Application of transcription factor CaABF3 in regulation and control of pepper fruit maturity

Abstract

The invention discloses application of a transcription factor CaABF3 in regulation and control of pepper fruit maturity. The invention relates to the technical field of plant genetic engineering, and provides any one of the following applications of CaABF3 protein: regulating and controlling ripening of plant fruits; the content of carotenoid in the plant fruits is regulated and controlled; the content of abscisic acid in the plants is regulated and controlled; the CaABF3 protein is a protein of which the amino acid sequence is SEQ ID NO: 1. A target fragment of the CaABF3 gene is amplified in pepper, a VIGS vector is constructed, and it is found that accumulation of carotenoids in pepper fruits can be reduced and fruit ripening can be delayed by inhibiting expression of the CaABF3 gene, so that the shelf life of the pepper is prolonged. Therefore, the CaABF3 gene plays an important role in metabolism of capsicum carotenoid, and has important significance on appearance and market value of fruits.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to the application of transcription factor CaABF3 in regulating the ripening of pepper fruits. Background Technology

[0002] chili( Capsicum Chili peppers (spp.) are an important global horticultural crop with significant economic and edible value. According to FAO (2024) data, the global planting area of ​​chili peppers reached 4.47 million hectares in 2022, ranking ninth among vegetable crops. Currently, my country has become the world's largest producer, consumer, and exporter of chili peppers (Wang Lihao et al., 2021).

[0003] Chili peppers are rich in carotenoids, vitamins, and capsaicin. They can be eaten fresh or processed into condiments or used to extract bioactive substances (Hernández-Pérez et al., 2020). Fruit ripening is crucial to the quality and commercial value of chili peppers. For varieties harvested or processed as fully ripe fruit, ripening effectively promotes the biosynthesis and accumulation of nutrients such as capsaicin. However, for varieties harvested as unripe fruit, the physiological changes caused by ripening, such as fruit turning red and flesh softening, often lead to a deterioration in appearance and a significant reduction in commercial value. Furthermore, as a non-climacteric fruit rich in carotenoids, the ripening regulation mechanism of chili peppers differs from that of climacteric fruits like tomatoes and anthocyanin-accumulating fruits like strawberries (Giovannoni et al., 2004; Xiao et al., 2020; Li et al., 2023). Therefore, in-depth analysis of the regulatory mechanism of chili fruit ripening can not only improve the theory of fruit ripening regulation, but also provide theoretical support for improving fruit quality, extending shelf life, and optimizing post-harvest treatment, and provide theoretical support for future chili genetic engineering breeding.

[0004] ABF (ABA-responsive element-binding factors) family transcription factors are important components of the ABA signaling pathway. They mainly participate in plant growth, development, and stress responses by responding to abscisic acid (ABA) signaling. Summary of the Invention

[0005] The purpose of this invention is to provide the application of transcription factor CaABF3 in regulating the ripening of pepper fruit.

[0006] In a first aspect, the present invention claims protection for the use of the CaABF3 protein in any of the following: P1. Regulates the ripening of plant fruits; P2. Regulates the content of carotenoids in plant fruits; P3. Regulates the content of abscisic acid in plants. The CaABF3 protein can be any of the following: (A1) A protein with the amino acid sequence SEQ ID NO:1; (A2) A protein derived from chili peppers that has the same function as the amino acid sequence shown in SEQ ID NO:1, by substitution and / or deletion and / or addition of one or more amino acid residues. (A3) has 99%, 95%, 90%, 85% or 80% or more of the same amino acid sequence as any of (A1)-(A2) and is derived from a chili pepper and has the same function. (A4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of any of the proteins defined in (A1)-(A3).

[0007] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using identity search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.

[0008] In the aforementioned proteins, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 85% or more identity can be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 95% or more identity can be at least 95%, 96%, 97%, 98%, or 99% identity.

[0009] In the application, the expression level and / or activity of the CaABF3 protein in the plant are reduced, the fruit ripening of the plant is delayed and / or the content of carotenoids and / or abscisic acid in the fruit is reduced.

[0010] In the aforementioned application, the ripening of the plant fruit can be regulated by controlling the content of carotenoids in the fruit.

[0011] In some embodiments, the carotenoids in the fruit refer to the carotenoids in the pericarp. In some embodiments, the abscisic acid in the plant refers to the abscisic acid in the pericarp. The same applies below.

