Application of SmOEF1 gene in regulation and control of eggplant fruit shape

Abstract

The invention discloses application of a SmOEF1 gene in regulation and control of eggplant fruit shapes, belongs to the technical field of agricultural biological genetic engineering, and relates to application of the SmOEF1 gene in regulation and control of eggplant fruit shapes, and the nucleotide sequence of the SmOEF1 gene is shown as SEQ ID NO.1. The invention further discloses application of the SmOEF1 gene in regulation and control of eggplant fruit shapes. The invention discloses an application of a SmOEF1 gene in regulation of eggplant fruit shape, the gene is used as a novel eggplant fruit shape regulation related gene, and provides a new target for eggplant fruit shape regulation and molecular breeding. The method has important theoretical significance and practical application value for enriching eggplant fruit shape genetic research theories, developing efficient molecular breeding tools and accelerating the cultivation process of new eggplant varieties with different fruit shapes.

Description

Technical Field

[0001] This invention belongs to the field of agricultural bioengineering technology, specifically involving the application of the SmOEF1 gene in regulating eggplant fruit shape. Background Technology

[0002] Eggplant (Solanum melongena L.) is an annual or perennial herbaceous plant belonging to the Solanaceae family and the Solanum genus, originating in the tropical regions of Southeast Asia. It has been cultivated in my country for approximately two thousand years and is currently one of the most widely grown and important vegetable crops in my country and globally. As the country with the largest eggplant planting area and highest yield in the world, my country's production and supply play a vital role in ensuring the diversity of the vegetable market, meeting consumer dietary needs, and promoting agricultural economic development.

[0003] Fruit shape is an important appearance quality and commercial trait of eggplants, directly affecting their market acceptance and economic value. Based on morphological differences, eggplant fruit shapes can be broadly classified into three categories: round, long, and oval. Each category further includes several intermediate types due to genotypic differences, such as flattened round, high round, linear, and horn-shaped. Due to regional differences in consumption habits, the demand for eggplant fruit shapes varies significantly across different regions. For example, some regions prefer round eggplants, while others primarily consume long or oval varieties. Therefore, cultivating high-quality eggplant varieties with different fruit shapes that meet the specific market demands of different regions is one of the important goals in eggplant breeding.

[0004] Fruit shape is influenced by both genetic factors and environmental conditions, but genetic factors play a dominant role. In recent years, with the development of molecular biology and genetic engineering technologies, research on the regulatory mechanisms of plant fruit shape has made some progress. Several key genes regulating fruit shape have been cloned in crops such as tomatoes and cucumbers and applied to molecular breeding practices. However, compared with these crops, the genetic research foundation for eggplant fruit shape is relatively weak, and the elucidation of its regulatory mechanisms is still in its early stages.

[0005] Currently, research on eggplant fruit shape mainly focuses on the preliminary localization of quantitative trait loci (QTLs), with only a few studies involving the cloning of homologous genes. No key genes with clearly defined regulatory functions on fruit shape have yet been identified. This scarcity of regulatory genes means that eggplant fruit shape improvement still relies primarily on traditional hybridization breeding, which suffers from long breeding cycles and low efficiency in selecting target traits. This severely limits the application of modern biotechnologies such as molecular marker-assisted breeding and gene editing in the targeted improvement of eggplant fruit shape. Summary of the Invention

[0006] This invention aims to provide the application of the SmOEF1 gene in regulating eggplant fruit shape, and to provide gene resources for eggplant fruit shape regulation and molecular breeding.

[0007] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0008] The SmOEF1 gene is used to regulate eggplant fruit shape, and its nucleotide sequence is shown in SEQ ID NO.1.

[0009] Preferably, the regulation of eggplant fruit shape includes changing the length, width, and shape index of the eggplant fruit.

[0010] Preferably, the amino acid sequence of the protein encoded by the SmOEF1 gene is shown in SEQ ID NO.2.

[0011] This invention also provides the application of the protein encoded by the SmOEF1 gene as described above in regulating eggplant fruit shape.

[0012] Preferably, the regulation of eggplant fruit shape includes changing the length, width, and shape index of the eggplant fruit.

[0013] The present invention also provides a mutant allele of the SmOEF1 gene as described above, wherein the mutant allele is located in the 3.90-4.90 Mb region of eggplant chromosome 9 and carries an SNP. 9-1 The G / A mutation at the site leads to the formation of an early stop codon in the coding region of the SmOEF1 gene.

[0014] The present invention also provides the application of the mutant alleles as described in the cultivation and / or screening of oval eggplant fruits.

[0015] The present invention also provides a KASP primer, which is used to identify the genotype of the SmOEF1 gene or the mutant allele of the SmOEF1 gene.

