Wheat taheat s1 protein and application of the coding gene in regulating wheat heat tolerance

By inhibiting or knocking out the TaHeatS1 gene using genetic engineering techniques and constructing recombinant expression vectors using the CRISPR/Cas9 system, the heat resistance of wheat was improved, solving the problem of wheat's sensitivity to high-temperature stress and enhancing the heat resistance of wheat varieties.

CN120923599BActive Publication Date: 2026-01-27CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511460993.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-14
Publication Date
2026-01-27
Estimated Expiration
2045-10-14

AI Technical Summary

Technical Problem

Wheat is sensitive to high temperature stress, especially during the flowering and grain-filling stages, which leads to inhibited photosynthesis, poor grain filling, and reduced yield and quality. Current technologies lack effective methods for screening and breeding heat-resistant genes.

Method used

By using genetic engineering techniques, the expression of the TaHeatS1 gene was suppressed or knocked out. A recombinant expression vector was constructed using the CRISPR/Cas9 system, introduced into Agrobacterium tumefaciens, and used to infect wheat embryogenic callus tissue. Heat-resistant plants were obtained through differentiation culture.

Benefits of technology

It significantly improves the heat resistance of wheat and enhances its resistance to high-temperature stress, providing a theoretical basis and practical application for breeding heat-resistant varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120923599B_ABST
    Figure CN120923599B_ABST
Patent Text Reader

Abstract

The application discloses a wheat TaHeatS1 (Heat Sensitivity 1) protein, a coding gene and application in regulating heat resistance of wheat, wherein the TaHeatS1 protein is derived from wheat (Triticum aestivum L.). Triticum aestivum The gene coding the TaHeatS1 protein is named as TaHeatS1 gene. TaHeatS1 The application inhibits expression of the TaHeatS1 gene through a genetic engineering technology, thereby significantly improving heat resistance of the wheat. TaHeatS1 The application has important significance for plant heat resistance research and breeding of high-temperature-resistant wheat, and can be used as an important index for future plant breeding and selection of excellent varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of wheat breeding technology, and relates to the wheat TaHeatS1 protein, its encoding gene, and its application in regulating wheat heat tolerance. Background Technology

[0002] Wheat is one of the world's most important food crops, accounting for more than 20% of global dietary energy supply, and is of great significance to human survival and development.

[0003] Wheat, a crop that thrives in cool climates, is extremely sensitive to heat stress, especially during the flowering and grain-filling stages. Heat stress can inhibit photosynthesis, lead to poor grain filling, and significantly reduce yield and quality. Statistics show that for every 1°C increase in global temperature, wheat production may decrease by approximately 6%, posing a serious threat to food security.

[0004] Screening and breeding heat-resistant wheat varieties is crucial. In-depth research on the heat-resistant genes and molecular mechanisms of wheat will not only provide a theoretical basis for the breeding of heat-resistant varieties, but will also open up new avenues for addressing the challenges of climate change and ensuring food security. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide the wheat TaHeatS1 protein, the encoding gene, and its application in regulating wheat heat tolerance.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] 1. Wheat TaHeatS1 (Heat Sensitivity 1) protein, selected from any of the following:

[0008] (a1) A protein with the amino acid sequence shown in SEQ ID NO.1;

[0009] (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1).

[0010] As one of the preferred technical solutions, the tags mentioned in (a2) are Flag tags, His tags, MBP tags, HA tags, myc tags, GST tags and / or SUMO tags.

[0011] 2. Genes encoding the aforementioned proteins TaHeatS1 Choose from any of the following:

[0012] (b1) A DNA molecule with a coding region as shown in SEQ ID NO.2;

[0013] (b2) DNA molecules with nucleotide sequences as shown in SEQ ID NO.3.

[0014] (b3) A DNA molecule that hybridizes under stringent conditions with the DNA molecules defined in (b1) and / or (b2) and encodes the protein therein.

[0015] 3. Targeted knockout TaHeatS1 A recombinant expression vector for a gene, wherein the recombinant expression vector contains a targeted knockout gene. TaHeatS1 The sgRNA of a gene.

