Application of virulence gene of valsa ceratosperma in prevention and treatment of plant diseases

Abstract

The invention belongs to the technical field of gene engineering, and relates to application of a valsa ceratosperma virulence gene in plant disease control. The invention discloses a valsa pear tree valsa pyri virulence gene VpCYP38, the CDS region sequence of the valsa pear tree valsa pyri virulence gene VpCYP38 is shown as SEQ ID NO: 1, and the virulence of V. pyri is reduced by knocking out the valsa pear tree valsa pyri virulence gene VpCYP38 in V. pyri. The invention further constructs a dsRNA medicament based on the virulence gene VpCYP38 of the valsa ceratosperma, and the dsRNA medicament is targeted to the virulence gene VpCYP38 of the valsa ceratosperma in V. pyri through an exogenous spraying method and is used for preventing and treating plant diseases caused by V. pyri in host plants.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to the application of pathogenic genes of pear tree rot fungus in the prevention and control of plant diseases. Background Technology

[0002] Fungi of the Ascomycota Valsa pyri Pear tree rot caused by this fungus is one of the most serious diseases affecting pear trees. This fungus can cause cankers or branch dieback on pear tree branches, and in severe cases, even destroy the entire orchard. In the process of plant disease control, the use of chemical pesticides is a common method. However, long-term use of chemical pesticides can lead to a series of problems such as pesticide residues and environmental pollution. Therefore, more environmentally friendly disease control methods are gradually becoming a research hotspot.

[0003] In recent years, the development of nucleic acid pesticides based on spray-induced gene silencing (SIGS) technology has become an emerging technology in the field of green control of plant diseases. This technology is a novel plant disease control strategy based on RNA interference (RNAi). Its core is to spray plants with double-stranded RNA (dsRNA) that targets key genes related to the growth, development, or pathogenicity of pathogens, triggering the pathogen's RNA interference pathway. After being taken up by cells, the dsRNA is cleaved into small interfering RNA (siRNA) by nucleases. The siRNA then forms an RNA-induced silencing complex (RISC) with some enzymes and proteins in the body. The siRNA in the RISC recognizes and binds to its complementary target mRNA sequence, and then degrades the mRNA under the action of nucleases, thereby inhibiting the expression of specific genes. As a novel biopesticide, dsRNA has advantages over chemical pesticides, including being environmentally friendly, less prone to resistance development, highly targeted, and having minimal impact on non-target organisms, making it a promising candidate for plant disease control. Summary of the Invention

[0004] The purpose of this invention is to design a gene that targets the pathogenic gene of pear tree rot fungus. VpCYP38 This invention aims to provide a dsRNA agent for the green control of pear tree canker, offering new ideas and technological reserves for its application. To address this need in the field, this invention provides a pathogenic gene of pear tree canker pathogen and its application in conjunction with dsRNA.

[0005] In a first aspect, this invention provides the application of a pathogenic gene of pear tree rot fungus in the prevention and control of plant diseases, wherein the pathogenic gene of pear tree rot fungus is... VpCYP38 , VpCYP38 The CDS region sequence is shown in SEQ ID NO: 1; knockout V. pyri Pathogenic gene of pear tree rot pathogen VpCYP38 ,weakenV. pyri Its toxicity.

[0006] Furthermore, this invention provides the application of a pathogenic gene of pear tree rot fungus in plant disease control, specifically the pathogenic gene of pear tree rot fungus. VpCYP38 The non-conservative region is shown in SEQ ID NO: 2.

[0007] Furthermore, the present invention provides the application of a pathogenic gene of pear tree rot fungus in the prevention and control of plant diseases, wherein the plant is a pear tree and the plant disease is pear tree rot.

[0008] Secondly, this invention provides a gene that inhibits the pathogenicity of pear tree rot fungus. VpCYP38 The expressed dsRNA, the pathogenic gene of the pear tree rot fungus. VpCYP38 The CDS region sequence is shown in SEQ ID NO: 1.

