Construction method and application of genetically engineered bacteria for synthesizing polylactic acid

Abstract

The application discloses a method for synthesizing polylactic acid (PLA), lactic acid and 3-hydroxybutyric acid copolymer (PLA3HB) with high lactic acid mole ratio, lactic acid and 4-hydroxybutyric acid copolymer (PLA4HB) by using genetically engineered bacteria and application thereof. Specifically, the recombinant strain is constructed by the following steps: firstly, the pct-phaC1 gene is integrated into the genome of Vibrio halpernii TGB4, and four endogenous lactic acid dehydrogenase genes (dld, ldhA, lldd1 and lldd2) are knocked out respectively; then, on the basis of the dld gene knockout, four endogenous acetoacetyl-CoA reductase genes (phaB1, phaB2, phaB3 and phaB4) are further knocked out, and the lactic acid monomer content in the PLA3HB synthesized by the obtained recombinant strain is as high as 90.21 mol%; finally, through the knockout of the lldd1 gene, the synthesis of pure PLA is successfully realized. This is the first time to realize the synthesis of PLA3HB, PLA4HB with high lactic acid mole ratio and pure PLA in Vibrio halpernii, which shows a good application prospect and provides a new technical route for the industrialized production of bio-based materials.

Description

Technical Field

[0001] This invention belongs to the fields of biotechnology, genetic engineering and fermentation engineering, and particularly relates to a genetically engineered bacterium of Vibrio salinae that uses lactic acid to prepare polylactic acid, lactic acid and 3-hydroxybutyrate copolyesters with a high lactic acid molar ratio, and lactic acid and 4-hydroxybutyrate copolyesters, as well as its construction method and application. Background Technology

[0002] Polylactic acid (PLA), as the most commercially available biodegradable polyester material, has been widely used in medical devices, food packaging, and textile fibers due to its excellent biocompatibility, processability, and compostability. By copolymerizing lactic acid monomers with 3-hydroxybutyrate (3HB) or 4-hydroxybutyrate (4HB), the material's toughness can be effectively improved while maintaining its biodegradability.

[0003] However, existing technologies still face the following key technical challenges:

[0004] In terms of chemical synthesis: (1) Tin-based compounds (such as stannous octoate), organometallic compounds, or other highly toxic catalysts are usually required. These substances may remain in the final product, affecting the biocompatibility of the material and limiting its application in fields such as medical and food packaging. (2) Chemical synthesis usually needs to be carried out at high temperature, high vacuum, or inert atmosphere, which consumes a lot of energy and has strict requirements for equipment, increasing production costs. (3) Lactic acid monomers need to be highly purified (such as optically pure L- or D-lactic acid), otherwise it will affect the crystallinity and mechanical properties of the polymer, and the preparation cost of high-purity lactic acid is high. (4) When synthesizing copolymers of lactic acid with 3-hydroxybutyric acid or 4-hydroxybutyric acid, it is difficult to accurately control the monomer ratio by chemical methods, which affects the material properties.

[0005] In terms of biosynthesis: (1) Due to the metabolic regulation mechanism of natural strains, the proportion of lactic acid units in copolymers synthesized by microbial methods is usually less than 50%, which seriously restricts the optimization space of material properties. (2) There are currently no articles published on the efficient biosynthesis of polylactic acid (fermentation yield >10g / L).

[0006] Currently, the main bottlenecks in the biosynthesis of polylactic acid or high lactic acid copolyesters are: (1) metabolic competition between lactic acid and 3-hydroxybutyric acid or 4-hydroxybutyric acid monomers. In most strains, lactic acid is preferentially utilized and can enter the tricarboxylic acid cycle for energy, rather than serving as a substrate for polyhydroxy fatty acid ester synthase (PHA synthase, PhaC), resulting in the difficulty of efficiently integrating lactic acid units into the polymer chain. (2) The synthesis pathway of 3-hydroxybutyric acid or 4-hydroxybutyric acid monomers is dominant, and their significant metabolic advantage further reduces the polymerization efficiency of lactic acid monomers and the proportion of lactic acid polymerization. (3) Traditional metabolic engineering modification strategies, such as knocking out lactate dehydrogenase or blocking the synthesis of 3-hydroxybutyric acid or 4-hydroxybutyric acid monomers, can partially increase the proportion of lactic acid, but often lead to metabolic imbalance and growth restriction in strains.

[0007] Salinivibrio kushneri TGB4, a halophilic bacterium, can grow in high-salt environments and efficiently utilize various carbon sources. This strain has been shown to synthesize polyhydroxyalkanoates (PHAs) from volatile fatty acids. This strain is deposited at the China General Microbiological Culture Collection Center (CGMCC) under the Budapest Treaty, with accession number CGMCC No. 21105, and has been published in CN113265356B. Summary of the Invention

[0008] This invention develops a novel fermentation process by genetically engineering Vibrio salineae, such as TGB4, enabling the efficient synthesis of pure polylactic acid (PLA), lactic acid-3-hydroxybutyrate copolyester [poly(lactate-co-3-hydroxybutyrate, abbreviated as PLA3HB)], and lactic acid-4-hydroxybutyrate copolyester [poly(lactate-co-4-hydroxybutyrate, abbreviated as PLA4HB)] using lactic acid as a carbon source, and significantly increasing the proportion of lactic acid units.

[0009] Specifically, the inventors unexpectedly discovered through experiments that among the four endogenous lactate dehydrogenase genes (dld, ldhA, lldd1, and lldd2) of TGB4, knocking out ldhA or lldd2 did not significantly increase the lactate monomer content in the lactate copolyester product, while knocking out lldd1 or dld could increase the lactate monomer content in the lactate copolyester product from approximately 20 mol% to over 60 mol% and 80 mol%, respectively. Based on this, further knocking out the four endogenous acetyl-CoA reductase genes (phaB1, phaB2, phaB3, and phaB4) of TGB4 revealed that knocking out phaB3 had no promoting effect on increasing the lactate molar ratio, while knocking out phaB1, phaB2, and phaB4 could further increase the lactate molar ratio, yielding PLA3HB or PLA4HB with a lactate molar ratio exceeding 90 mol%, and even pure polylactic acid. In scaled-up fermenter culture, this recombinant bacterium exhibited excellent performance using lactic acid and γ-butyrolactone as substrates: the yield of PLA4HB reached 10.05 g / L in fermenter culture, with a lactic acid monomer content of approximately 98 mol%. This is the first time that PLA3HB, PLA4HB, and pure PLA with a high lactic acid molar ratio and a yield exceeding 10 g / L have been synthesized in Vibrio saline, demonstrating promising application prospects. The innovation of this invention lies in its systematic genetic modification strategy, which significantly improves the yield and purity of the target products, providing a new technical route for the industrial production of bio-based materials.

