CRISPR-Cas12a-based semi-quantitative detection method for glioma IDH1 gene mutation

Abstract

The invention belongs to the technical field of biological information, and discloses a rapid detection kit for brain glioma IDH1 gene mutation based on CRISPR-Cas12a and a semi-quantitative detection method thereof, and the rapid detection kit comprises: 1) an RPA specific isothermal amplification primer aiming at an IDH1-R132H mutant gene; (2) a CRISPR-Cas12a detection system, wherein the CRISPR-Cas12a detection system comprises specific crRNA; a Cas12a protein; an ssDNA fluorescent probe; and 3) a standard substance ladder, wherein the standard substance ladder comprises a plurality of IDH1 wild type gDNA and IDH1-R132H mutant type gDNA in different proportions. By adopting the detection kit, the detection of single-point mutation of brain glioma genes can be realized, and the detection kit is used for specific recognition and semi-quantitative detection of IDH1R132H mutation in a clinical sample.

Description

Technical Field

[0001] This invention belongs to the field of molecular diagnostic technology. Specifically, it is a semi-quantitative detection method for IDH1 gene mutation in gliomas based on CRISPR-Cas12a, including a rapid detection kit for IDH1 gene mutation in gliomas based on CRISPR-Cas12a, which is used for the specific identification and semi-quantitative detection of IDH1 R132H mutation in clinical samples. Background Technology

[0002] Gliomas, the most common type of malignant tumor, account for approximately 40% to 50% of intracranial tumors. These tumors are known for their unique invasive growth pattern; they can infiltrate and destroy surrounding normal brain tissue. They are highly malignant, have a poor prognosis, a long course, and are accompanied by severe impairment of consciousness and function, placing a heavy burden on patients' families and society. Therefore, accurate and rapid detection of gliomas remains a critical challenge in clinical practice.

[0003] In 2008, Parsons et al.'s research team, using cutting-edge high-throughput sequencing technology, first revealed point mutations in the isocitrate dehydrogenase-1 (IDH1) gene in glioblastoma multiforme. Following this, in 2009, Yan et al.'s research further expanded our understanding of IDH1 mutations, discovering that this mutation is not limited to the most malignant WHO grade IV glioblastoma, but is widely present in lower-grade WHO grade II and III astrocytomas and oligodendrogliomas. A common type of IDH1 mutation involves a mutation at amino acid position 132 of the IDH1 gene, replacing arginine (R) with histidine (H), hence the name R132H mutation. This mutation leads to an abnormal change in IDH1 enzyme activity, causing its catalytic product to change from α-ketoglutarate to 2-hydroxyglutarate (2-HG). The accumulation of 2-HG has detrimental effects on normal cellular metabolism and signal transduction. IDH1 gene mutations are present in 70% of brain tumor patients.

[0004] Given the widespread presence of IDH1 gene mutations and their potential significant impact on the prognosis and treatment options for glioma patients, IDH1 gene mutation detection has gradually become a routine procedure in the clinical diagnosis and treatment of gliomas. However, there are currently few research reports on how to rapidly and accurately detect IDH1 gene mutations, particularly regarding the consistency and accuracy between immunohistochemical and molecular detection methods.

[0005] Currently, three main techniques are used clinically to assess the mutation status of the IDH1 gene: EnVision immunohistochemistry, which uses the antigen-antibody reaction principle to visualize and detect IDH1 protein mutations at the cellular or tissue level; High-resolution melting curve analysis (HRM), a molecular detection method based on differences in DNA melting temperature, capable of accurately identifying sequence variations in the IDH1 gene; and gene sequencing technology. Each of these methods has its advantages and limitations. For example, EnVision immunohistochemistry generally involves paraffin embedding, cutting, baking, dewaxing and dehydration, high-pressure repair, incubation, staining, and mounting. While it allows direct observation of IDH1 protein expression on tissue sections, its accuracy may be slightly lower than molecular detection and is affected by factors such as sample quality and antibody specificity. HRM requires DNA amplification and HRM analysis. Although PCR technology is relatively simple to operate, it also has issues with sample processing and amplification efficiency, and may not detect some low-abundance mutations. While Sanger sequencing technology is classic and accurate, it has low throughput and is time-consuming, making it difficult to meet the needs of rapid detection of large-scale samples.

[0006] In clinical practice, rapidly obtaining IDH1 gene mutation detection results is crucial for guiding treatment planning. This is especially true in emergency situations, such as surgical decisions, chemotherapy, or radiotherapy regimens, where understanding the patient's gene mutation status is essential as quickly as possible. Therefore, existing detection methods may have limitations in terms of speed.