[0009] Furthermore, the gene for inhibiting the pathogenicity of pear tree rot fungus provided by this invention... VpCYP38 The nucleotide sequence of the template DNA for the expressed dsRNA is shown in SEQ ID NO: 2.

[0010] Thirdly, this invention provides a gene that inhibits the pathogenicity of pear tree rot pathogens. VpCYP38 The expressed dsRNA in preparation V. pyri Applications in prevention and control products.

[0011] Furthermore, the gene for inhibiting the pathogenicity of pear tree rot fungus provided by this invention... VpCYP38 The expressed dsRNA in preparation V. pyri In the application of prevention and control products, the aforementioned V. pyri Weakness of prevention products V. pyri Its toxicity.

[0012] Furthermore, the gene for inhibiting the pathogenicity of pear tree rot fungus provided by this invention... VpCYP38 The expressed dsRNA in preparation V. pyri In the application of prevention and control products, the aforementioned V. pyri Prevention and treatment products reduce V. pyri Pathogenicity.

[0013] Fourthly, this invention provides a gene that inhibits the pathogenicity of pear tree rot fungus. VpCYP38 Application of expressed dsRNA in the preparation of products for the prevention and control of pear tree canker, wherein the pathogen of pear tree canker is... V. pyri .

[0014] Fifthly, the present invention provides a method for preventing and controlling pear tree rot disease, comprising: inhibiting the pathogenic genes of pear tree rot pathogens. VpCYP38 dsRNA expressionV. pyri The pathogen causing pear tree rot in the body is... V. pyri .

[0015] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages: This invention utilizes dsRNA (double-stranded RNA) technology to induce pear tree rot pathogens ( V. pyri ) pathogenic genes VpCYP38 The reduction of dsRNA expression levels helps control pear tree rot. Compared to traditional chemical pesticides, dsRNA, as a biological pesticide, is environmentally friendly and less prone to developing resistance. This invention targets specific pathogenic genes of the pear tree rot pathogen. VpCYP38 Designing dsRNAs can precisely target and inhibit the expression of this gene, thereby effectively reducing its expression in host plants. V. pyri The pathogenicity of the disease is reduced, thus achieving the goal of effectively preventing and controlling pear tree rot. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 for VpCYP38 A schematic diagram illustrating the principle of target gene knockout.

[0018] Figure 2 for V. pyri Wild-type strain 134 infects pear branches VpCYP38 Gene expression status.

[0019] Figure 3 for VpCYP38 Gene knockout and reinstatement verification diagram. In this diagram, A represents the four pairs of detections for the mutant, and B represents... VpCYP38 PCR detection of the complement mutant strain; WT is V. pyri Wild type strain 134, ΔVpCYP38 for VpCYP38 Knockout mutant, ΔVpCYP38-C for VpCYP38 Replacement mutant strain; M is VpCYP38 Gene, G418 is NEO Gene, K1 is VpCYP38 Knock out the upstream segment of the box, K2 is VpCYP38 Knock out downstream segments of the box.

[0020] Figure 4 for VpCYP38The growth and pathogenicity test results of the knockout mutant are shown in the following figures: A is the growth phenotype; B is the colony diameter statistics; C is the phenotypic results of disease incidence on infected branches; D is the statistical results of lesion length on infected branches; WT is... V. pyri Wild type strain 134, ΔVpCYP38 for VpCYP38 Knockout mutant, ΔVpCYP38-C for VpCYP38 The mutant strain was reintroduced; CT was the crude extract from empty YEPD medium. ns indicates no significant difference, ** indicates a significant difference. p <0.01.

[0021] Figure 5 for VpCYP38 The graph shows the toxicity test results of the crude secondary metabolite extract of the knockout mutant. Where A represents... VpCYP38 Phenotypic results of pear leaves treated with different concentrations of crude secondary metabolites from the knockout mutant; B represents... VpCYP38 A schematic diagram showing the inoculation sites of the knockout mutant's secondary metabolite crude extract on leaves; C is a statistical result of the necrotic area of ​​pear leaves caused by different concentrations of secondary metabolite crude extract; WT represents... V. pyri Wild type strain 134, ΔVpCYP38 for VpCYP38 Knockout mutant, Δ VpCYP38-C for VpCYP38 The mutant strain was reintroduced; CK was a blank control consisting of crude extract from YEPD empty medium; ns indicates no significant difference, ** indicates a significant difference. p <0.01.