[0010] Therefore, the present invention provides a recombinant Salinivibrio kushneri that overexpresses an exogenous or endogenous propionyl-CoA transferase gene (pct gene) and a polyhydroxy fatty acid ester synthase gene (phaC1 gene), and knocks out (or deletes) one or more of the following endogenous lactate dehydrogenase genes: dld gene and lldd1 gene.

[0011] In some specific embodiments, the propionyl-CoA transferase gene (pct gene) is an exogenous gene.

[0012] In some specific embodiments, the propionyl-CoA transferase gene (pct gene) is derived from Megasphaera elsdenii, preferably with Genbank number NC_015873.1 and Gene ID MELS_RS03915.

[0013] In some specific implementations, the phaC1 gene is an exogenous gene.

[0014] In some specific embodiments, the phaC1 gene is derived from Pseudomonas, preferably from the sequence reference cloning vector pSC101-PhaC-pct (available from Shanghai Newp Biotechnology Co., Ltd., Cat.#V015353), GenBank number: MN623110.1, Protein ID: QJR97783.1. More specifically, the sequence of the phaC1 gene is shown as fragment 909 to 2588 bp of the cloning vector pSC101-PhaC-pct with GenBank number MN623110.1.

[0015] In some specific implementations, the GeneBank number of the dld gene is NZ_CP114586.1, and the Gene ID is O4598_RS06205.

[0016] In some specific implementations, the GeneBank number of the lldd1 gene is NZ_CP114586.1, and the Gene ID is O4598_RS15235.

[0017] In some specific embodiments, the recombinant saline Vibrio has also had one or more of the following endogenous acetyl-CoA reductase genes knocked out (or deleted): phaB1 gene, phaB2 gene, phaB3 gene and phaB4 gene, preferably phaB1 gene, phaB2 gene, phaB4 gene or a combination thereof knocked out (or deleted).

[0018] In some specific implementations, the phaB1 gene has the GeneBank number NZ_CP114586.1 and the Gene ID O4598_RS02970.

[0019] In some specific implementations, the phaB2 gene has the GeneBank number NZ_CP114586.1 and the Gene ID O4598_RS15185.

[0020] In some specific implementations, the GeneBank number of the phaB3 gene is NZ_CP114586.1, and the Gene ID is O4598_RS03885.

[0021] In some specific implementations, the phaB4 gene has the GeneBank number NZ_CP114586.1 and the Gene ID O4598_RS15130.

[0022] In some specific embodiments, the recombinant saline Vibrio has had the dld gene and phaB1 gene knocked out (or deleted).

[0023] In some specific embodiments, the recombinant saline Vibrio has had the dld gene, phaB1 gene, and phaB2 gene knocked out (or deleted).

[0024] In some specific embodiments, the recombinant saline Vibrio has had the dld gene, phaB1 gene, phaB2 gene, and phaB3 gene knocked out (or deleted).

[0025] In some specific embodiments, the recombinant saline Vibrio has had the dld gene, phaB1 gene, phaB2 gene, phaB3 gene, and phaB4 gene knocked out (or deleted).

[0026] In some specific embodiments, the recombinant saline Vibrio has had the dld gene, lldd1 gene, phaB1 gene, phaB2 gene, phaB3 gene, and phaB4 gene knocked out (or deleted).

[0027] In some specific embodiments, the pct gene and phaC1 gene are integrated into the genome of the recombinant Vibrio salinae. The pct gene is derived from Megasphaera elsdenii, with its sequence referenced in GenBank (NC_015873.1, Gene ID: MELS_RS03915). The phaC1 gene is derived from Pseudomonas, with its sequence referenced in the cloning vector pSC101-PhaC-pct, GenBank (MN623110.1, Protein ID: QJR97783.1). More specifically, the phaC1 gene sequence is shown as fragment 909 to 2588 bp of the cloning vector pSC101-PhaC-pct with GenBank (MN623110.1).

[0028] In some specific embodiments, the recombinant saline Vibrio is recombinant saline Vibrio (Salinivibriokushneri) TGB4, and the accession number of saline Vibrio (Salinivibrio kushneri) TGB4 is CGMCC No. 21105.

[0029] Another aspect of the present invention provides a method for producing 3-hydroxybutyrate copolyester (PLA3HB), 4-hydroxybutyrate copolyester (PLA4HB), and / or polylactic acid (PLA), the method comprising the steps of: fermenting and culturing the recombinant saline Vibrio according to the present invention, synthesizing and purifying to obtain PLA3HB, PLA4HB, and / or PLA.

[0030] In some specific embodiments, the carbon source for the fermentation culture is lactic acid, or lactic acid plus γ-butyrolactone.

[0031] In some specific embodiments, the molar ratio of lactic acid monomer in PLA3HB or PLA4HB is greater than 60%, preferably greater than 80%, more preferably greater than 90%, or even 100% (i.e., the product is pure PLA).

[0032] The technical problem to be solved by the present invention is to provide an engineered Vibrio salineus that utilizes lactic acid to synthesize polylactic acid or a copolyester of lactic acid and 3-hydroxybutyric acid or a copolyester of lactic acid and 4-hydroxybutyric acid.

[0033] To solve the above problems, the present invention starts with Salinivibriokushneri TGB4, which was previously isolated and identified in the laboratory, and modifies it according to the following A1-A10 to obtain the recombinant bacteria.

[0034] A1. Integrate the propionyl-CoA transferase gene (pct gene) and the polyhydroxyalkanoate synthase gene (phaC1 gene, which is derived from Pseudomonas, and its sequence is referenced in the cloning vector pSC101-PhaC-pct, Genbank number: MN623110.1, Protein ID: QJR97783.1. More specifically, the phaC1 gene sequence is shown as the sequence of fragment 909 to 2588 bp of the cloning vector pSC101-PhaC-pct with Genbank number MN623110.1) or add the propionyl-CoA transferase gene (pct gene, derived from Megasphaera elsdenii, Genbank number: NC_015873.1, Gene... The genetically engineered bacterium TGB4-01 is obtained by increasing the content of the protein encoded by the pct gene (ID: MELS_RS03915) or enhancing the activity of the protein encoded by the pct gene, or by increasing the content of the protein encoded by the polyhydroxy fatty acid ester synthase gene (phaC1 gene) in the recipient bacteria or enhancing the activity of the protein encoded by the phaC1 gene.

[0035] A2. Knock out the lactate dehydrogenase gene (dld gene, GeneBank number: NZ_CP114586.1, GeneID: O4598_RS06205) of TGB4-01 or inhibit the expression of the dld gene or inhibit the activity of the protein encoded by the dld gene to obtain the genetically engineered bacterium TGB4-02.

[0036] A3. Knock out the lactate dehydrogenase gene (ldhA gene, GeneBank number: NZ_CP114586.1, GeneID: O4598_RS14960) of TGB4-01 or inhibit the expression of the ldhA gene or inhibit the activity of the protein encoded by the ldhA gene to obtain the genetically engineered bacterium TGB4-03.