[0016] 4. The aforementioned method for constructing recombinant expression vectors allows for the design of any targeting vector on the sequence shown in SEQ ID NO.2. TaHeatS1 The single-stranded guide RNA (sgRNA) of the gene was used to construct a knockout wheat genome containing this sgRNA. TaHeatS1 The plant binary expression vector for the gene PUbi414- TaHeatS1 .

[0017] As one of the preferred technical solutions, the specific steps are as follows:

[0018] (1) Design using online software E-CRISPR (http: / / www.e-crisp.org / E-CRISP / ) TaHeatS1 Knockout target primer pairs were selected, and BLAST was performed using Plants ensembl (http: / / plants.ensembl.org / index.html) to select specific target sites for knockout. TaHeatS1 Gene;

[0019] (2) The target primers are linked to the wheat U6 promoter to form an sgRNA expression cassette; this promoter drives the expression of the CRISPR / Cas9 system, ensuring the correct guidance of the primers;

[0020] (3) Prepare PUbi414 plasmid: Prepare a plasmid suitable for the CRISPR / Cas9 system, which includes Cas9 protein and corresponding RNA components;

[0021] (4) Restriction endonuclease digestion: The sgRNA expression cassette and PUbi414 plasmid were digested with restriction endonucleases respectively so that they could be ligated together;

[0022] (5) Ligation: The enzyme-digested sgRNA expression cassette was ligated to the PUbi414 plasmid to form PUbi414- TaHeatS1 Knock out the expression vector.

[0023] Construction method references: Kumar, R., Mamrutha, HM, Kaur, A., Venkatesh, K., Sharma, D., & Singh, GP (2019). Optimization of Agrobacterium-mediated transformation in spring bread wheat using mature and immature embryos. Molecular biology reports, 46(2), 1845–1853.

[0024] As one of the further preferred technical solutions, step (1) is described TaHeatS1 The sgRNA primer pairs for the gene are as follows:

[0025] TaHeatS1 -414F: 5′-GACGAGGTGCAGAACCATCTGGG-3′, as shown in SEQ ID NO.6;

[0026] TaHeatS1 -414R: 5′-GATGACACTCGAGGATTTCTTGG-3′, as shown in SEQ ID NO.7.

[0027] 5. The recombinant bacteria that inhibit TaHeatS1 protein expression were obtained by introducing the aforementioned recombinant expression vector into Agrobacterium tumefaciens.

[0028] 6. The aforementioned TaHeatS1 protein or TaHeatS1 Application of genes in regulating wheat heat tolerance.

[0029] As one of the preferred technical solutions, this involves inhibiting or knocking out TaHeatS1 protein expression. TaHeatS1 Genes enhance wheat's heat resistance.

[0030] 7. Application of the aforementioned recombinant expression vectors or recombinant bacteria in the breeding of heat-resistant wheat varieties.

[0031] 8. A method for breeding heat-resistant wheat, comprising constructing the aforementioned recombinant expression vector, introducing Agrobacterium tumefaciens into it to obtain recombinant Agrobacterium, using the recombinant Agrobacterium to infect wheat embryogenic callus, differentiating and culturing, rooting culture, resistance screening, obtaining T0 generation regenerated plants, and obtaining offspring through self-pollination.

[0032] The beneficial effects of this invention are as follows:

[0033] This invention discloses the wheat TaHeatS1 protein, its encoding gene, and its application in regulating wheat heat tolerance. The TaHeatS1 protein is derived from wheat (…). Wheat L.). The gene encoding the TaHeatS1 protein also falls within the scope of protection of this invention. The gene encoding the TaHeatS1 protein is named... TaHeatS1 Genes. This invention protects the use of gene editing to knock out genes. TaHeatS1 The method.