[0022] Figure 6 This is an electrophoretic detection image of dsRNA synthesized in vitro.

[0023] Figure 7 for V. pyri Hyphae and protoplasm absorption of dsRND- GFP The image shows the results of laser confocal microscopy detection. Where A represents... V. pyri Mycelium, B is V. pyri Protoplasm; CK was the blank control.

[0024] Figure 8 Applying exogenous dsRNA- VpCYP38 back V. pyri Pathogenicity detection. Among them, A represents dsRNA- VpCYP38 and V. pyri Phenotypic results of disease incidence in pear branches inoculated with the disease; B represents dsRND- GFP, dsRNA- VpCYP38 respectively with V. pyri Statistical results of disease incidence on inoculated pear branches; C represents dsRND-GFP, dsRNA- VpCYP38 respectively with V. pyri After receiving VpCYP38 Gene expression level analysis results; WT represents... V. pyri Wild-type strain 134, ** indicates significant difference. p <0.01. Detailed Implementation

[0025] The technical solution of the present invention will be described below with reference to embodiments. However, the present invention is not limited to the following embodiments. Unless otherwise specified, the experimental and detection methods described in each embodiment are conventional methods; the reagents and materials described are commercially available unless otherwise specified. Unless otherwise specified, all percentages in the following embodiments refer to mass percentages. Unless otherwise specified, all proportions in the following embodiments refer to mass ratios.

[0026] The test materials in the following examples were sourced from the following sources: (1) Test culture medium and reagents High-agar PDA medium: Peel and cut 200g of potatoes into pieces, boil them in double-distilled water for 30 minutes, filter them through gauze into a 1L measuring cup, add 20g of glucose and 30g of agar and stir well, bring the volume to 1L with double-distilled water, and autoclave at 121℃ for 21 minutes.

[0027] YEPD medium: Add 10g yeast extract, 10g tryptone and 20g glucose to a 1L measuring cup, dissolve with double-distilled water and bring the volume to 1L, autoclave at 121℃ for 21min.

[0028] TB3 medium: Add 3g yeast extract, 3g acid-hydrolyzed casein and 200g sucrose to a 1L measuring cup, dissolve with double-distilled water and bring the volume to 1L, autoclave at 121℃ for 21min.

[0029] (2) Test strains Pear tree rot pathogen ( V. pyri The pathogen of pear tree rot was isolated and preserved by the Fruit Tree Disease Pathogenic Biology and Integrated Management Research Team of the College of Plant Protection, Northwest A&F University. ∆VpCYP38 Knockout mutants and ∆VpCYP38-C The reintroduced strains were knocked out, reintroduced, and preserved by the Fruit Tree Disease Pathogenic Biology and Integrated Management Research Team of the College of Plant Protection, Northwest A&F University.

[0030] (3) Test reagents dsRNA- GFP With dsRNA- VpCYP38 It was synthesized and purified by the Fruit Tree Disease Pathogenic Biology and Integrated Management Research Team of the College of Plant Protection, Northwest A&F University.

[0031] (4) Test materials pear( Pyrus bretschneideri One-year-old detached branches (Rehd.) were used to determine the pathogenicity of the pathogen, and detached leaves were used to determine the pathogenicity of the pathogen and the toxicity of the crude metabolic extract. All samples were collected from the Economic Arboretum of the South Campus of Northwest A&F University, Yangling District, Xianyang City, Shaanxi Province.