[0037] A4. Knock out the lactate dehydrogenase gene (lldd1 gene, GeneBank No.: NZ_CP114586.1, Gene ID: O4598_RS15235) of TGB4-01 or inhibit the expression of the lldd1 gene or inhibit the activity of the protein encoded by the lldd1 gene to obtain the genetically engineered bacterium TGB4-04.

[0038] A5. Knock out the lactate dehydrogenase gene (lldd2 gene, GeneBank No.: NZ_CP114586.1, Gene ID: O4598_RS01565) of TGB4-01 or inhibit the expression of the lldd2 gene or inhibit the activity of the protein encoded by the lldd2 gene to obtain the genetically engineered bacterium TGB4-05.

[0039] A6. Knock out the acetyl-CoA reductase gene (phaB1 gene, GeneBank No.: NZ_CP114586.1, Gene ID: O4598_RS02970) of TGB4-02 or inhibit the expression of the phaB1 gene or inhibit the activity of the protein encoded by the phaB1 gene to obtain the genetically engineered bacterium TGB4-06.

[0040] A7. Knock out the acetyl-CoA reductase gene (phaB2 gene, GeneBank No.: NZ_CP114586.1, Gene ID: O4598_RS15185) of TGB4-06 or inhibit the expression of the phaB2 gene or inhibit the activity of the protein encoded by the phaB2 gene to obtain the genetically engineered bacterium TGB4-07.

[0041] A8. Knock out the acetyl-CoA reductase gene (phaB3 gene, GeneBank No.: NZ_CP114586.1, Gene ID: O4598_RS03885) of TGB4-07 or inhibit the expression of the phaB3 gene or inhibit the activity of the protein encoded by the phaB3 gene to obtain the genetically engineered bacterium TGB4-08.

[0042] A9. Knock out the acetyl-CoA reductase gene (phaB4 gene, GeneBank No.: NZ_CP114586.1, Gene ID: O4598_RS15130) of TGB4-08 or inhibit the expression of the phaB4 gene or inhibit the activity of the protein encoded by the phaB4 gene to obtain the genetically engineered bacterium TGB4-09.

[0043] A10. Knock out the lactate dehydrogenase gene (lldd1 gene, GeneBank No.: NZ_CP114586.1, Gene ID: O4598_RS15235) of TGB4-09 or inhibit the expression of the lldd1 gene or inhibit the activity of the protein encoded by the lldd1 gene to obtain the genetically engineered bacterium TGB4-10.

[0044] First, this invention obtained strain TGB4-01 by inserting the pct-phaC1 gene into the genome of wild-type Vibrio salinae through gene integration. This strain can effectively synthesize lactic acid and 3-hydroxybutyrate copolyesters. Second, to further improve the molar ratio of lactic acid in the copolyester, this invention knocked out four endogenous lactate dehydrogenase genes in TGB4-01, obtaining modified strains TGB4-02, TGB4-03, TGB4-04, and TGB4-05. Among them, TGB4-02 showed a significant increase in the content of lactic acid units during copolyester production. This may be because knocking out the dld gene inhibited the D-lactic acid metabolic pathway, blocked the oxidative metabolic pathway of lactic acid to pyruvate, forced the accumulation of intracellular lactic acid precursors and directed them towards copolyester synthesis, thereby increasing the molar ratio of lactic acid.

[0045] Furthermore, this invention obtained strains TGB4-06, TGB4-07, TGB4-08, and TGB4-09 by weakening the genes phaB1, phaB2, phaB3, and phaB4 in TGB4-02. By weakening the expression of the phaB gene (acetyl-CoA reductase gene), the excessive production of 3HB monomer was inhibited, further increasing the molar ratio of lactic acid, resulting in a lactic acid molar ratio exceeding 90% in the final synthesized lactic acid and 3-hydroxybutyrate copolyester.

[0046] Finally, the lldd1 gene was knocked out based on strain TGB4-09 to obtain strain TGB4-10. Gas phase results showed that the molar ratio of lactic acid was further improved, and pure polylactic acid was synthesized.

[0047] In summary, the beneficial effects of this invention are as follows: By integrating two exogenous genes (pct, phaC1) into the genome of Vibrio salinae TGB4, and subsequently knocking out four endogenous lactate dehydrogenase genes (dld, ldhA, lldd1, and lldd2) and four acetyl-CoA reductase genes (phaB1, phaB2, phaB3, and phaB4), an engineered strain capable of efficiently synthesizing polylactic acid (PLA), lactate-3-hydroxybutyrate (HHB), or lactate-4-hydroxybutyrate (HHB) copolyesters using lactate is obtained. The obtained engineered strain exhibits high metabolic stability and good potential for industrial application, and can efficiently produce PLA, lactate-3-hydroxybutyrate (HHB) copolyesters with a lactate molar ratio exceeding 90%, and lactate-4-hydroxybutyrate (HHB) copolyesters with a lactate molar ratio exceeding 95% under controlled conditions. The engineered saline Vibrio bacteria and the method for producing polylactic acid or copolyesters of lactic acid and 3-hydroxybutyrate or copolyesters of lactic acid and 4-hydroxybutyrate described in this invention can be widely applied in the production of biodegradable plastics, environmentally friendly materials, and related chemical products, providing a new approach to achieving sustainable development. Furthermore, the modification method can be applied to other related microbial strains, demonstrating strong operability and broad application prospects. Attached Figure Description

[0048] Figure 1 The image shows the 112-pct-phaC1 plasmid.

[0049] Figure 2 Map of CBE-dld plasmid for base editing.

[0050] Figure 3 The results of scale-up culture for the synthesis of lactic acid and 4-hydroxybutyric acid copolyester by recombinant strain TGB4-10.

[0051] Figure 4 The 1H NMR spectrum of polylactic acid synthesized by recombinant strain TGB4-10.

[0052] Figure 5 The 1H NMR spectrum of the copolyester synthesized by recombinant strain TGB4-10 of lactic acid and 4-hydroxybutyric acid. Detailed Implementation

[0053] The *Violis salinivibrio* used in the following examples is specifically *Violis salinivibrio kushneri* TGB4, which has the accession number CGMCC No. 21105 at the China General Microbiological Culture Collection Center and has been disclosed in CN113265356B.

[0054] In this invention, the pct-phaC1 gene was first integrated into *Salinivibrio kushneri* TGB4 to obtain recombinant strain TGB4-01. This strain can synthesize lactic acid and 3-hydroxybutyrate copolyesters, showing promising application prospects. Secondly, based on TGB4-01, four endogenous lactate dehydrogenase genes were individually knocked out, resulting in modified strains TGB4-02, TGB4-03, TGB4-04, and TGB4-05. Among them, recombinant strain TGB4-02, with the dld gene knocked out, yielded a lactic acid and 3-hydroxybutyrate copolyester with a high lactate molar ratio. Subsequently, based on TGB4-02, four endogenous acetyl-CoA reductase genes were knocked out, resulting in strains TGB4-06, TGB4-07, TGB4-08, and TGB4-09, with lactate molar ratios exceeding 90 mol%. By knocking out the lldd1 gene from TGB4-09, a recombinant strain TGB4-10 capable of synthesizing pure polylactic acid was obtained. Scale-up culture with exogenous addition of γ-butyrolactone to this strain revealed the synthesis of a lactic acid-4-hydroxybutyric acid copolyester with a lactic acid molar ratio exceeding 96 mol%.