[0034] This invention uses genetic engineering technology to inhibit TaHeatS1 Gene expression significantly improves the heat resistance of wheat. This invention further enhances or improves [the heat resistance] through genetic engineering technology. TaHeatS1 Protein activity and / or TaHeatS1 The expression levels of the encoding gene were analyzed, and it was found that the heat tolerance of wheat was significantly reduced, confirming that... TaHeatS1 The regulatory role of genes in wheat heat tolerance. Therefore, this invention is of great significance for research on plant heat tolerance and the breeding of heat-resistant wheat, and can serve as an important indicator for future plant breeding and selection of superior varieties. Attached Figure Description

[0035] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the following figures are provided for illustration:

[0036] Figure 1 This is a comparison diagram of sequencing results for transgenic plants.

[0037] Figure 2 These are phenotypic photographs of the heat-treated transgenic plants. From left to right in the image, they are Fielder control wheat, ... TaHeatS1 Knockout strains TaHeatS1、TaHeatS1 Overexpression lines TaHeatS1-OE .

[0038] Figure 3 The survival rate statistics for the heat-treated group are shown; * indicates p≤0.05.

[0039] Figure 4 This is a schematic diagram of the pWMB110 carrier.

[0040] Figure 5 The results show the relative transcription levels in transgenic plants; * indicates p≤0.05. Detailed Implementation

[0041] The preferred embodiments of the present invention will now be described in detail with reference to the accompanying drawings.

[0042] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores. Unless otherwise specified, the quantitative experiments in the following examples were all performed in triplicate, and the results were averaged. Example 1

[0043] I. Discovery of TaHeatS1 protein and its encoding gene

[0044] A novel protein was discovered in the roots of *Fielder* wheat grown hydroponically for 8 days. Its amino acid sequence is shown in SEQ ID NO. 1, and it has been named TaHeatS1 protein. The gene encoding TaHeatS1 protein has been named. TaHeatS1 Genes. In the cDNA of wheat Fielder, TaHeatS1 The coding sequence of the gene is shown in SEQ ID NO.2.

[0045] II. Construction of Recombinant Plasmids

[0046] Reference "Optimization of Agrobacterium-mediated transformation inspring bread wheat using mature and immature embryos" (Kumar R, Mamrutha HM, Kaur A, Venkatesh K, Sharma D, Singh GP. 2019, Molecular Biology Reports 46:1845-1853), will TaHeatS1 The sgRNA of the gene was linked to the wheat U6 promoter to form an sgRNA expression cassette; the sgRNA expression cassette was then linked to the PUbi414 plasmid (Shanghai Kelei Biotechnology Co., Ltd.) to obtain the recombinant plasmid PUbi414-TaHeatS1. The recombinant plasmid PUbi414-TaHeatS1 has been sequenced and verified.

[0047] TaHeatS1 The sgRNA primer pairs for the gene are as follows:

[0048] TaHeatS1 -414F: 5′-GACGAGGTGCAGAACCATCTGGG- 3′, as shown in SEQ ID NO.6;

[0049] TaHeatS1 -414R: 5′-GATGACACTCGAGGATTTCTTGG- 3′, as shown in SEQ ID NO.7.

[0050] III. Preparation of Transgenic Plants

[0051] 1. The recombinant plasmid PUbi414-TaHeatS1 was introduced into Agrobacterium tumefaciens EHA105 (WEIDI, CAT#:AC1013) to obtain recombinant Agrobacterium.

[0052] 2. The recombinant Agrobacterium obtained in step 1 was used to infect the embryogenic callus of wheat Fielder, and then differentiation culture, rooting culture and herbicide resistance screening (screening concentration of 250 mg / L) were carried out in sequence to obtain 4 T0 generation regenerated plants.

[0053] 3. The four T0 generation regenerated plants obtained in step 2 were identified by sequencing of the sgRNA knockout target sites. TaHeatS1 The status of gene editing.

[0054] (1) Take plant leaves and extract DNA.

[0055] (2) Using DNA as a template, the amplified products were sequenced for verification.

[0056] Used for identification TaHeatS1-A The primer pairs for the gene (homologous gene in genome A) are as follows:

[0057] TaHeatS1-A F: 5′-TTACACCGCACTGACCCCC-3′, as shown in SEQ ID NO.8;

[0058] TaHeatS1-A R: 5′-CATACCCATACACCGGAAGG- 3′, as shown in SEQ ID NO.9.