[0032] (5) Test primers The test primers are shown in Table 1 below, and all were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0033] Table 1 Test primers

[0034] (6) Test sequence VpCYP38 dsRNA-VpCYP38 is a 423bp amplification of the non-conserved region of VpCYP38, with the sequence (SEQ ID). NO: 2): GGCGGCTTCAGATGCTTTTCTACTAAATGTTGCCTGGCGCAAATGGGGGCCTTCGTCGTACACGCCTAGCCAACTCCATGGCTACCTCATCTTCTTGGCTCTCATGGTGGTTGCATGTCTGGGGATGGGCATTCTTTAGACTGATTGTGAAGCCCAAGTATTTGTCGCCTATGCGGCATCTACCAGAACCAACAGTGAGTGGCACTA TCTACAACTACAACCCCTGGAGATTTGAACCCATCGTTCCCCAATATACATTCGACAAGTCTAACTCAGGTTACAGGAAGGTAGAAGCTGGTGGTTCGGGTACGGTGGACGTACATTCACGGAGGGTAACGGAGCCGGTCCTGCTGAATGGTAAGTGTTACAATACAATGTCTTCCCTCCACACCTTCTGACATGATCATCGCTTAGGTCACGA.

[0035] Example 1 This embodiment provides V. pyri Key pathogenic factors CYP450 Gene screening and knockout.

[0036] (1) CYP450 Gene screening exist V. pyri All annotations were obtained from transcriptome data of pear branches in the early (12h) and late (72h) stages of infection. CYP450 Gene and expression level data were collected, and a total of 48 genes were identified. CYP450 Genes, among which VpCYP38 Its expression was significantly upregulated in both the early and late stages of infection, suggesting that it may be related to... V. pyri It plays a crucial role in the infection process, therefore the gene... VpCYP38 As V. pyri Candidate key pathogenic factors CYP450 Further research will be conducted on the genes.

[0037] (2) VpCYP38 gene knockout Reference Figure 1 The schematic diagram shown is for reference. V. pyri Genome sequence, designed for amplification using Primer 5.0. VpCYP38Primers for upstream and downstream homologous arms L / R VpCYP38 -AF / AR, VpCYP38 -BF / BR, and in VpCYP38 -AR and VpCYP38 Add resistance genes to BF NEO The adapter sequence of the gene, and the detection primers used to detect whether the knockout cassette has been successfully inserted into the genome. VpCYP38 -K1F / K1R, VpCYP38 -K2F / K2R and used to detect the replacement target gene NEO Gene primers G418 -F / R. (This likely refers to a specific type of torrent or emulation.) V. pyri Using wild-type strain genomic DNA as a template, primers were used... VpCYP38 -AF / AR, VpCYP38 -BF / BR amplification respectively VpCYP38 Fragments approximately 1500 bp each upstream (L) and downstream (R) of the gene were used in double-joint PCR to... VpCYP38 Upstream homology arm L- NEO - VpCYP38 Downstream homologous arms R are linked to the same sequence, and a large amount of DNA product is obtained after purification. VpCYP38 Knockout box.

[0038] Will V. pyri Newly formed hyphae at the colony edge of wild-type strain 134 were transferred into 100 mL of YEPD medium and incubated at 25°C and 110 rpm for 48 h. The hyphae were then collected using a sterile filter cloth, rinsed twice with sterile ddH₂O, and repeatedly rinsed with 1.2 M KCl solution before squeezing to remove excess water. The pre-prepared enzyme hydrolysate was added to the hyphae at a rate of 10 mL per 0.7 g of hyphae, and the mixture was shaken at 30°C and 90 rpm for 2 h until all protoplasmic spheres were visible under a microscope. 5–10 μg of the solution was then used. VpCYP38 The knockout fragment was added to the protoplasm and gently swirled to mix. After standing at room temperature for 20 minutes, 1 mL of PTC buffer was slowly added, followed by another 20 minutes of standing. Then, 5 mL of TB3 liquid medium was added to each tube, and the tubes were incubated at 25°C and 90 rpm for 24 hours until protoplasts formed clumps of mycelium. The cultured mycelium was poured into 100 mL of TB3 solid medium, which had been melted and cooled to approximately 45°C. Genimycin G418 was added to a final concentration of 70 μg / mL, and the tubes were inverted. After solidification, the tubes were incubated at 25°C for 12 hours. This process was repeated, and the tubes were incubated upside down in the dark at 25°C until transformants appeared on the surface. Individual transformants were picked out and inoculated onto PDA plates containing 150 μg / mL genimycin G418 for subsequent validation.