[0055] This invention provides a method for constructing recombinant bacteria, as follows: 1) or 2):

[0056] 1) The pct-phaC1 gene was integrated into the genome of Vibrio salinae TGB4 to obtain recombinant strain TGB4-01;

[0057] 2) The expression of four endogenous lactate dehydrogenase genes in the genome of strain TGB4-01 was inhibited or reduced respectively to obtain recombinant strains TGB4-02, TGB4-03, TGB4-04 and TGB4-05. Among them, the lactate unit content in PLA3HB synthesized by recombinant strain TGB4-02 was significantly increased.

[0058] 3) The expression of four endogenous acetyl-CoA reductase genes in the genome of strain TGB4-02 was inhibited or reduced to obtain recombinant strains TGB4-06, TGB4-07, TGB4-08 and TGB4-09, respectively. The lactate unit content in PLA3HB synthesized by recombinant strain TGB4-09 was 90.21 mol.

[0059] 4) The expression of the endogenous lactate dehydrogenase gene in the genome of strain TGB4-09 was inhibited or reduced to obtain recombinant strain TGB4-10. This recombinant strain synthesized pure PLA using lactate.

[0060] 5) The recombinant strain TGB4-10 was scaled up and cultured, and PLA4HB with a lactic acid monomer content of 98 mol% was synthesized under the culture conditions of DL lactic acid and γ-butyrolactone.

[0061] In some specific embodiments, the method is characterized by:

[0062] The integration of the pct-phaC1 gene into the genome of Vibrio salinae TGB4 and the inhibition or reduction of the expression of endogenous lactate dehydrogenase gene and acetyl-CoA reductase gene are described in the context of knocking out the full-length or partial lactate dehydrogenase gene and acetyl-CoA reductase gene in the TGB4-01 genome.

[0063] In some specific embodiments, the method is characterized by:

[0064] The pct gene encoded by propionyl-CoA transferase and the phaC1 gene encoded by polyhydroxyalkanoate synthase in the recombinant strain were integrated into the Vibrio salinae TBG4 strain through homologous recombination.

[0065] The present invention also provides recombinant bacteria prepared by the method described herein.

[0066] This invention also provides the application of the recombinant bacteria described herein in any of the following:

[0067] 1) Synthesis of PLA3HB with a high lactate molar ratio;

[0068] 2) Synthesize pure PLA;

[0069] 3) Scale up the culture and synthesize PLA4HB.

[0070] The present invention also provides the recombinant bacteria described herein and a culture medium containing lactic acid as a carbon source, or a culture medium containing lactic acid plus γ-butyrolactone as a carbon source, for use in any of the following:

[0071] 1) Synthesis of PLA3HB with a high lactate molar ratio;

[0072] 2) Synthesize pure PLA;

[0073] 3) Scale up the culture and synthesize PLA4HB.

[0074] The present invention also provides a method for producing PLA3HB and PLA4HB with high lactate molar ratios and pure PLA, comprising the following steps: fermenting the recombinant bacteria described in the present invention to obtain PLA3HB, PLA4HB and pure PLA.

[0075] In some specific embodiments, the method is characterized in that: the carbon source for fermentation is lactic acid, or lactic acid plus γ-butyrolactone.

[0076] In some specific embodiments, the recombinant saline Vibrio can preferably use substances such as lactic acid, lactic acid and γ-butyrolactone as carbon sources to synthesize polylactic acid (PLA), lactic acid and 3-hydroxybutyric acid copolyester (PLA3HB) and lactic acid and 4-hydroxybutyric acid copolyester (PLA4HB).

[0077] In this invention, the fermentation medium includes a fermentation substrate, and specific examples of the fermentation substrate include, but are not limited to, one or more of lactic acid and γ-butyrolactone.

[0078] In some specific embodiments, the fermentation medium preferably comprises 20-60 g / L of fermentation substrate, such as 20 g / L, 30 g / L, 40 g / L, 50 g / L, 60 g / L, or any value between them. This fermentation medium contains a suitable concentration of fermentation substrate, which is beneficial for the synthesis of PLA, PLA3HB, and PLA4HB by recombinant saline Vibrio.

[0079] In some specific embodiments, the fermentation medium preferably comprises 20-60 g / L of NaCl, such as 20 g / L, 30 g / L, 40 g / L, 50 g / L, 60 g / L, or any value between them. This fermentation medium is beneficial to the growth and reproduction of recombinant *Vibrio salineae*, and can enhance the intracellular metabolic pathways for the synthesis of PLA, PLA3HB, and PLA4HB, thereby effectively increasing their yield.

[0080] This invention does not limit the specific components of the fermentation medium, which are commonly used bacterial culture media in the prior art. In some specific embodiments, specific examples of the fermentation medium may be, but are not limited to, one or more of TYS medium, LB medium, YPD medium (Yeast Extract Peptone Dextrose Medium), and MRS (Man, Rogosa, and Sharpe) medium. In other specific embodiments, the fermentation medium is more preferably TYS medium and / or LB medium.

[0081] In this invention, the fermentation culture conditions include an inoculum size preferably of 2-10%, such as 2%, 3%, 4%, 5%, 6%, 7.5%, 8%, 9%, 10%, or any value between them; a temperature preferably of 25-37°C, such as 25°C, 27°C, 28°C, 30°C, 32°C, 35°C, 37°C, or any value between them; and a time preferably of 6-48h, such as 6h, 12h, 18h, 24h, 36h, 48h, or any value between them.

[0082] The embodiments of the present invention are described in detail below. These embodiments are intended to explain the present invention and should not be construed as limiting the present invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products.

[0083] The reagents used in the following examples specifically include:

[0084] The standard polyhydroxy fatty acid ester was purchased from Sigma-Aldrich, catalog number 403121, product name poly(3-hydroxybutyrate-co-3-hydroxyvalerate), wherein the content of 3-hydroxybutyric acid monomer is 88 mol% and the content of 3-hydroxyvalerate monomer is 12 mol%.

[0085] γ-Butyrolactone (Beijing Tongguang Fine Chemical Co., Ltd., product number YZD23120811).

[0086] Lactic acid (Beijing Boya Hongxing Technology Development Co., Ltd., product number 50215).