[0012] Secondly, the present invention claims protection for the use of substances capable of reducing the expression level and / or activity of CaABF3 protein in plants in any of the following: Q1. Delay the ripening of plant fruits; Q2. Reduce the carotenoid content in plant fruits; Q3. Reduce the content of abscisic acid in plants.

[0013] The CaABF3 protein may be any one of those described in (A1)-(A4) above.

[0014] The regulation (reduction) of the expression level and / or activity of the CaABF3 protein in the plant by the substance can be at the gene transcription level, or at the post-transcriptional level (i.e., regulation of splicing or processing of primary transcripts), or regulation of RNA transport (i.e., regulation of mRNA transport from the nucleus to the cytoplasm), or regulation of translation.

[0015] Thirdly, the present invention claims protection for a method for delaying the ripening of plant fruits.

[0016] The method for delaying fruit ripening claimed in this invention may include the following steps: reducing the expression level and / or activity of CaABF3 protein in the plant, thereby delaying fruit ripening.

[0017] The CaABF3 protein may be any one of those described in (A1)-(A4) above.

[0018] Fourthly, the present invention claims a method for reducing the content of carotenoids in plant fruits.

[0019] The method for reducing the content of carotenoids in plant fruits, as claimed in this invention, may include the following steps: reducing the expression level and / or activity of CaABF3 protein in the plant, thereby reducing the content of carotenoids in the fruit of the plant.

[0020] The CaABF3 protein may be any one of those described in (A1)-(A4) above.

[0021] Fifthly, the present invention claims a method for reducing the content of abscisic acid in plants.

[0022] The method for reducing the content of abscisic acid in plants claimed in this invention may include the following steps: reducing the expression level and / or activity of CaABF3 protein in the plant, thereby reducing the content of abscisic acid in the plant.

[0023] The CaABF3 protein may be any one of those described in (A1)-(A4) above.

[0024] In the third to fifth aspects above, reducing the expression level and / or activity of the CaABF3 protein in the plant can be achieved by inhibiting the expression of the gene encoding the CaABF3 protein in the plant.

[0025] In some embodiments, the suppression of the expression of the gene encoding the CaABF3 protein in the plant is achieved by introducing a VIGS vector carrying the DNA fragment shown at positions 436-735 of SEQ ID NO:2 into the plant. In some embodiments, the VIGS vector consists of a pTRV1 vector and a pTRV2-GFP-CaABF3 vector; the pTRV2-GFP-CaABF3 vector is a recombinant vector obtained by cloning the DNA fragment shown at positions 436-735 of SEQ ID NO:2 into the pTRV2-GFP vector.

[0026] In the aforementioned relevant aspects, the content of carotenoids in the plant fruit can specifically refer to the total carotenoid content in the plant fruit.

[0027] In all the aforementioned relevant aspects, the gene encoding the CaABF3 protein may be any of the following: (B1) The DNA molecule shown in SEQ ID NO:2; (B2) A DNA molecule that hybridizes under stringent conditions with the DNA molecule defined in (B1) and encodes the CaABF3 protein; (B3) is a DNA molecule that has 99%, 95%, 90%, 85% or 80% identity with the DNA sequence defined by (B1) or (B2) and encodes the CaABF3 protein.

[0028] The stringent conditions for the above-mentioned genes can be as follows: hybridization at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 2×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 1×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 0.5×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 0.1 ...7% SDS, 0.5M Na3PO4, and 1mM EDTA; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 0.1×SSC and 0.1% SDS. Hybridize in a mixed solution of SDS, 0.5 M Na3PO4 and 1 mM EDTA, and wash at 65 °C with 0.1 × SSC and 0.1% SDS; alternatively, hybridize in a solution of 6 × SSC and 0.5% SDS at 65 °C, and then wash once each with 2 × SSC and 0.1% SDS and 1 × SSC and 0.1% SDS.

[0029] For the genes mentioned above, nucleotide sequence identity can be determined using identity search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastn as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of nucleotide sequences to calculate the identity value (%), then the identity value can be obtained.

[0030] In the aforementioned genes, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 85% or more identity can be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 95% or more identity can be at least 95%, 96%, 97%, 98%, or 99% identity.

[0031] In the aforementioned relevant aspects, the plant may be any of the following: (C1) Dicotyledonous plants; (C2) Plants of the Solanaceae family; (C3) Plants of the Capsicum genus; (C4) Chili pepper.