[0016] The present invention also provides the application of an expression cassette, vector, or recombinant bacteria containing one of the SmOEF1 gene as described in claim 1, the protein encoded by the SmOEF1 gene, or a mutant allele of the SmOEF1 gene in regulating eggplant fruit shape.

[0017] This invention also provides a method for breeding eggplant varieties with a target fruit shape, comprising the following steps:

[0018] S1. Detect the genotype of the SmOEF1 gene in eggplant plants;

[0019] S2. Screen individual plants with the following genotypes: the SmOEF1 gene, used to obtain round fruits; or a mutant allele of the SmOEF1 gene, used to obtain oval fruits.

[0020] Compared with the prior art, the present invention has the following advantages and technical effects:

[0021] This invention discloses the application of the SmOEF1 gene in regulating eggplant fruit shape. As a novel gene related to the regulation of eggplant fruit shape, this gene provides a new gene for the regulation of eggplant fruit shape and provides gene resources for molecular breeding of eggplant fruit shape. It has important theoretical significance and practical application value for enriching the theory of eggplant fruit shape genetic research, developing efficient molecular breeding tools, and accelerating the breeding process of high-quality multi-fruit-shaped eggplant varieties.

[0022] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0023] Figure 1 The results of a comparative analysis of the ovary and fruit shape at different developmental stages of the wild-type and mutant oef1 are shown. Figure 1 In the image, A represents a longitudinal section scan. Figure 1 In this context, B represents the length statistics result; Figure 1 In this context, C represents the width statistics. Figure 1 In this context, D represents the statistical result of the shape index;

[0024] Figure 2 The results of the genetic analysis of the oef1 mutant phenotype are as follows: Figure 2 In this context, A represents the mature fruits of WT, F1, and oef1. Figure 2 In the figure, B represents the statistical results of the comparative analysis of the fruit length at maturity for WT, F1, and oef1. Figure 2 In the figure, C represents the statistical results of the comparative analysis of the fruit width at maturity for WT, F1, and oef1. Figure 2 In the figure, D represents the statistical results of the comparative analysis of the fruit shape index at maturity for WT, F1, and oef1. Figure 2 D in the figure represents the fruit shape index distribution of the F2 generation population;

[0025] Figure 3 This is a distribution map of SNP-index on chromosomes; Figure 3 In the diagram, A represents the distribution of SNP-index on chromosome 9; Figure 3 B in the diagram represents the distribution of SNP-index on chromosome 12.

[0026] Figure 4 This is a graph showing the genotype results of the F2 generation of KASP. Red dots represent SNPs. AThe single plant, with blue dots representing SNPs. G A single plant, with green dots indicating SNPs. G / A Heterozygous single plants, with pink dots representing negative controls. Detailed Implementation

[0027] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0028] Unless otherwise defined, the technical or scientific terms used in this invention shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

[0029] Source of experimental materials:

[0030] The mutant oef1 was derived from: Wang Xing. 2016. Identification and analysis of mutant phenotypes in M1 generation eggplant induced by EMS [Master's Thesis]. Baoding: Hebei Agricultural University.

[0031] In this invention, unless otherwise specified, all other test materials and instruments are conventional test materials in the field and can be purchased through commercial channels.

[0032] Example 1

[0033] Sources and growth conditions of experimental materials

[0034] I. The process of obtaining the mutant oef1

[0035] The oef1 mutant was discovered in the M2 generation EMS mutant library of '14-345', and its fruit is oval. This mutant has been stably inherited through multiple generations of self-pollination, exhibiting normal fruiting ability and stable fruit shape. Wild-type '14-345' (WT) was crossed with the oef1 mutant to obtain the F1 generation, and self-pollination of the F1 generation yielded the F2 segregating population. The materials used were raised as seedlings at the Hebei Agricultural University Agricultural Science Teaching and Practice Base (38°N, 115°E). After 60 days, the materials were transplanted into a cold greenhouse, and field planting and management followed normal field production methods.

[0036] II. Phenotypic Study of the OEF1 Mutant

[0037] Phenotypic observations were conducted on the eggplant oval fruit mutant oef1 and its wild-type '14-345'. Fruit length, width, and shape index were measured and recorded using calipers and a ruler, with 3-4 biological replicates for each material. Results are as follows: Figure 1 As shown.

[0038] Depend on Figure 1 It can be seen that the fruit length and shape index of the oef1 mutant are significantly higher than those of WT, while the fruit width of the oef1 mutant is significantly lower than that of WT.

[0039] III. Analysis of the genetic patterns of the mutant oef1

[0040] S1. Population Construction: An F2 population was constructed using the mutant oef1 and its wild-type '14-345' as parents. This population was used for genetic analysis of the mutant fruit shape, BSA pooled resequencing, and KASP genotyping.