[0059] TaHeatS1-B Gene coding regions, such as SEQ ID NO.4, are used for identification. TaHeatS1-B The primer pairs for the genes (homologous genes in the B genome) are as follows:

[0060] TaHeatS1-B F: 5′-TGGTTCAGTCAGATCCATCG-3′, as shown in SEQ ID NO.10;

[0061] TaHeatS1-B R: 5′-ACCTGCCAATACGAGCAATC-3′, as shown in SEQ ID NO.11.

[0062] TaHeatS1-D Gene coding regions, such as SEQ ID NO.5, are used for identification. TaHeatS1-D The primer pairs for the genes (homologous genes in the D genome) are as follows:

[0063] TaHeatS1-D F: 5′-CGAGCTTGTTTTCACCCAGT-3′, as shown in SEQ ID NO.12;

[0064] TaHeatS1-D R: 5′-TGCAGCATTTTGGTAAACTTG-3′, as shown in SEQ ID NO.13.

[0065] PCR reaction system (10 μl): 2×Mix 5 μl, primer F (2 μM) 1 μl, primer R (2 μM) 1 μl, DNA template 1 μl, ddH2O 2 μl.

[0066] PCR reaction procedure: 94 o C pre-denaturation for 5 min; 94 o C 20s, 58 o C 20s, 72 o C 30s, 35 cycles; 72℃ 5min; 12℃ 5min.

[0067] The amplified products were sequenced for verification, and the sequencing results were analyzed using SnapGene software. Results are shown below. Figure 1 , Figure 1 Two were shown in the middle. TaHeatS1 Transgenic lines ( TaHeatS1-6 and TaHeatS1-8 Editing status.

[0068] 4. Produce offspring through self-fertilization.

[0069] Transgenic plants are self-pollinated to obtain seeds, which are designated as T1 generation seeds. Plants grown from T1 generation seeds are designated as T1 generation plants. T1 generation plants are self-pollinated to obtain seeds, which are designated as T2 generation seeds. Plants grown from T2 generation seeds are designated as T2 generation plants. DNA is extracted from leaves of T2 generation plants for PCR identification. If a T2 generation plant is identified as a positive transgenic plant by PCR sequencing, that T2 generation plant and its offspring constitute a homozygous transgenic line.

[0070] Two transgenic lines were randomly selected ( TaHeatS1-6 and TaHeatS1-8 Then proceed to step four for identification.

[0071] IV. Phenotypic Assessment of Resistance to (High Temperature) Heat Stress

[0072] Seeds tested: TaHeatS1-6 T3 generation seeds of the series TaHeatS1-8 T3 generation seeds, wheat Fielder seeds.

[0073] Culture conditions: 22℃, 16h light / 8h darkness.

[0074] (1) Take the test seeds, soak them in a 1% sodium hypochlorite aqueous solution for 15 minutes for disinfection, and then wash them 6 times with distilled water.

[0075] (2) Take the seeds from step (1) and place them at 4°C in the dark for 3 days.

[0076] (3) Take the seeds from step (2) and cultivate them until the seedlings germinate for 2 days.

[0077] (4) Take seedlings with uniform growth and transfer them to rectangular culture pots (28cm*21cm*9cm). Sow 108 seeds in each pot. After 7 days of cultivation, transfer them to a 42℃ incubator for 6 days, then transfer them to a 20℃ incubator for a week to recover. The survival rate is then calculated. The results show that after treatment at 42℃, TaHeatS1 Compared to wild-type Fielder, the knockout material showed more upright growth, less wilting, less wilting and yellowing of leaves, and more upright stems. Figure 2 ), resulting in a higher plant survival rate ( Figure 3 It exhibits a better phenotype for (high temperature) heat stress.