[0032] This invention amplifies in chili peppers CaABF3 The target gene fragment was used to construct the VIGS vector and identify the repressor. CaABF3 Gene expression can reduce the accumulation of carotenoids in pepper fruits, delay fruit ripening, and thus extend the shelf life of peppers. Therefore, CaABF3 Genes play an important role in the metabolism of carotenoids in peppers, which is significant for the appearance and market value of the fruit. Attached Figure Description

[0033] Figure 1 Silence in the embodiments of the present invention CaABF3 Fruit phenotypic analysis of genes. Scale bar is 1.5cm.

[0034] Figure 2 In response to silence CaABF3 In the fruit of the gene-modified pepper and the control fruit CaABF3 The level of expression.

[0035] Figure 3 In response to silence CaABF3 Detection of abscisic acid content in chili pepper fruits with the gene and control fruits.

[0036] Figure 4 For silence CaABF3 Detection of total carotenoid content in the pericarp of chili peppers with genetic modification and control fruits. Detailed Implementation

[0037] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0038] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0039] The amino acid sequence of the CaABF3 protein involved in the following examples is shown in SEQ ID NO:1, and its encoding gene sequence is shown in SEQ ID NO:2.

[0040] The pTRV1 plasmid, pTRV2-GFP vector, and pepper 16C391 (a sweet pepper inbred line 16C391) used in the following examples are described in "Song Y, Cheng Q, Li X, Ma S, Shen H, Sun L. The MADS-Box Transcription Factor CaRIN Positively Regulates Chlorophyll Degradation During Pepper ( Capsicum annuum L.) Fruit Ripening by Repressing the Expressionof CaLhcb-P4 . Plants The article "2025; 14(3):445" is available to the public from the applicant and may only be used to repeat the experiments of this invention and may not be used for other purposes.

[0041] Example 1, Suppression CaABF3 Gene expression delays pepper fruit ripening 1. Chili peppers CaABF3 Construction of VIGS gene vector according to CaABF3 Specific primers with EcoRI and BamHI restriction sites were designed for the target fragment of the gene (positions 436-735 of SEQ ID NO:2), as follows (5'-3'): Upstream primer: GTGAGTAAGGTTACC GAATTC GAGGAGTTCTTGGTGAAGGCCGG GG; Downstream primer: CTGAGCTCGGTACC GGATCCGTTACCATTGTTCGATAATTGCATA.

[0042] In the primers above, the underlined portion represents the restriction enzyme site, and the subsequent sequence is... CaABF3 The target segment of the gene is a specific sequence.

[0043] Using pepper 16C391 as the research object, RNA was extracted from the pepper fruit according to the instructions of the RNA extraction kit (TIANGEN).

[0044] Using the extracted RNA as a template, RT-PCR was performed using a one-step RT-PCR kit (PrimeScript™ One Step RT-PCR Kit, TAKARA). The RT-PCR system consisted of: 2 μL PrimeScript 1Step Enzyme Mix, 25 μL 2×1Step Buffer (Dye Plus), 1 μL each of 1 μM upstream and downstream primers, 1 μL capsicum RNA, and 20 μL ddH2O.

[0045] Expanding chili peppers CaABF3 The amplification procedure for a one-step RT-PCR of a gene fragment is as follows: 50℃ for 30 min; 95℃ for 2 min; 95℃ for 30 s, 60℃ for 30 s, 72℃ for 1 min, 35 cycles.

[0046] The RT-PCR product was detected by agarose gel electrophoresis, and the target fragment size was 342 bp.

[0047] The target fragment was recovered using a gel extraction kit (TIANGEN). The gel-extracted product was then ligated into the pTRV2-GFP vector and incubated in a metal bath at 37°C for 35 min. The ligation system was as follows: 1 μL of 5×CE II Buffer, 0.5 μL of Exnase II, 2 μL of pTRV2-GFP vector, and 1.5 μL of the target fragment (ClonExpress® II One Step Cloning Kit).

[0048] The ligation product was transformed into competent E. coli DH5α cells as follows: E. coli competent cells were removed from the -80℃ freezer and thawed on ice. 5 μL of the ligation system was added to 50 μL of competent cells, and the mixture was gently shaken and mixed. After incubating on ice for 30 min, the cells were heat-shocked at 42℃ for 80 s, followed by an ice bath for 3-5 min. Then, 700 μL of LB liquid medium was added, and the cells were incubated at 37℃ in a shaker at 180 rpm for 1 h. After centrifugation at 4500 rpm for 1 min, the supernatant was discarded, and the entire bacterial culture was spread onto LB solid medium (100 μg / mL Kana) and incubated overnight at 37℃ inverted.