[0041] S2. Genetic Analysis: Comparative analysis was conducted on the fruit length, width, and shape index of the mutant oef1, the wild-type '14-345', and their F1 generation plants. The results are as follows: Figure 2 As shown.

[0042] Depend on Figure 2 It can be seen that the fruit length, width and shape index of F1 are all between oef1 and WT.

[0043] After sowing the F2 generation population, the fruit length, width, and shape index of each individual plant in the F2 generation were analyzed at the physiological maturity stage. The analysis revealed that the fruit shape of the F2 generation population exhibited segregation and a trimodal distribution. Calculations using the mean, T-test, and chi-square (χ²) test showed a segregation ratio of 1:2:1. In conclusion, the oef1 mutant trait is controlled by a pair of semi-dominant genes.

[0044] IV. Location of oef1 mutation candidate genes

[0045] 1. DNA extraction and sequencing pool construction, the specific experimental protocol is as follows:

[0046] Using pooled subgroup analysis (BSA), 30 wild-type phenotype individuals and 30 mutant phenotype individuals were selected from the F2 segregating population. DNA was extracted and then mixed in equal volumes to construct wild-type pool (WT-pool) and mutant pool (oef1-pool), respectively. DNA was extracted using the CTAB method.

[0047] (1) Grind the sample into powder quickly under liquid nitrogen freezing, and then immediately transfer the sample powder into a 2 μL centrifuge tube.

[0048] (2) Add 600uL of CTAB (containing 1.5% mercaptoethanol) extract preheated at 65℃ to the centrifuge tube, shake vigorously to mix, and incubate in a water bath at 65℃ for 1h.

[0049] (3) After cooling to room temperature, add an equal volume of chloroform / isoamyl alcohol in a 24:1 ratio, gently shake until the solution becomes an emulsion, and centrifuge at 10,000 rpm for 10 minutes at 20°C. Repeat this process once more.

[0050] (4) Slowly transfer the supernatant to a 1.5uL centrifuge tube containing 2 / 3 volume of pre-cooled isopropanol and precipitate at -20℃ for more than 2 hours.

[0051] (5) Centrifuge at 10,000 rpm for 5 min at 4℃, remove the supernatant, wash with 70% ethanol 1-2 times, centrifuge for 5 min each time, and dry on a clean bench.

[0052] (6) Dissolve in 150uL sterile water and 1.5μL RNAase, flick with your finger, and heat in a 60℃ water bath for 10min.

[0053] (7) DNA quality testing: DNA concentration and OD value were determined by 1% agarose gel electrophoresis and an SMA3000 spectrophotometer. Concentration >100 ng·μL -1 The requirement that the OD value A260 / A280 is within the range of 1.8-2.0 is considered acceptable. The sample should be placed at -20℃ for later use.

[0054] 2. Mixed-pool high-throughput sequencing and sequence alignment

[0055] The mixed-pool samples were sequenced using the Illumina Novaseq sequencing platform. After obtaining the raw sequencing data, its quality was assessed, and low-quality reads were removed. The raw data was filtered using the BWA genome alignment software in BWA-MEM mode to obtain Clean Reads, which were then compared with the eggplant reference genome (Eggplant-HQ V1.0) to remove low-quality reads.

[0056] 3. SNP-index analysis and candidate SNP site screening

[0057] Variation detection was performed on two DNA pools using GATK software, and functional annotation of the detected variations was performed using ANNOVAR. After data processing, the distribution of progeny SNP-index across all chromosomes was plotted. Candidate regions were predicted based on the SNP-index curves and chi-square distribution results. Candidate SNP sites were confirmed using gene annotation, ultimately locating the oefl mutation sites in the 3.90-4.90 Mb interval on chromosome 9 and the 1.10-2.10 Mb interval on chromosome 12. The results are as follows: Figure 3 As shown.

[0058] 4. KASP verification of F2 segregating population genotypes

[0059] Based on the BSA results, candidate regions and genes related to the mutant trait were screened. KASP primers were designed and genotyping was performed based on the candidate SNPs and their preceding and following 100 bp sequences. The KASP primers included primer_X, primer_Y, and primer_C. The nucleotide sequence of primer_X is shown in SEQ ID NO.3, the nucleotide sequence of primer_Y is shown in SEQ ID NO.4, and the nucleotide sequence of primer_C is shown in SEQ ID NO.5.

[0060] SEQ ID NO.3:

[0061] GAAGGTGACCAAGTTCATGCTGTTGTTCATCCCATAAGTCT GCC);

[0062] SEQ ID NO.4:

[0063] GAAGGTCGGAGTCAACGGATTATGTTGTTCATCCCATAAGT CTGCT);

[0064] SEQ ID NO.5:

[0065] GGGTGAAGCCATTAGAGGGTATTAAC.