[0087] LB liquid medium is prepared by dissolving 10g of peptone, 5g of yeast extract, and 10g of sodium chloride in an appropriate amount of deionized water, and then bringing the volume to 1L with deionized water. 20LB and 60LB represent sodium chloride concentrations of 20g and 60g, respectively, with the remaining components the same as LB.

[0088] The TYS culture medium is prepared as follows: 5g peptone, 1g yeast extract, and artificial seawater are added to a final volume of 1L and sterilized at 121℃ for 20 minutes. The artificial seawater is composed of the following components in the following proportions: 27.5g sodium chloride, 0.7g potassium chloride, 5.4g magnesium chloride hexahydrate, 6.8g magnesium sulfate heptahydrate, 1.05g calcium chloride, and 0.2g sodium bicarbonate. The mixture is then added to a final volume of 1L with deionized water and the pH is adjusted to 7.5.

[0089] Materials used in the following embodiments:

[0090] A1. Integrate the propionyl-CoA transferase gene (pct gene) and the polyhydroxyalkanoate synthase gene (phaC1 gene, which is derived from Pseudomonas, and its sequence is referenced in the cloning vector pSC101-PhaC-pct, Genbank number: MN623110.1, Protein ID: QJR97783.1. More specifically, the phaC1 gene sequence is shown as the sequence of fragment 909 to 2588 bp of the cloning vector pSC101-PhaC-pct with Genbank number MN623110.1) or add the propionyl-CoA transferase gene (pct gene, derived from Megasphaera elsdenii, Genbank number: NC_015873.1, Gene... The genetically engineered bacterium TGB4-01 is obtained by increasing the content of the protein encoded by the pct gene (ID: MELS_RS03915) or enhancing the activity of the protein encoded by the pct gene, or by increasing the content of the protein encoded by the polyhydroxy fatty acid ester synthase gene (phaC1 gene) in the recipient bacteria or enhancing the activity of the protein encoded by the phaC1 gene.

[0091] 1. Plasmid 112-pct-phaC1: Synthesized by Beijing Bomaide Biotechnology Co., Ltd. The plasmid map is shown below. Figure 1 As shown. The backbone plasmid is pRE112, with a sequence from Addgene, catalog number 43828. pct-phaC1 (the pct gene is from Megasphaera elsdenii, Genbank ID: NC_015873.1, Gene ID: MELS_RS03915; the phaC1 gene is from Pseudomonas, with its sequence referenced from the cloning vector pSC101-PhaC-pct, Genbank ID: MN623110.1, Protein ID: QJR97783.1. More specifically, the phaC1 gene sequence is shown as the 909th to 2588th bp segment of the cloning vector pSC101-PhaC-pct with Genbank ID MN623110.1) integrates into the genome at the 7th base position after the phaC gene stop codon, with upstream and downstream sequences of 500 bp and 501 bp respectively.

[0092] 2. Base editing plasmids CBE-dld, CBE-ldhA, CBE-lldd1, CBE-lldd2, CBE-phaB1, CBE-phaB2, CBE-phaB3, and CBE-phaB4: synthesized by Beijing Bomed Biotechnology Co., Ltd. The plasmid map of CBE-dld is shown below. Figure 2As shown, the structures of the other base editing plasmids are similar, except for the sgRNA sequences. The backbone plasmid is pSEVA341, purchased from NovoPro Bioscience Inc., catalog number V003324. The sgRNA sequences for each gene are shown below: dld-sgRNA: cagacccagcattatcggac (SEQ ID No. 1); ldhA-sgRNA: aaaaccgccaagatggcgca (SEQ ID No. 2); lldd1-sgRNA: cagcgccaacttcatgccga (SEQ ID No. 3); lldd2-sgRNA: tcaagggttaatgtggccca (SEQ ID No. 4); phaB1-sgRNA: acaccgaacaatgcgcctca (SEQ ID No. 5);

[0093] phaB2-sgRNA:cacagtcggcggtgagcagta (SEQ ID No. 6);

[0094] phaB3-sgRNA: catcaaccaagcagtcgagg (SEQ ID No. 7); phaB4-sgRNA: aggctatcaattcggtgaag (SEQ ID No. 8).

[0095] 3. Rapid Taq Master Mix DNA polymerase: purchased from Vazyme Biotech (Nanjing).

[0096] 4. E. coli NEB 5-alpha: derived from NEB (New England Biolabs), catalog number C2987I.

[0097] 5. E. coli s17-1: sourced from Biomed (Beijing), product number BC129-01.

[0098] 6. DNA Marker, nucleic acid gel dyes, and other reagents: purchased from Biomed (Beijing).

[0099] 7. Gel extraction kit and plasmid extraction kit: purchased from BioMed (Beijing).

[0100] 8. Seamless cloning kit: purchased from Shanghai Beyotime Biotechnology Co., Ltd.

[0101] 9. Various analytical grade reagents: purchased from Sinopharm Chemical Reagents Beijing Co., Ltd.

[0102] 10. Sample processing and gas chromatography detection method: After fermentation with lactic acid or lactic acid plus γ-butyrolactone as carbon source, take 20 mL of fermentation broth, centrifuge at 10000 rpm for 10 min, discard the supernatant, resuspend the bacterial cells with deionized water and wash, centrifuge again at 10000 rpm for 10 min to collect the bacterial cells, place the centrifuge tube containing the washed bacterial cell precipitate at -20℃ for 2 h, and then freeze-dry in a freeze vacuum dryer for 8-12 h to obtain the freeze-dried product.

[0103] In the following examples, cell dry weight is measured as the cell dry weight per liter of fermentation broth. The unit of cell dry weight is g / L. Cell dry weight (CDW) = (weight of the freeze-dried centrifuge tube - weight of the original empty centrifuge tube) / volume of fermentation broth; the weight of the freeze-dried centrifuge tube and the weight of the original empty centrifuge tube are both in g; the volume of fermentation broth is in L.

[0104] The method for detecting the content of polyhydroxyalkanoate in bacterial cells in the following examples is as follows: the freeze-dried product undergoes an esterification reaction, and the content of the product after the esterification reaction is measured to calculate the content.

[0105] Esterification reaction: Take 30-40 mg of the freeze-dried product into an esterification tube, add 2 mL of chloroform and 2 mL of esterification solution (which is obtained by adding 15 mL of concentrated sulfuric acid and 0.5 g of benzoic acid to 500 mL of methanol), mix well, cover and seal, and esterify at 100 °C for 4 h; after cooling to room temperature, add 1 mL of deionized water, mix thoroughly with a vortex mixer, and let stand to separate the layers; after the chloroform phase and water are completely separated, take 1 μL of the chloroform phase for gas chromatography analysis.

[0106] Take about 20 mg of poly(3-hydroxybutyrate-co-3-hydroxyvalerate), about 20 mg of lactic acid, and about 20 mg of 4-hydroxybutyric acid, and esterify them using the same method to obtain the standard.