[0007] CRISPR-Cas12a gene editing technology has developed rapidly in recent years, demonstrating great potential in multi-gene editing. Cas12a (formerly known as Cpf1) is a DNA endonuclease guided solely by crRNA (CRISPR RNAs). When Cas12a binds to crRNA and a specific DNA target, a ternary complex is formed. After recognizing and cleaving the target DNA, the Cas12a / crRNA / DNA target ternary complex is activated and exhibits non-specific ssDNA trans-cleavage activity. This activity means that the complex can indiscriminately cleave any single-stranded DNA (ssDNA) in the system, not just the target DNA. By modifying the ends of the single-stranded DNA with fluorescent and quenching groups, when the ssDNA probe is cleaved by Cas12a, the fluorescent and quenching groups separate, emitting a fluorescent signal that is easily detected. Currently, some teams have also proposed IDH1 mutation detection based on CRISPR technology, such as CN113136429A and CN 119639901 A. However, CN113136429A strictly relies on traditional TTTV-type PAM sequences in its crRNA design, while such sequences are lacking around the IDH1-R132H mutation site. This prevents the direct application of the CRISPR-Cas12a system for specific recognition, limiting the technology's versatility. Furthermore, the patent document does not mention optimization strategies for non-classical PAM sequences, leading to a high risk of detection failure when no TTTV sequence is available at the target site. Moreover, neither CN113136429A nor CN119639901A addresses the accurate quantification of IDH1 gene mutant cell content, relying solely on a single fluorescence signal channel and lacking standardized calibration methods. This results in significant errors in quantifying mutant cell content, particularly insufficient sensitivity for low-abundance mutations (e.g., <10%), and poor reproducibility under background noise interference. Therefore, improvements are necessary. Summary of the Invention

[0008] Regarding the aforementioned issues: crRNA design requires the PAM sequence of TTTV, which presents challenges when the PAM sequence is unavailable. However, the IDH1 R132H gene mutation does not conform to the PAM sequence of TTTV, and crRNA detection is based on luminescence principles. Existing CRISPR-based fluorescence detection methods rely on a single signal channel and lack standardized calibration methods, making it difficult to accurately quantify the content of mutant cells.

[0009] To address the aforementioned pain points, the core innovation of this invention lies in overcoming the target limitations of CRISPR-Cas12a through non-traditional PAM design, improving the accuracy of identifying the content of IDH1 gene mutant cells by combining a multi-channel calibration system, and integrating efficient amplification technology to achieve rapid detection.

[0010] This invention, through research, discovered that designing PAM sequences using a non-traditional PAM, namely VTTV, and utilizing multi-channel signal calibration based on a standard ladder to compare the IDH1 detection signal, improves the accuracy of identifying the content of IDH1 gene mutation cells. These innovations are currently unresolved and possess significant technological breakthroughs and clinical application value. Therefore, the first objective of this invention is to provide a rapid detection kit for IDH1 gene mutations in gliomas based on CRISPR-Cas12a. The second objective of this invention is to provide RPA-specific isothermal amplification primers for the IDH1-R132H mutation gene in gliomas. The third objective of this invention is to provide a CRISPR-Cas12a detection system for the IDH1-R132H mutation gene in gliomas. The fourth objective of this invention is to provide a semi-quantitative detection method for IDH1 gene mutations in gliomas based on CRISPR-Cas12a.

[0011] To address the above problems, the present invention adopts the following technical solution:

[0012] As a first aspect of the present invention, a rapid detection kit for IDH1 gene mutations in gliomas based on CRISPR-Cas12a is provided, comprising:

[0013] (1) RPA-specific isothermal amplification primers for the IDH1-R132H mutant gene;

[0014] (2) CRISPR-Cas12a detection system, including:

[0015] Specific crRNA: The sequence of the crRNA is shown in SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8;

[0016] Cas12a protein;

[0017] ssDNA fluorescent probe;

[0018] (3) A standard ladder containing wild-type IDH1 gDNA as shown in SEQ ID NO:11 and mutant IDH1-R132H gDNA as shown in SEQ ID NO:12. It should be noted that the wild-type IDH1 gDNA and mutant IDH1-R132H gDNA in the standard ladder can be set to contain various different ratios, for example, wild-type IDH1 gDNA and mutant IDH1-R132H gDNA can be mixed in ratios of 0:100, 25:75, 50:50, 75:25, and 100:0.

[0019] According to the present invention, the backbone sequence of the crRNA is shown in SEQ ID NO:3.

[0020] According to the present invention, the crRNA is designed using VTTV to design the PAM sequence, and the mutated base is located at position 5-6 at the 5' end of the spacer sequence.

[0021] According to the present invention, the fluorescence detection wavelength of the ssDNA fluorescent probe is 485 nm for excitation and 520 nm for emission.

[0022] As a second aspect of the present invention, an RPA-specific isothermal amplification primer for the glioma mutant gene IDH1-R132H includes: a forward primer with the sequence shown in SEQ ID NO:1 and a reverse primer with the sequence shown in SEQ ID NO:2.

[0023] As a third aspect of the present invention, a CRISPR-Cas12a detection system for the glioma mutation gene IDH1-R132H includes:

[0024] Specific crRNA: The crRNA is designed using a non-traditional PAM sequence, the non-traditional PAM sequence being CTTG, and the sequence of the crRNA is shown in SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8;

[0025] Cas12a protein;

[0026] ssDNA fluorescent probe.

[0027] As a third aspect of the present invention, a PAM sequence of the CRISPR-Cas12a detection system described above is characterized in that the PAM sequence is a non-traditional PAM sequence, and the PAM sequence is CTTG.