[0039] use VpCYP38-MF / MR primers were used to perform PCR detection on the genomic DNA of all mutants to screen for transformants lacking the target gene; then, using VpCYP38 -MF / MR, VpCYP38 -K1F / K1R, VpCYP38 PCR detection was performed using K2F / K2R and G418-F / R. Transformants that could not amplify the target gene but amplified the other three fragments were considered positive transformants indicating homologous recombination of the target gene. VpCYP38 Knockout mutants.

[0040] (3) VpCYP38 Gene replacement by V. pyri Using wild-type strain 134 genomic DNA as a template, and employing complement primers... VpCYP38 -CF / CR amplification VpCYP38 The full-length sequence from approximately 1500 bp upstream of the start codon to the stop codon was amplified. The amplified sequence was then constructed into the PDL2 vector. The constructed recombinant PDL2- VpCYP38 The vector was transferred into the protoplast using PEG-mediated protoplast transformation. VpCYP38 The protoplasm of the deletion mutant was used to screen transformants for hygromycin resistance, and then... VpCYP38 -MF and VpCYP38 PCR detection was performed using -MR primers; the correct result indicates that... VpCYP38 The complement strain of the deletion mutant ( VpCYP38 (Completion of mutant strains).

[0041] (4) VpCYP38 Knockout mutant growth assay In activation V. pyri Wild type strain 134, VpCYP38 Knockout mutants and VpCYP38 5 mm diameter mycelial discs were taken from the edge of the mutant strain and transferred to PDA plates containing 12.5 mL. After incubation at 25°C in the dark for 48 h, the colony morphology was observed and the colony diameter was measured using the cross-cross method. All experiments were performed in triplicate, with three biological replicates and three technical replicates.

[0042] (5) VpCYP38 Knockout mutant pathogenicity testing Determination using detached branch method V. pyri Wild type strain 134, VpCYP38 Knockout mutants and VpCYP38 To restore the pathogenicity of the mutant strain, healthy, uniformly sized one-year-old pear branches were collected, cut into small sections, and disinfected with a 0.7% sodium hypochlorite solution for 15 minutes. Wounds were created on the branch surface using a 5mm diameter punch, and the activated pear branches were then... V. pyriWild type strain 134, VpCYP38 Knockout mutants and VpCYP38 A 5mm diameter bacterial cake was taken from the edge of the colony of the mutant strain and inoculated onto the wound. After incubation at 25°C in the dark for 3 days, the diameter of the lesion was measured and photographed. All the above experiments were performed in 3 biological replicates and 3 technical replicates.

[0043] (6) VpCYP38 Preparation and toxicity assay of crude extracts of secondary metabolites from knockout mutants Will V. pyri Wild type strain 134, VpCYP38 Knockout mutants and VpCYP38 The complemented mutant strain was cultured in YEPD medium at 25°C and 100 rpm for 10 days. The results were compared with those in empty YEPD medium. V. pyri Wild type strain 134, VpCYP38 Knockout mutants and VpCYP38 The fermentation broth of the mutant strain was extracted three times with ethyl acetate, and the organic phase was concentrated to obtain crude secondary metabolites. All crude extracts were dissolved in 10% methanol to three concentration gradients: 5 mg / mL, 10 mg / mL, and 20 mg / mL. Toxicity tests were conducted on pear leaves using the puncture method. The crude extract of YEPD was used as a control, and the necrotic area was photographed and recorded 72 hours after treatment. The area of ​​necrotic lesions was calculated using ImageJ software. All experiments were performed with three biological replicates and three technical replicates.

[0044] Example 2 This embodiment provides VpCYP38 The pathogenicity of the knockout mutant and the toxicity of the crude extract of its secondary metabolites.