[0107] Gas chromatography analysis parameters: An HP 6890 gas chromatograph was used, with an HP-5 capillary column, 30m in length and 320μm in inner diameter, and a 25nm thick phenylmethyl polysiloxane stationary phase; a flame ionization detector (FID) was used; high-purity nitrogen was used as the carrier gas, hydrogen as the fuel gas, and air as the combustion-supporting gas;

[0108] The conditions for gas chromatography analysis are as follows:

[0109] (1) Column temperature: Start at 80℃ and hold for 1.5 min; increase the temperature to 140℃ at a rate of 30℃ / min and hold for 0 min; increase the temperature to 220℃ at a rate of 40℃ / min and hold for 1 min. The total time is 6.5 min.

[0110] (2) Column pressure: Start at 10 psi, hold for 1.5 min; increase the pressure to 20 psi at a rate of 2.5 psi / min, hold for 0.5 min. (psi is a unit of pressure, i.e., pounds per square inch, 1 psi = 6.89476 kPa)

[0111] (3) Inlet: Temperature is 200℃, split mode is used, and split ratio is 30.

[0112] (4) Detector: Temperature is 220℃, hydrogen flow rate is 30mL / min, and air flow rate is 400mL / min.

[0113] Using an Agilent microsyringe with an injection volume of 1 μL, the polymer was quantitatively analyzed using the internal standard method, and quantification was based on peak area.

[0114] During gas chromatography detection, frozen stem cell samples were compared with poly(3-hydroxybutyrate-co-3-hydroxyvalerate) standards, lactic acid standards, and 4-hydroxybutyrate standards. Using the above steps for esterification reaction and gas chromatography detection, the presence of a peak position in the frozen stem cell sample that matches the lactic acid position in the standards indicates that polylactic acid has accumulated in the cells; the presence of a peak position in the frozen stem cell sample that matches the positions of both 3-hydroxybutyrate and lactic acid in the standards indicates that lactic acid and 3-hydroxybutyrate copolyester has accumulated in the cells; and the presence of a peak position in the frozen stem cell sample that matches the positions of both 4-hydroxybutyrate and lactic acid in the standards indicates that lactic acid and 4-hydroxybutyrate copolyester has accumulated in the cells.

[0115] The yield calculation for lactic acid and 3-hydroxybutyric acid copolyester is as follows: PLA3HB yield = P3HB yield + PLA yield.

[0116] Where: P3HB yield = (P3HB peak area in sample / internal standard peak area in sample) × [(internal standard peak area in standard / P3HB peak area in standard) × (standard mass × 0.908)] / esterification mass of sample × cell dry weight;

[0117] PLA yield = (PLA peak area in sample / internal standard peak area in sample) × [(internal standard peak area in standard / PLA peak area in standard) × (standard mass × 1)] / esterification mass of sample × cell dry weight;

[0118] Lactic acid unit percentage = (PLA production / 72) ÷ (PLA production / 72 + P3HB production / 86) × 100;

[0119] 3HB unit percentage = (P3HB output / 86) ÷ (PLA output / 72 + P3HB output / 86) × 100.

[0120] The yield calculation for lactic acid and 4-hydroxybutyric acid copolyester is as follows: PLA4HB yield = P4HB yield + PLA yield.

[0121] Where: P4HB yield = (P4HB peak area in sample / internal standard peak area in sample) × [(internal standard peak area in standard / P4HB peak area in standard) × (standard mass × 1)] / esterification mass of sample × cell dry weight;

[0122] PLA yield = (PLA peak area in sample / internal standard peak area in sample) × [(internal standard peak area in standard / PLA peak area in standard) × (standard mass × 1)] / esterification mass of sample × cell dry weight.

[0123] Lactic acid unit percentage = (PLA production / 72) ÷ (PLA production / 72 + P4HB production / 86) × 100;

[0124] 4HB unit percentage = (P4HB output / 86) ÷ (PLA output / 72 + P4HB output / 86) × 100.

[0125] The PLA yield calculation is as follows: PLA yield = (PLA peak area in sample / internal standard peak area in sample) × [(internal standard peak area in standard / PLA peak area in standard) × (standard mass × 1)] / esterification mass of sample × cell dry weight.

[0126] Polymer content is defined as the ratio of polymer to cell dry weight, and polymer content = polymer yield / cell dry weight × 100%.

[0127] 11. Chemical transformation of E. coli S17-1pir:

[0128] (1) Take one tube of competent E.coli S17-1pir (100 μL) and place it in an ice bath. After the competent cells thaw, add the ligated plasmid (10 μL) to the competent cell suspension and incubate on ice for 30 min.

[0129] (2) Place the competent cell centrifuge tube in a 42°C constant temperature water bath for 60 seconds, and then quickly transfer the tube to an ice bath to cool the cells for 2 minutes. Do not shake the centrifuge tube during this process.

[0130] (3) Add 500 μL of LB liquid culture medium (without antibiotics) to the centrifuge tube, mix well, and then place it in a shaker at 37°C and 200 rpm for 45 min-1 h.

[0131] (4) Under aseptic conditions, take 100 μL of bacterial solution and add it to an LB solid medium plate containing the corresponding resistance. Add glass beads and shake to spread the bacterial solution evenly.

[0132] (5) After the liquid in the plate is completely absorbed, invert the plate and incubate it in a constant temperature incubator at 37°C for 16 hours.

[0133] 12. Establish a conjugation transformation method in Vibrio saline-containing bacteria TGB4:

[0134] (1) The recombinant strain of E. coli S17-1pir(112-pct-phaC1) that was verified as positive was cultured at 37℃ until OD 600 The value was 0.8. Take 3 mL of bacterial culture, centrifuge at 5500 rpm for 2 min, and wash once with ordinary LB medium.

[0135] (2) Vibrio salineae TGB4 cultured at 37℃ to OD 600 The value was 0.8. Take 3 mL of bacterial culture, centrifuge at 5500 rpm for 2 min, and wash once with ordinary LB medium.

[0136] (3) Take 100 μL of each of the two bacterial solutions, mix them evenly, and drop them all onto a 20 LB solid plate to try to make the bacterial solutions aggregate.

[0137] (4) Incubate at 37°C for 6-8 hours, then resuspend the bacterial growth on the plate with fresh LB liquid medium, dilute appropriately, spread on 60LB plates containing chloramphenicol resistance, and incubate overnight at 37°C.

[0138] (5) Perform colony PCR verification, streak purification and other operations on the single colonies that grow. The required primer sequences are shown in Table 1. Select a suitable positive clone and inoculate it into 4 mL of 60 LB liquid medium containing chloramphenicol. After overnight culture, store it in glycerol tubes and place the stored glycerol tubes in a -80℃ freezer.