[0049] Eight single clones were picked from each plate using a pipette tip and placed in 1 ml of LB liquid medium (100 μg / mL Kana). The culture was incubated at 37°C and 180 rpm in a shaker until the culture became turbid, and then sequenced.

[0050] The plasmid was extracted from the correctly sequenced bacterial culture according to the method in the plasmid miniprep kit (TIANGEN) and named pTRV2-GFP-CaABF3. The structural description of pTRV2-GFP-CaABF3 is as follows: the recombinant plasmid obtained by inserting the DNA fragment shown in positions 436-735 of SEQ ID NO:2 between EcoRI and BamHI of the pTRV2-GFP vector.

[0051] II. Transformed Chili Peppers and Identification of Their Characteristics 1. Transformation of Agrobacterium The pTRV2-GFP-CaABF3 plasmid and the pTRV2-GFP empty vector plasmid were transformed into Agrobacterium GV3101 competent cells according to the following steps: 5 μL of pTRV2-GFP-CaABF3 plasmid was added to 50 μL of Agrobacterium GV3101 competent cells. After gentle mixing, the cells were placed in an ice-water bath for 10 min, treated with liquid nitrogen for 5 min, and then incubated in a 37℃ water bath for 5 min. After removal, the cells were placed on an ice-water bath for 5 min, and then 700 μL of liquid LB medium was added. The cells were then cultured in a shaker at 28℃ and 180 rpm for 3-4 h.

[0052] Take 100 μL of bacterial culture and spread it evenly on solid LB medium (100 μg / mL Kana, 50 μg / mL Rif), then invert it and incubate in the dark at 28°C for 2 days.

[0053] Pick a single colony and place it in 1 ml of liquid LB medium (100 μg / mL Kana, 50 μg / mL Rif). Incubate at 28°C and 200 rpm for 24 h until the bacterial culture becomes turbid. Add an equal volume of 60% glycerol to the positive single colony culture, flash freeze in liquid nitrogen, and store at -80°C for later use.

[0054] The recombinant Agrobacterium that was transformed into the pTRV2-GFP-CaABF3 plasmid was named GV3101 / pTRV2-GFP-CaABF3, and the recombinant Agrobacterium that was transformed into the pTRV2-GFP empty vector plasmid was named GV3101 / pTRV2-GFP.

[0055] Meanwhile, the pTRV1 plasmid was introduced into Agrobacterium strain GV3101 to obtain recombinant Agrobacterium, named GV3101 / pTRV1.

[0056] 2. Identification of infected chili peppers and their characteristics (1) Observation of infection of peppers and phenotypic characteristics The procedure for infecting plants with Agrobacterium is as follows: 3-4 days before injection, recombinant Agrobacterium GV3101 / pTRV1, GV3101 / pTRV2-GFP-CaABF3 and GV3101 / pTRV2-GFP are streaked (LB solid medium, containing the corresponding antibiotics) and cultured at 28°C for 2 days to obtain well-isolated single clones.

[0057] Small shake: Pick a single clone and add 900 μl of LB liquid medium (Kan+rif) to a 2 ml centrifuge tube and shake to activate the cells. Incubate overnight at 28°C.

[0058] Take 200 μl of each recombinant Agrobacterium culture that has been cultured overnight and add it to a 100 ml Erlenmeyer flask in 50 ml LB liquid medium (Kana + Rif, both added at a ratio of 1:1000). Shake the culture overnight at 28 °C. Centrifuge at 5000 rpm for 10 min to collect the cells. Discard the supernatant and resuspend the cells in an appropriate amount of infection solution (10 mM MgCl2, 10 mM MES, 100 μmol / L AS) until the OD600 is 0.8.

[0059] Mix equal volumes of GV3101 / pTRV1 resuspension with GV3101 / pTRV2-GFP-CaABF3 resuspension, or GV3101 / pTRV1 resuspension with GV3101 / pTRV2-GFP resuspension, and incubate at room temperature in the dark for 3 hours.