[0045] (1) VpCYP38 Genes in V. pyri Expression during the infection stage Through the V. pyri Analysis of transcriptome data from wild-type strain 134 mycelia (0h) and pear branches infected for 12h and 72h revealed a gene with accession number VP1G_08287. V. pyri The expression of mycelium was significantly upregulated at 12h and 72h compared to the 0h sample, with an upregulation of 309.6-fold at 12h and 22.1-fold at 72h (e.g., ...). Figure 2 As shown), it is speculated that this gene is in V. pyri It plays a crucial role in the infection and pathogenesis process. According to genome annotation, this gene is a single... CYP450 Gene, named VpCYP38 .

[0046] (2) VpCYP38 Knockout mutants and VpCYP38Obtaining and validating the complement mutant strain Using PEG-mediated protoplast transformation VpCYP38 Knockout was performed, and the candidate transformants were detected by PCR using four pairs of primers. The results are as follows: Figure 3 As shown. This invention successfully obtained 1 VpCYP38 Knockout mutant ΔVpCYP38 ( Figure 3 (A) in the knockout mutant. VpCYP38 Gene replacement was successfully achieved through PCR testing. VpCYP38 Replacement mutant strain ΔVpCYP38-C ( Figure 3 (B in the middle).

[0047] (3) VpCYP38 Pathogenicity of knockout mutants right ΔVpCYP38 Growth assays of the strain revealed that... ΔVpCYP38 mutants and ΔVpCYP38-C The growth status of the strain and V. pyri The growth of wild-type strain 134 showed no significant difference, indicating that... VpCYP38 The deletion of a gene does not affect growth. Figure 4 A in Figure 4 (B in the text). By V. pyri Wild type strain 134, ΔVpCYP38 and ΔVpCYP38-C The strain was inoculated on pear branches, and the length of the lesions was counted 3 days later. It was found that the inoculated strain... ΔVpCYP38 The length of the lesions caused after vaccination was shorter than that after inoculation. V. pyri The lesion length induced by wild-type strain 134 was reduced by 43%. ΔVpCYP38-C The length of the lesions caused to recover to V. pyri Wild-type strain 134 caused the same level of lesion length ( Figure 4 C in Figure 4 (D in the text) indicates knockout VpCYP38 gene Can reduce V. pyri Pathogenicity.

[0048] (4) VpCYP38 Toxicity of crude extracts from the secondary metabolites of the knockout mutant To further explore VpCYP38 How to influence V. pyri The toxicity will V. pyri Wild type strain 134, Δ VpCYP38 , ΔVpCYP38-CAfter 10 days of shake-fermentation on YEPD medium, the secondary metabolites were extracted with ethyl acetate to obtain crude extracts. Using the crude extract from empty YEPD medium as a control, the crude extracts from empty YEPD medium and the crude extracts from the three strains were dissolved in 10% methanol to obtain solutions with three gradient concentrations: 5 mg / mL, 10 mg / mL, and 20 mg / mL. Fresh pear leaves were treated with these solutions of different concentrations of secondary metabolite crude extracts, and the necrotic area of ​​the leaves was observed and counted after 72 hours. The results showed that none of the three concentrations of crude extract from empty YEPD medium induced necrosis symptoms in pear leaves, while... V. pyri Wild type strain 134, Δ VpCYP38 , ΔVpCYP38-C Three concentrations of crude extracts of the strain's secondary metabolites all induced necrosis symptoms in pear leaves to varying degrees. Figure 5 A in Figure 5 B in Figure 5 (C in the text). ΔVpCYP38 The necrotic area caused by the three concentrations of crude secondary metabolites was compared to V. pyri Wild-type strain 134 was significantly reduced ( Figure 5 A in Figure 5 B in Figure 5 (C in the text). ΔVpCYP38-C The necrotic area induced by three concentrations of crude secondary metabolites recovered to [the desired level]. V. pyri Wild-type strain 134 at the same level ( Figure 5 A in Figure 5 B in Figure 5 (C in the text). The above results indicate that, by VpCYP38 The regulation of secondary metabolites V. pyri It made a significant contribution to the toxicity, namely VpCYP38 yes V. pyri It is an important virulence factor and a potential target of dsRNA.