[0139] 13. Extraction method of PLA / PLA4HB: Crush the frozen stem cell sample, weigh approximately 0.3g of stem cell fragments, and add 5-8mL of chloroform to an esterification tube. Incubate at 100℃ for 4 hours. Pour the chloroform-cell fragment mixture into a 50mL centrifuge tube, add an equal volume of deionized water, mix well, and centrifuge at 10000rpm for 8min. Use a pipette to transfer the lower organic phase to a clean shake flask. Add 10 times the volume of ice-cold anhydrous ethanol to the chloroform organic phase to obtain the PLA / PLA4HB precipitate. Centrifuge to collect the precipitate. Dry the precipitate in a 40℃ oven to obtain clean PLA / PLA4HB.

[0140] 14. Nuclear magnetic resonance hydrogen spectroscopy determination method: Take the clean PLA or PLA4HB sample obtained above, dissolve it in 1 mL of deuterated chloroform, transfer the dissolved sample to an NMR tube, and send it to the Analysis and Testing Center of Beijing University of Chemical Technology for detection.

[0141] Example 1: Construction of 10 recombinant strains TGB4-01 to TGB4-10

[0142] 1. Integration of pct-phaC1 into the TGB4 genome

[0143] (1) The 112-pct-phaC1 plasmid synthesized by Bomeide Company was conjugated into TGB4. Single clones were picked from the screening plate and grown in 60LB chloramphenicol liquid medium. 200μL of bacterial culture was transferred to medium containing 200g / L high concentration of sucrose and cultured for 4 hours. Then, it was streaked onto 60LB plates containing 200g / L high concentration of sucrose and cultured at 37℃ for 24h to obtain transformants.

[0144] (2) The transformant was verified by colony PCR using phaC-VF and phaC-VR primers. The 3745bp fragment obtained was a positive clone. The positive clone was sent for sequencing and was found to be a bacterium obtained by integrating pct-phaC1 into the TGB4 genome. The bacterium was inoculated into TYS liquid medium and cultured overnight at 37°C. The resulting strain was named TGB4-01.

[0145] Table 1 is a list of primer sequences used in Example 1.

[0146]

[0147]

[0148] 2. Knock out four endogenous lactate dehydrogenase genes in recombinant strain TGB4-01.

[0149] (1) The base editing plasmids CBE-dld, CBE-ldhA, CBE-lldd1, and CBE-lldd2 synthesized by BOMIDE were conjugated into TGB4-01, and the transformants were verified by colony PCR. The verification primers were dld-VF and dld-VR, ldhA-VF and ldhA-VR, lldd1-VF and lldd1-VR, and lldd2-VF and lldd2-VR, respectively, and positive clones with 1045bp fragments were obtained. The positive clones were sent for sequencing, and they were identified as recombinant strains with dld, ldhA, lldd1, and lldd2 knocked out in the TGB4-01 genome, respectively. The strains were inoculated into TYS liquid medium and cultured overnight at 37°C. The resulting strains were named TGB4-02, TGB4-03, TGB4-04, and TGB4-05, respectively.

[0150] 3. Knock out four endogenous acetyl-CoA reductase genes in recombinant strain TGB4-02.

[0151] (1) The base-editing plasmid CBE-phaB1 synthesized by Bomeide was conjugated into TGB4-02. The transformant was verified by colony PCR using phaB1-VF and phaB1-VR primers, yielding a positive clone with a 1015 bp fragment. This positive clone was sent for sequencing and was identified as a recombinant strain with phaB1 knocked out in the TGB4-02 genome. The strain was then inoculated into TYS liquid medium and cultured overnight at 37°C. The resulting strain was named TGB4-06.

[0152] (2) The base-editing plasmid CBE-phaB2 synthesized by BOMIDE was conjugated into TGB4-06. The transformant was verified by colony PCR using phaB2-VF and phaB2-VR primers, yielding a positive clone with a 1015 bp fragment. This positive clone was sent for sequencing, and it was identified as a recombinant strain with phaB2 knocked out in the TGB4-06 genome. The strain was then inoculated into TYS liquid medium and cultured overnight at 37°C. The resulting strain was named TGB4-07.

[0153] (3) The base-editing plasmid CBE-phaB3 synthesized by Bomeide was conjugated into TGB4-07. The transformant was verified by colony PCR using phaB3-VF and phaB3-VR primers, yielding a positive clone with a 1015 bp fragment. This positive clone was sent for sequencing, and it was found to be a recombinant strain with phaB3 knocked out in the TGB4-07 genome. The strain was then inoculated into TYS liquid medium and cultured overnight at 37°C. The resulting strain was named TGB4-08.

[0154] (4) The base-editing plasmid CBE-phaB4 synthesized by Bomeide was conjugated into TGB4-08. The transformant was verified by colony PCR using phaB4-VF and phaB4-VR primers, yielding a positive clone with a 1015 bp fragment. This positive clone was sent for sequencing, and it was found to be a recombinant strain with phaB4 knocked out in the TGB4-08 genome. The strain was then inoculated into TYS liquid medium and cultured overnight at 37°C. The resulting strain was named TGB4-09.

[0155] 4. Knock out the endogenous lactate dehydrogenase lldd1 gene in recombinant strain TGB4-09.

[0156] (1) The base-editing plasmid CBE-lldd1 synthesized by Bomeide was conjugated into TGB4-09. The transformant was verified by colony PCR using lldd1-VF and lldd1-VR primers, yielding a positive clone with a 1045bp fragment. This positive clone was sent for sequencing and was identified as a recombinant strain with lldd1 knocked out in the TGB4-09 genome. The strain was then inoculated into TYS liquid medium and cultured overnight at 37°C. The resulting strain was named TGB4-10.

[0157] Example 2: Recombinant bacteria produce lactic acid and 3-hydroxybutyric acid copolyesters and polylactic acid using lactic acid as a carbon source.

[0158] This embodiment illustrates the ability of recombinant bacteria to synthesize lactic acid and 3-hydroxybutyrate copolyester (PLA3HB) and polylactic acid (PLA) using lactic acid, specifically including:

[0159] (1) Single clones of recombinant bacteria TGB4-01 to TGB4-10 were inoculated into 20 mL of TYS liquid medium and cultured at 37℃ and 200 rpm for 12 h to obtain recombinant bacterial seed liquid.

[0160] (2) Fermentation of recombinant bacteria: Adjusting the OD of the recombinant bacteria seed liquid 600 3. 1.5 mL (inoculum amount of 5%) of the seed culture of recombinant bacteria TGB4-01 to TGB4-10 were inoculated into 30 mL of TYS liquid medium containing 30 g / L lactic acid and 40 g / L NaCl, and cultured at 30 °C and 200 rpm for 48 h to obtain the fermentation broth.

[0161] (3) The cell dry weight and PLA3HB and PLA yield were determined according to the method provided above, and the yield, content and ratio of PLA3HB and PLA and LA to 3HB were calculated. The results are shown in Table 2.

[0162] Table 2. Recombinant bacteria synthesize PLA3HB and PLA using lactic acid.