[0066] The results showed that SNPs on chromosome 9 9-1 The match rate with the oef1 mutant phenotype was 99.0%, while the SNP on chromosome 12... 12-1 and SNP 12-2 The matching rates with the oef1 mutant phenotype were only 60.5% and 25.0%, respectively. Therefore, the SNP is considered... 9-1 This is the site that causes the oef1 fruit shape variation. This SNP is a G / A variation, resulting in a premature stop codon in Sme09G0349(SmOEF1).

[0067] SmOEF1 gene nucleotide sequence (SEQ ID NO.1):

[0068]

[0069] The amino acid sequence of the protein encoded by the SmOEF1 gene is shown in SEQ ID NO.2:

[0070] MEKCRHRKCRSASGIMEGSKLVQKQIATPKVTLNSRSYCDGTTRGDMSMLDVGKSSSKRVTGTPIKKLLAEEMAKEGESKRRPPSIVAKLMGLEGMPSPQHIGRQQRRFSDSCQHRNEQIDPRRRKQLFDEQSSKRSSMEHQEFKDVYEDLEASHVANRRHSSRWNETGRFATPDMALIQQKFMDAKRLSTDERFQNSKEFDDTLEALDSNKELLLKYLQEPDSLFEKHLQDLQVNTASSRCSHIAVLKPSNSVKNEGSAKSSKSVRGGSCKQGISLPKERIDGLLLQSQHRHSGHNSQKSSPILSEGKEENILPTKIVVLKPNLGITQNDITSVPYHPDVRKHALYHHASPRGAGEEEEKNSSKNVGISKPRSNEARDIAKEITRRMRDTFGPFDGGDAYFRGSGVKGYAGDESSCDVYESDSTGESDFTTSSFRKPSGRGNLKKSSSLGSESSVGREAKKRLSERWKMTQYYQDIEMGGKSSTLGEMLSLPDEGTKHDYCDTMVHVEEATNEPGGRKGTTEWDFPLGISSRDGWKDVCFNDSSGYRSASPPFCSKKHRTRSRREVKKFSVSKEPVNEERSGNHRRSRSLDGMLNIRDEFLSKDSKSSKKKLHTCRLGSDSSSKGKLRQRIDMNLEENLSEKLSLASQVPSADGMSYTNASDDAETESITLSSEYSVEMLQKLPVKCGSASSPNQEVSILQEALPEPSPPSSATASVVLEYSPPEPESSVSSKEADHPSPLSVLEVPFTEDASSGSECFERVSAELNGLRMQLKLLKMESEYNADIVVSDEEDEYFEDNCSLRSQSWQSSYTLDVLTESGLKASDSDAFATSCHTLECPLSPWIFDNLEKKYADEITGPRYERRLLFDRINFCLLEILKKYVDPCPWVKPLEGINWKWQTYGMNNILHELLRSQEDAANADTPSNVVEEMQWLDVKDELNLMGKDVMELLIEDLIEEVVTM*。

[0071] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. The application of the SmOEF1 gene in regulating eggplant fruit shape, characterized by, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The regulation of eggplant fruit shape includes changing the length, width, and shape index of the eggplant fruit.

3. The application according to claim 1, characterized in that, The amino acid sequence of the protein encoded by the SmOEF1 gene is shown in SEQ ID NO.

2.

4. The application of the protein encoded by the SmOEF1 gene as described in claim 3 in regulating eggplant fruit shape.

5. The application according to claim 4, characterized in that, The regulation of eggplant fruit shape includes changing the length, width, and shape index of the eggplant fruit.

6. A mutant allele of the SmOEF1 gene as described in claim 1, characterized in that, The mutated allele is located in the 3.90-4.90 Mb region of eggplant chromosome 9 and carries an SNP. 9-1 The G / A mutation at the site leads to the formation of an early stop codon in the coding region of the SmOEF1 gene.

7. The application of the mutant allele as described in claim 6 in the cultivation and / or screening of oval eggplant fruits.

8. A KASP primer, characterized in that, The KASP primers are used to identify the genotype of the mutant alleles of the SmOEF1 gene of claim 1 or claim 6.

9. The application of an expression cassette, vector, or recombinant bacteria containing one of the SmOEF1 gene as described in claim 1, the protein encoded by the SmOEF1 gene, or a mutant allele of the SmOEF1 gene in regulating eggplant fruit shape.

10. A method for cultivating eggplant varieties with a target fruit shape, characterized in that, Includes the following steps: S1. Detect the genotype of the SmOEF1 gene in eggplant plants; S2. Screening for single plants with the following genotypes: the SmOEF1 gene of claim 1, used to obtain round fruits; or the mutant allele of the SmOEF1 gene of claim 6, used to obtain oval fruits.

Images