[0078] Therefore, the results show that knockout TaHeatS1 The gene can significantly enhance wheat's resistance to heat (high temperature) stress and can be applied to plant heat tolerance breeding and variety improvement. Example 2

[0079] I. Heat-resistant genes in wheat TaHeatS1 Cloning

[0080] In this example, the wheat variety *Chinese Spring* was selected as the amplification template because it was the first wheat variety to complete sequencing assembly. *Chinese Spring* seeds were placed on germination paper and cultured for 7 days to obtain wheat seedlings. The seedlings were then sampled, frozen in liquid nitrogen, and ground. RNA was extracted using the Trizol method, and cDNA was obtained by reverse transcription using the RNA as a template. The cDNA obtained in the previous step was then used as a template for PCR amplification.

[0081] For amplification TaHeatS1 The primer pairs for the gene are as follows:

[0082] TaHeatS1 F:5′-TTACACCGCACTGACCCCC-3′, as shown in SEQ ID NO.14;

[0083] TaHeatS1 R:5′-ACGATTCTAAACCGAAGAGGC-3′, as shown in SEQ ID NO.15.

[0084] The PCR reaction program was as follows: 94℃ for 3 min pre-denaturation; 98℃ for 10 s, 58℃ for 15 s, 68℃ for 40 s, 35 cycles; 68℃ for 5 min extension. The PCR product was ligated into a blunt-terminated T-vector for sequencing to obtain the T-TaHeatS1 vector.

[0085] The embodiment used TaHeatS1 The gene overexpression vector is the recombinant plasmid pWMB110-TaHeatS1-MYC. pWMB110-TaHeatS1-MYC is a recombinant vector obtained by adding the MYC fusion tag gene to the pWMB110-MYC vector (pWMB110-MYC is a specific overexpression transformation vector pWMB110 used in wheat transformation). Figure 4 Related literature: Yanan Chang, Junxian Liu, Chang Liu, Huiyun Liu, Huali Tang, Yuliang Qiu, Zhishan Lin, KeWang, Yueming Yan, Xingguo Ye. (2024). Establishment of a transformation system in close relatives of wheat under the assistance of TaWOX5. Journal of Integrative Agriculture, 23(6), 1839-1849. https: / / doi.org / 10.1016 / j.jia.2023.06.021) The nucleotide sequence inserted at the BamHⅠ site is SEQ ID NO.2 in the sequence listing. The recombinant vector obtained by keeping the other nucleotide sequences of the pWMB110 vector unchanged is as follows. The specific construction method of pWMB110-TaHeatS1-MYC is as follows.

[0086] II. Wheat heat resistance genes TaHeatS1 Construction of expression carrier

[0087] Using the correctly sequenced T-TaHeatS1 vector as a template, primers...

[0088] pWMB110-TaHeatS1-F:5′- AGGTCGACTCTAGAGGATCC ATGGGGAGTCGGAAAATGGC-3′, as shown in SEQ ID NO.16;

[0089] pWMB110-TaHeatS1-R:5′- AGCTCGGTACCCGGGGATCCCGAAAGCGGCCGAGCATGTTC-3′, as shown in SEQ ID NO.17.

[0090] PCR amplification was performed (the underlined part of the primers indicates the vector ligation sequence). The amplified product was then purified by gel extraction (Zhuangmeng Microcolumn Concentrated DNA Gel Extraction Kit ZPV202) to obtain the purified PCR product, which was used for subsequent ligation.

[0091] The vector pWMB110-MYC, which links the ubiquitin promoter of maize, was digested with the restriction endonuclease BamHI. The digested vector product and the PCR product were then ligated (ligation conditions: 50℃, 20 min) to obtain the recombinant plasmid. The recombinant plasmid was sequenced to verify that the primers were universal primers for the pWMB110 vector.

[0092] Ubi-F:5′-TTTAGCCCTGCCTTCATACGC-3′, as shown in SEQ ID NO.18;

[0093] Tnos-R:5′-AGACCGGCAACAGGATTCAATC-3′, as shown in SEQ ID NO.19.