[0163]

[0164]

[0165] The results showed that the recombinant strain TGB4-01, which integrates pct-phaC1 into the TGB4 genome, can synthesize a copolyester of lactic acid and 3-hydroxybutyric acid (PLA3HB) using lactic acid, with a lactic acid monomer content of 24.49 mol% and a polymer yield of 0.43 g / L.

[0166] Knocking out the dld gene increased the lactate monomer content in recombinant strain TGB4-02 to 84.69 mol%, indicating that the lactate degradation pathway was significantly inhibited and more lactate was used for polymerization. Knocking out the lldd1 gene resulted in a lactate monomer content of 65.43 mol% in recombinant strain TGB4-04, suggesting that the lldd1 gene has a similar function to the dld gene. However, knockout of the ldhA and lldd2 genes did not significantly increase the lactate monomer content, suggesting that they may not play a major role in lactate degradation.

[0167] To further increase the proportion of lactic acid monomers, the polymerization of 3-hydroxybutyrate monomers in the copolyester was weakened by deleting the key gene for PHB synthesis in the dld gene knockout strain TGB4-02. The recombinant strain TGB4-06, with the phaB1 gene knocked out, inhibited the function of acetyl-CoA reductase, achieving a lactic acid monomer content of 92.50 mol%. Since there are four isoenzyme genes for acetyl-CoA reductase in Vibrio salinae TGB4, phaB2 was knocked out based on TGB4-06. The lactic acid monomer content in the recombinant strain TGB4-07 was 91.17 mol%, with no significant increase. Knocking out phaB3 based on TGB4-07 resulted in a significantly reduced lactic acid monomer content of 83.05 mol% in the recombinant strain TGB4-08, indicating that the phaB3 gene did not promote an increase in the lactic acid molar ratio. By knocking out phaB4 in TGB4-08, the lactic acid monomer content in the recombinant strain TGB4-09 was 90.21 mol%, which was significantly higher than that in TGB4-08.

[0168] To achieve the biosynthesis of polylactic acid (PLA), the lldd1 gene was knocked out in the TGB4-09 strain. The resulting recombinant strain TGB4-10 had a lactic acid monomer content of 100 mol% and a PLA yield of 0.36 g / L. The sample was extracted and subjected to 1H NMR spectroscopy analysis. Figure 4 As shown in the figure. The results showed that the sample was pure PLA, with two characteristic peaks appearing after 1.5 min and 5.0 min, respectively. This is also the first time that PLA and a lactic acid-3-hydroxybutyric acid copolyester with a high lactic acid molar ratio have been synthesized in Vibrio saline.

[0169] Example 3: Scale-up culture of recombinant strain TGB4-10 in DL lactic acid-containing medium.

[0170] (1) TGB4-10 monoclonal cells were expanded and cultured according to the method provided in Example 2 to obtain TGB4-10 seed culture as primary seed culture.

[0171] (2) Inoculate 1 mL of bacterial culture into a 500 mL shake flask containing 100 mL of TYS medium (containing 30 g / L lactic acid and 4 g / L γ-butyrolactone) at an inoculation rate of 1%. Incubate at 30°C and 200 r / min for 12 h to obtain a secondary seed culture.

[0172] (3) The secondary seed culture was inoculated into a 5L fermenter containing 2.5L of TYS medium (containing 30g / L lactic acid and 4g / L γ-butyrolactone). The initial temperature of the fermenter was set to 30℃ and the rotation speed was 200rpm.

[0173] (4) If the lactic acid concentration in the reaction system is less than 5 g / L, lactic acid is added at once until the final concentration is 10 g / L (the supplementary lactic acid is 500 g / L lactic acid).

[0174] (5) By adding 28% NH3·H2O, the pH value is automatically maintained at 7.0.

[0175] (6) Samples were taken every 8 hours until fermentation was completed (96 hours). Cell dry weight and PLA4HB yield were determined according to the method provided above, and the yield, content and ratio of PLA4HB to LA and 4HB were calculated.

[0176] The results are as follows Figure 3 As shown, the recombinant strain synthesized PLA4HB after exogenous addition of γ-butyrolactone. The highest yield of PLA4HB was obtained after 88 hours of fermentation, reaching 10.05 g / L. Figure 3 B), the lactic acid unit content is 98 mol% ( Figure 3 A). The sample after 96 hours of fermentation was extracted and subjected to 1H NMR spectroscopy, such as... Figure 5 As shown in the figure. The results indicate that the sample is a copolyester of lactic acid and 4-hydroxybutyric acid. The two characteristic peaks of the lactic acid monomer appeared after 1.5 min and 5.0 min, respectively, while the three characteristic peaks of the 4-hydroxybutyric acid monomer appeared at 2.0 min, 2.5 min, and 4.25 min, respectively. This is also the first time that a copolyester of lactic acid and 4-hydroxybutyric acid with a high lactic acid molar ratio has been synthesized in Vibrio saline.

Claims

1. A recombinant saline vibrio ( Salinivibrio kushneri ), which overexpresses the propionyl-CoA transferase gene ( pct Gene) and polyhydroxy fatty acid ester synthase gene ( phaC1 (genes), the aforementioned pct Genes and phaC1 The gene was integrated into the genome of the recombinant Vibrio salinarum, which is recombinant Vibrio salinarum TGB4, and the preservation number of Vibrio salinarum TGB4 is CGMCC No. 21105; pct Genes originate from Megasphaera elsdenii Its Genbank number is NC_015873.1, and its Gene ID is MELS_RS03915; phaC1 Genes originate from Pseudomonas It is the 909th to 2588th bp fragment of the sequence from the cloning vector pSC101-PhaC-pct with GenBank accession number MN623110.1; and 1) Knockout dld Genes, and they were also knocked out. phaB1 Genes; or 2) Knockout dld Genes and lldd1 Genes, and they were also knocked out. phaB1 Gene, phaB2 Gene, phaB3 Genes and phaB4 Gene; The above dld The gene's GeneBank number is NZ_CP114586.1, and its Gene ID is O4598_RS06205; The lldd1 The gene was knocked out using the sgRNA shown in SEQ ID No. 3; The phaB1 The gene's GeneBank number is NZ_CP114586.1, and its Gene ID is O4598_RS02970; The phaB2 The gene was knocked out using the sgRNA shown in SEQ ID No. 6; The phaB3 The gene's GeneBank number is NZ_CP114586.1, and its Gene ID is O4598_RS03885; and The phaB4 The gene was knocked out using the sgRNA shown in SEQ ID No.

8.

2. A method for producing 3-hydroxybutyrate copolyester (PLA3HB), 4-hydroxybutyrate copolyester (PLA4HB), and / or polylactic acid (PLA), the method comprising the following steps: fermenting and culturing the recombinant saline Vibrio according to claim 1 to obtain PLA3HB, PLA4HB, and / or PLA.

3. The method according to claim 2, wherein the carbon source for fermentation culture is lactic acid, or lactic acid plus γ-butyrolactone.

Images