[0049] Example 3 This embodiment provides dsRNA- VpCYP38 In vitro synthesis method.

[0050] (1) Fluorescein-labeled dsRNA- GFP In vitro synthesis First, using primers GFP -T7-F / GFP -R and GFP -F / GFP-T7-R amplifies templates containing the T7 promoter, yielding transcription template 1 and transcription template 2, respectively. In vitro transcription is then performed using T7 RNA ploymerase and Fluorescein RNA Labeling Mix to ultimately obtain fluorescently labeled dsRNA- GFP The complex was prepared as shown in Table 2. The reaction system was placed in a PCR instrument and reacted at 37°C for 2 hours. After adding 2 μL of DNase I, the reaction was continued at 37°C for 15 minutes. Finally, 2 μL of 0.2M EDTA was added to stop the reaction.

[0051] Table 2. Fluorescent labeling of dsRNA- GFP In vitro synthesis reaction system

[0052] (2) dsRNA- VpCYP38 In vitro synthesis Using primers VpCYP38 -T7-F / VpCYP38 -R and VpCYP38 -F / VpCYP38 -T7-R amplified fragments with the T7 promoter at the 5' end of the sense strand and the antisense strand, respectively, to obtain transcription template 1 and transcription template 2. In vitro synthesis was performed using the Novizan T7 RNAi Transcription Kit. The PCR reaction system is shown in Table 3. The reaction was carried out at 37℃ for 2 hours in a PCR instrument. The synthesized dsRNA was treated with DNase I / RNase T1 and purified to remove residual DNA template and single-stranded RNA. Finally, the product concentration was measured and stored at -20℃ for later use.

[0053] Table 3 dsRNA- VpCYP38 In vitro synthesis reaction system

[0054] (3) Observation by confocal microscope V. pyri Hyphae absorption of dsRNA dsRNA- was labeled with 20 μL of 50 ng / μL fluorescent dye. GFP deal with V. pyri Wild-type strain 134 hyphae were incubated at 25°C for 10-12 hours and then treated with 75U nuclease at 37°C for 30 minutes. The treated hyphae were then used to prepare protoplasm, and the fluorescence signals of the hyphae and protoplasm were observed using an LSM880 confocal microscope.

[0055] (4) dsRNA treatment and pathogenicity assay Create wounds on fresh, sterilized one-year-old pear branches using a 5mm punch, and inject 20μL of dsRNA at a concentration of 50ng / μL. GFP With dsRNA- VpCYP38 Apply drops to the wounds on the pear branches, then apply 5mm diameter drops to each wound. V. pyri Wild-type strain 134 bacterial discs were inoculated at the same locations where dsRNA was added, and cultured at 25°C for 1, 3, 5, and 7 days. The diameter of the lesions was measured and photographed. All experiments were performed in triplicate (three biological replicates and three technical replicates).

[0056] Example 4 This embodiment provides exogenous dsRNA- VpCYP38 right V. pyri The impact of pathogenicity.

[0057] (1) dsRNA- VpCYP38 In vitro synthesis verification A universal gene was successfully synthesized in vitro. GFP The dsRNA band size is 720bp (e.g. Figure 6 As shown), the target gene was successfully synthesized. VpCYP38 The non-conserved region band size is 423 bp dsRNA (e.g. Figure 6 (As shown).

[0058] (2) V. pyri Hyphae can absorb dsRNA- GFP dsRNA labeled with fluorescent dye GFP deal with V. pyri Wild-type strain 134 hyphae were analyzed to determine whether it could absorb dsRNA. After incubation for 10 h, the mycelium was treated with nuclease for 30 min, and protoplasm was prepared. Confocal microscopy observations showed that it could absorb dsRNA- GFP After processing V. pyri Fluorescent signals were observed in the mycelial samples of wild-type strain 134. Figure 7 (A in the text), and simultaneously, fluorescence signals can also be observed in the protoplasm ( Figure 7 B in the text indicates that... V. pyri It can absorb dsRNA.