[0094] A positive recombinant plasmid pWMB110-TaHeatS1-MYC containing the TaHeatS1 gene was obtained. The recombinant vector plasmid pWMB110-TaHeatS1-MYC contains the CDS sequence of TaHeatS1 shown in SEQ ID NO.2 of the sequence listing and can express the TaHeatS1 protein shown in SEQ ID NO.1 of the sequence listing.

[0095] III. Obtaining and Phenotypic Observation of Transgenic Plants

[0096] 1. The recombinant plasmid pWMB110-TaHeatS1-MYC was transformed into Agrobacterium EHA105 (WEIDI, CAT#:AC1013). The transformation method for plants was Agrobacterium-mediated transformation. The selection marker in plants was Bar. 1 μg of the recombinant vector plasmid pWMB110-TaHeatS1-MYC prepared in Example 2 was used to transform competent cells of Agrobacterium EHA105. The cells were cultured at 28°C on LB medium (containing 50 mg / L kanamycin and 25 mg / L rifampin) for two days. Positive clones were selected.

[0097] 2. PCR identification was performed using primers Ubi-F and Tnos-R. The positive bacterial culture obtained by PCR identification was named recombinant Agrobacterium EHA105 / pWMB110-TaHeatS1-MYC and stored at -80℃.

[0098] 3. The recombinant Agrobacterium obtained in step 1 was used to infect the embryogenic callus of wheat Fielder. Following the wheat transformation method described by Hayta et al. (Related literature: Hayta, S., Smedley, MA, Clarke, M., Forner, M., and Harwood, WA. (2021). An efficient Agrobacterium-mediated transformation protocol for hexaploid and tetraploid wheat. Curr. Protoc. 1:e58), differentiation culture, rooting culture, and herbicide resistance screening (screening concentration of 250 mg / L) were performed sequentially to obtain 6 T0 generation regenerated plants.

[0099] T0 generation positive transgenic overexpressing wheat was planted and harvested to obtain T1 generation transgenic overexpressing wheat seeds, which were then planted to obtain T1 generation individual plants. These T1 generation individual plants were also identified by PCR using primers for the Bar gene detection, yielding positive T1 generation individual plants. Seeds from these positive T1 generation individual plants were harvested and further tested to obtain two T2 generation positive transgenic wheat homozygous lines. These T2 generation individual plants were also identified by PCR using primers for the Bar gene detection, yielding positive T2 generation individual plants. Seeds from these positive T2 generation individual plants were harvested and further tested to obtain two T3 generation positive transgenic wheat homozygous lines. TaHeatS1-OE3 , TaHeatS1-OE5 .

[0100] 4. TaHeatS1 Transgenic expression level detection

[0101] right TaHeatS1 Transgenic T3 generation overexpression wheat lines ( TaHeatS1-OE3 and TaHeatS1-OE5 )middle TaHeatS1 Gene expression levels were detected.

[0102] The experiment was set up in triplicate. Each replicate was configured as follows: Total RNA was extracted from leaves of two transgenic overexpression lines and wild-type (WT) wheat Fielder, reverse transcribed into cDNA, and detected using Real-time RT-PCR with wheat-actin as an internal control gene. TaHeatS1 Relative gene expression levels. Primer sequences are as follows:

[0103] q TaHeatS1-F: 5′-TTGAACTCGGCACATACTGG-3′, as shown in SEQ ID NO.20;

[0104] q TaHeatS1-R: 5′-GTGCAGAACCATCTGGGAGA- 3′, as shown in SEQ ID NO.21.

[0105] The primer pair used to detect the internal reference gene (wheat-actin gene) is as follows:

[0106] q wheat-actin-F: 5′-GGAATCCATGAGACCACCTAC-3′, as shown in SEQ ID NO.22;

[0107] q wheat-actin-R: 5′-GACCCAGACAACTCGCAAC-3′, as shown in SEQ ID NO.23.

[0108] The reaction system for real-time quantitative PCR (10 μl) is as follows: 5 μl of 2× Green Master Mix, 1 μl of primer F (2 μM), 1 μl of primer R (2 μM), 1 μl of cDNA template, and 2 μl of ddH2O.

