 8, characterized by, ​ ​ ​

Citation Information

Patent Citations

  • Channel chip for plant substance detection, and plant substance detection device

    JP2021065112A