[0059] (3) External application of dsRNA- VpCYP38 right V. pyri Effects of pathogenicity 20 μL of dsRNA at a concentration of 50 ng / μL was added. GFP With dsRNA- VpCYP38 Apply drops to the wounds on pear branches, then inoculate the branches at the same locations where dsRNA was applied. V. pyriWild-type strain 134 mycelial cake. Pathogenicity test results showed that... V. pyri Wild-type strain 134 was co-inoculated with dsRNA (dsRNA- GFP With dsRNA- VpCYP38 After 1d, 3d, 5d and 7d, with dsRNA- GFP In comparison, dsRNA- VpCYP38 Total vaccination V. pyri The lesion area produced by wild-type strain 134 was significantly reduced. Figure 8 A in Figure 8 (B in the text). RT-qPCR analysis revealed that exogenous application of dsRNA (dsRNA- GFP With dsRNA- VpCYP38 After 1 day, 3 days, 5 days, and 7 days, compared to exogenous application of dsRNA- GFP Exogenous application of dsRNA- VpCYP38 Can make V. pyri Wild-type strain 134 VpCYP38 The expression levels of all three were significantly reduced. Figure 8 (C in the text). In summary, exogenous application of dsRNA- VpCYP38 After suppression V. pyri middle VpCYP38 The expression reduced V. pyri Pathogenicity.

[0060] As described above, the basic principles, main features, and advantages of the present invention have been well described. The above embodiments and specifications are merely descriptions of preferred embodiments of the present invention, and the present invention is not limited to the above embodiments. Various changes and improvements made to the technical solutions of the present invention by those skilled in the art without departing from the spirit and scope of the present invention should fall within the protection scope defined by the present invention.

Claims

1. The application of pathogenic genes of pear tree rot pathogens in plant disease control, characterized in that, The pathogenic gene of the pear tree rot pathogen is: VpCYP38 , VpCYP38 The CDS region sequence is shown in SEQ ID NO: 1; Knockout V. pyri Pathogenic gene of pear tree rot pathogen VpCYP38 ,weaken V. pyri Its toxicity.

2. The application according to claim 1, characterized in that, Pathogenic genes of pear tree rot pathogen VpCYP38 The non-conservative region is shown in SEQ ID NO:

2.

3. The application according to claim 1, characterized in that, The plant in question is a pear tree, and the plant disease is pear tree rot.

4. A gene that inhibits the pathogenicity of pear tree rot pathogens. VpCYP38 The expressed dsRNA is characterized by, The pathogenic gene of the pear tree rot pathogen VpCYP38 The CDS region sequence is shown in SEQ ID NO:

1.

5. The gene for inhibiting the pathogenicity of pear tree rot pathogen as described in claim 4. VpCYP38 The expressed dsRNA is characterized by, The nucleotide sequence of the template DNA for the dsRNA is shown in SEQ ID NO:

2.

6. The gene for inhibiting the pathogenicity of pear tree rot pathogen as described in claim 4 VpCYP38 The expressed dsRNA in preparation V. pyri Applications in prevention and control products.

7. The application according to claim 6, characterized in that, The V. pyri Weakness of prevention products V. pyri Its toxicity.

8. The application according to claim 6, characterized in that, The V. pyri Prevention and treatment products reduce V. pyri Pathogenicity.

9. The gene for inhibiting the pathogenicity of pear tree rot pathogen as described in claim 4 VpCYP38 The application of expressed dsRNA in the preparation of products for the control of pear tree canker is characterized by, The pathogen causing the pear tree rot disease is... V. pyri .

10. A method for controlling pear tree rot disease, characterized in that, include: The gene for inhibiting the pathogenicity of pear tree rot fungus as described in claim 4 VpCYP38 dsRNA expression V. pyri The steps within the body, the pathogen causing the pear tree rot disease is... V. pyri .

Images