[0060] Using a 1mL disposable syringe, the above-mentioned mixed bacterial solution was injected into the inside of the fruit peel from the stem of the pepper (variety 16C391). The plants were placed in the dark for 36 hours and then placed in an artificial climate chamber to observe the phenotype. The environmental conditions were maintained at 70% relative humidity, 22℃ during the day with 16 hours of light, and 18℃ at night with 8 hours of darkness. Observe the pepper fruits for 1-2 weeks to observe their color change and the phenotype of the pepper fruits inoculated with the pTRV2-GFP-CaABF3 vector. Figure 1 As shown in the figure, the injection site (silent) is visible. CaABF3 After that, the fruit ripening is delayed.

[0061] (2) CaABF3 Gene expression pattern analysis For the introduction of pTRV2-GFP- CaABF3 The carrier is obtained from the pepper fruit at the injection site. CaABF3 Genetic analysis was performed. Pepper fruits inoculated with the pTRV2-GFP empty vector were used as a control.

[0062] Primer sequences were GCTCGGAAGCAGGCCTATAC and TGCTTACACCGAGGTTGAAGTT; total RNA was extracted, and SYBR GreenMaster Mix was analyzed using real-time quantitative PCR (RT-qPCR). CaUBI-3 As an internal reference gene, the primer sequence is CACATGTACAAGACTGACAGGGCCA,AGACCCGTTCCTTGACAACCCAC. CaABF3 The relative expression level of genes is expressed by formula 2. -△△Ct (Livak and Schmittgen, 2001). All reactions were performed in triplicate.

[0063] The results are as follows Figure 2 As shown in the figure, the injection site of the pTRV2-GFP-CaABF3 vector in pepper fruit is visible. CaABF3 Gene expression levels are significantly reduced, i.e. CaABF3 Genes have become silent.

[0064] (3) Determination of the content of carotenoids and abscisic acid The extraction method for carotenoids is referenced from Lichtenthaler and Wellburn (Lichtenthaler, HK; Wellburn, A.D. etermination of carotenoids and chlorophyll a and b of leaf extracts in different solvents). Biochem. Soc. Trans. 1983, 603 The method (591–592) was used. Injection sites were collected from pepper fruits inoculated with the pTRV2-GFP-CaABF3 vector. CaABF3 (Gene silencing) Total carotenoid content was measured, with pepper fruits introduced with the pTRV2-GFP empty vector serving as a control. To ensure robustness, two biological replicates were performed on fruits during the color-changing stage.

[0065] Abscisic acid extraction and analysis were performed according to the method of Šimura et al. (Šimura, J., Antoniadi, I., Široká, J., Tarkowská, D., Strnad, M., Ljung, K., Novák, O. 2018. Plant hormonomics: multiple phytohormone profiling by targeted metabolomics. Plant Physiology, 177(2): 476-489.). Injection sites were collected from pepper fruits inoculated with the pTRV2-GFP-CaABF3 vector. CaABF3 (Gene silencing) abscisic acid content was measured, with pepper fruits introduced with the pTRV2-GFP empty vector serving as a control. To ensure robustness, two biological replicates were performed on fruits during the color-changing stage.

[0066] The results showed that: pTRV2-GFP- CaABF3 The abscisic acid content in the silent plants (fruit injection site) was significantly lower than that in the control group (fruit injected with pTRV2-GFP empty vector), such as Figure 3 As shown, this illustrates silence. CaABF3 It can reduce abscisic acid levels, and pTRV2-GFP- CaABF3 The total carotenoid content in the silent plants (fruit injection site) was significantly lower than that in the control group (fruit injected with pTRV2-GFP empty vector), such as Figure 4 As shown in the figure. This result helps advance our understanding of the complex transcriptional regulation of pepper development, thereby further enhancing the nutritional and aesthetic value of peppers.

[0067] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Applications of CaABF3 protein in any of the following: P1. Regulates the ripening of plant fruits; P2. Regulates the content of carotenoids in plant fruits; P3. Regulates the content of abscisic acid in plants; The CaABF3 protein is any one of the following: (A1) A protein with the amino acid sequence SEQ ID NO:1; (A2) A protein derived from chili peppers that has the same function as the amino acid sequence shown in SEQ ID NO:1, by substitution and / or deletion and / or addition of one or more amino acid residues. (A3) has 99%, 95%, 90%, 85% or 80% or more of the same amino acid sequence as any of (A1)-(A2) and is derived from a chili pepper and has the same function. (A4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of any of the proteins defined in (A1)-(A3).