[0109] Real-time quantitative PCR reaction procedure: 94 o C pre-denaturation for 5 min; 94 o C 20s, 60 o C 20s, 72 o C 25s, 40 cycles; 72℃ 5min; 60℃-95℃ o C. Read the plate and record the melting curve every 0.2℃.

[0110] C = 2 -△CT ΔCt =Ct 目标基因 –Ct 内参基因 The average C-value of the three replicates was calculated as the relative expression level of the target gene. One-way ANOVA and Tukey's HSD test were used for significance testing (p < 0.05). Results are shown in [Figure number missing]. Figure 5 .

[0111] IV. Phenotypic Assessment of Resistance to (High Temperature) Heat Stress

[0112] Seeds tested: TaHeatS1-OE3 T3 generation seeds of the series TaHeatS1-OE5 T3 generation seeds, wheat Fielder seeds.

[0113] Culture conditions: 22℃, 16h light / 8h darkness.

[0114] (1) Take the test seeds, soak them in a 1% sodium hypochlorite aqueous solution for 15 minutes for disinfection, and then wash them 6 times with distilled water.

[0115] (2) Take the seeds from step (1) and place them at 4°C in the dark for 3 days.

[0116] (3) Take the seeds from step (2) and cultivate them until the seedlings germinate for 2 days.

[0117] (4) Take seedlings with uniform growth and transfer them to rectangular culture pots (30cm*24cm*15cm). Sow 120 seeds in each pot. After 7 days of cultivation, transfer them to a 42℃ incubator for 6 days, then transfer them again to a 20℃ incubator for one week to recover. The survival rate is then calculated. The results show that after treatment at 42℃, TaHeatS1 Compared to wild-type Fielder, the overexpression material exhibited more wilting, with more wilting and yellowing of leaves, and more stem wilting. Figure 2 The plant survival rate is even lower. Figure 3 The expression of these cells exhibited a worse phenotype in terms of tolerance to (high-temperature) heat stress. The results indicated that overexpression... TaHeatS1 The gene can significantly reduce the wheat's resistance to heat (high temperature) stress.

[0118] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made to it in form and detail without departing from the scope defined by the claims of the present invention.

Claims

1. TaHeatS1 protein or TaHeatS1 The application of genes in regulating wheat heat tolerance is characterized by, By inhibiting or knocking out TaHeatS1 protein expression TaHeatS1 Genes enhance wheat heat resistance; The wheat TaHeatS1 protein is selected from any of the following: (a1) A protein with the amino acid sequence shown in SEQ ID NO.1; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1); Gene encoding wheat TaHeatS1 protein TaHeatS1 Choose from any of the following: (b1) A DNA molecule with a coding region as shown in SEQ ID NO.2; (b2) DNA molecules with nucleotide sequences as shown in SEQ ID NO.

3.

2. The application of recombinant expression vectors or recombinant bacteria in the breeding of heat-resistant wheat varieties, characterized in that, The recombinant expression vector contains targeted knockout TaHeatS1 The sgRNA of the gene, as described TaHeatS1 Genes, selected from any of the following: (b1) A DNA molecule with a coding region as shown in SEQ ID NO.2; (b2) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO.3; The recombinant bacteria is a recombinant bacteria that inhibits the expression of TaHeatS1 protein according to claim 1, and is obtained by introducing the recombinant expression vector into Agrobacterium tumefaciens.

3. A method for breeding heat-resistant wheat, characterized in that, A recombinant expression vector was constructed and Agrobacterium tumefaciens was introduced to obtain recombinant Agrobacterium. This recombinant Agrobacterium was used to infect wheat embryogenic callus, followed by differentiation culture, rooting culture, and resistance screening to obtain T0 generation regenerated plants. Progeny were obtained through self-pollination. The recombinant expression vector contains targeted knockout TaHeatS1 The sgRNA of the gene, as described TaHeatS1 Genes, selected from any of the following: (b1) A DNA molecule with a coding region as shown in SEQ ID NO.2; (b2) DNA molecules with nucleotide sequences as shown in SEQ ID NO.3.