2. The application according to claim 1, characterized in that: In the application, the expression level and / or activity of the CaABF3 protein in the plant are reduced, the fruit ripening of the plant is delayed and / or the content of carotenoids and / or abscisic acid in the fruit is reduced.

3. The application of substances that can reduce the expression level and / or activity of CaABF3 protein in plants in any of the following: Q1. Delay the ripening of plant fruits; Q2. Reduce the carotenoid content in plant fruits; Q3. Reduce the content of abscisic acid in plants; The CaABF3 protein is any one of the following: (A1) A protein with the amino acid sequence SEQ ID NO:1; (A2) A protein derived from chili peppers that has the same function as the amino acid sequence shown in SEQ ID NO:1, by substitution and / or deletion and / or addition of one or more amino acid residues. (A3) has 99%, 95%, 90%, 85% or 80% or more of the same amino acid sequence as any of (A1)-(A2) and is derived from a chili pepper and has the same function. (A4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of any of the proteins defined in (A1)-(A3).

4. A method for delaying the ripening of plant fruit, comprising the following steps: reducing the expression level and / or activity of CaABF3 protein in the plant, thereby delaying the ripening of the plant fruit; The CaABF3 protein is any one of the following: (A1) A protein with the amino acid sequence SEQ ID NO:1; (A2) A protein derived from chili peppers that has the same function as the amino acid sequence shown in SEQ ID NO:1, by substitution and / or deletion and / or addition of one or more amino acid residues. (A3) has 99%, 95%, 90%, 85% or 80% or more of the same amino acid sequence as any of (A1)-(A2) and is derived from a chili pepper and has the same function. (A4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of any of the proteins defined in (A1)-(A3).

5. A method for reducing the content of carotenoids in plant fruits, comprising the following steps: reducing the expression level and / or activity of CaABF3 protein in the plant, thereby reducing the content of carotenoids in the fruit of the plant; The CaABF3 protein is any one of the following: (A1) A protein with the amino acid sequence SEQ ID NO:1; (A2) A protein derived from chili peppers that has the same function as the amino acid sequence shown in SEQ ID NO:1, by substitution and / or deletion and / or addition of one or more amino acid residues. (A3) has 99%, 95%, 90%, 85% or 80% or more of the same amino acid sequence as any of (A1)-(A2) and is derived from a chili pepper and has the same function. (A4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of any of the proteins defined in (A1)-(A3).

6. A method for reducing the content of abscisic acid in plants, comprising the following steps: reducing the expression level and / or activity of CaABF3 protein in plants, thereby reducing the content of abscisic acid in the plants; The CaABF3 protein is any one of the following: (A1) A protein with the amino acid sequence SEQ ID NO:1; (A2) A protein derived from chili peppers that has the same function as the amino acid sequence shown in SEQ ID NO:1, by substitution and / or deletion and / or addition of one or more amino acid residues. (A3) has 99%, 95%, 90%, 85% or 80% or more of the same amino acid sequence as any of (A1)-(A2) and is derived from a chili pepper and has the same function. (A4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of any of the proteins defined in (A1)-(A3).

7. The method according to any one of claims 4-6, characterized in that: The reduction of the expression level and / or activity of the CaABF3 protein in the plant is achieved by inhibiting the expression of the gene encoding the CaABF3 protein in the plant.

8. The method according to claim 7, characterized in that: The inhibition of expression of the gene encoding the CaABF3 protein in the plant is achieved by introducing a VIGS vector carrying the DNA fragment shown at positions 436-735 of SEQ ID NO:2 into the plant.

9. The application or method according to any one of claims 1-8, characterized in that: The gene encoding the CaABF3 protein is any one of the following: (B1) The DNA molecule shown in SEQ ID NO:2; (B2) A DNA molecule that hybridizes under stringent conditions with the DNA molecule defined in (B1) and encodes the CaABF3 protein; (B3) is a DNA molecule that has 99%, 95%, 90%, 85% or 80% identity with the DNA sequence defined by (B1) or (B2) and encodes the CaABF3 protein.

10. The application or method according to any one of claims 1-9, characterized in that: The plant is any one of the following: (C1) Dicotyledonous plants; (C2) Plants of the Solanaceae family; (C3) Plants of the Capsicum genus; (C4) Chili pepper.

Images