[0028] As a fourth aspect of the present invention, a semi-quantitative detection method for IDH1 gene mutations in gliomas based on CRISPR-Cas12a includes the following steps:

[0029] (1) Extract DNA from the sample to be tested;

[0030] (2) DNA was amplified using RPA-specific isothermal amplification primers to obtain amplification products;

[0031] (3) The amplification product is mixed with a CRISPR-Cas12a detection system, incubated, and then the fluorescence signal is detected; the detection system includes:

[0032] Specific crRNA: The crRNA is designed using a non-traditional PAM sequence, and the sequence of the crRNA is shown in SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8;

[0033] Cas12a protein;

[0034] ssDNA fluorescent probe;

[0035] (4) The fluorescence signal is quantitatively analyzed by a multi-channel calibration system of a standard ladder, wherein the standard ladder includes wild-type IDH1 gDNA as shown in SEQ ID NO:11 and mutant IDH1-R132H gDNA as shown in SEQ ID NO:12.

[0036] It should be noted that the IDH1 wild-type gDNA and IDH1-R132H mutant gDNA in the standard ladder can be set to contain a variety of different ratios, for example, IDH1 wild-type gDNA and IDH1-R132H mutant gDNA can be mixed in the ratio of 0:100, 25:75, 50:50, 75:25, 100:0.

[0037] According to the present invention, the incubation temperature in step (3) is 37°C and the time is 10-30 minutes.

[0038] According to the present invention, the detection wavelength of the fluorescence signal in step (4) is 485nm for excitation and 520nm for emission.

[0039] According to the present invention, the sequences of the RPA-specific isothermal amplification primers are shown in SEQ ID NO:1 and SEQ ID NO:2.

[0040] Compared to existing technologies, the beneficial effects of this invention are: the rapid detection technology for IDH1 gene mutations in gliomas based on CRISPR-Cas12a described in this invention reduces the detection time to 30 minutes (compared to more than 2 hours using traditional methods), thus reducing the IDH1 gene mutation detection time and improving the accuracy of identifying the content of IDH1 gene-mutant cells. This provides effective support for the formulation of clinical diagnosis and treatment plans. Specifically, it is reflected in:

[0041] (1) Addressing the challenge of the lack of TTTV-type PAM sequences in the IDH1 R132H mutation, this invention innovatively designs crRNA using VTTV-type PAM sequences (such as CTTG). By optimizing the relative positions of the spacer sequence and PAM (the mutant base is located at position 5-6 of the 5' end of the spacer), the specific recognition and cleavage of target DNA by Cas12a is successfully achieved. Specifically, this is reflected in:

[0042] The CRISPR-Cas12a-based glioma IDH1 gene mutation detection kit provided by this invention is a visualized IDH1 gene single-point mutation detection kit. This kit designs specific primers, crRNA, and ssDNA fluorescent probes for the glioma mutant gene IDH1. The kit uses the designed specific primers to perform RPA amplification on the sample to be tested, amplifying the target fragment. Then, in the CRISPR-Cas12a system, the RPA amplification product is recognized, bound, and cleaved to activate the non-specific nuclease function. The ssDNA fluorescent probe in the system is then randomly cleaved to obtain lysis products. Finally, the fluorescence color development of the lysis products is used for identification, realizing the detection of single-point mutations in glioma genes. This provides a detection technology for accurate and rapid early auxiliary screening of glioma IDH1 gene mutations.

[0043] 2. To address the problem of inaccurate fluorescence signal quantification, this invention introduces a multi-channel calibration system based on a standard ladder. By establishing a standard curve of mutant cell content gradient (0%-100%) and combining it with real-time background correction, the accuracy and repeatability of the detection results are significantly improved (CV<5%). Attached Figure Description

[0044] Figure 1 It is the RPA amplification product of the IDH1 gene.

[0045] Figure 2 Comparison of crRNA primer sequence detection signals for the IDH1 gene mutation fragment.

[0046] Figure 3 This is the standard curve diagram for the standard ladder.

[0047] Figure 4 This is a comparison graph of the signals of the measured sample and the standard ladder, where,

[0048] ①target: 100% gDNA + CrRNA4

[0049] ②Target: 75% gDNA + 25% IDH1 gene mutation fragment + crRNA4

[0050] ③Target: 50% gDNA + 50% IDH1 gene mutation fragment + crRNA4

[0051] ④Target: 25% gDNA + 75% IDH1 gene mutation fragment + crRNA4

[0052] ⑤Target: 100% IDH1 gene mutation fragment + crRNA4

[0053] ⑥ Sample 1 (actual measurement)

[0054] ⑦ Sample 2 (actual measurement). Detailed Implementation

[0055] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0056] 1. The specific meanings of the terms used in this invention are as follows:

[0057] TTTV type PAM sequence refers to a typical PAM sequence recognized by certain CRISPR-Cas systems, where TTTV means starting with "TTT" and the fourth position is any base (V = A / C / G).

[0058] Non-traditional PAM sequence (VTTV), where "V" represents a non-T base (i.e., A, C, or G).

[0059] Spacer, or guide sequence, is a 20-nt sequence in crRNA (CRISPR RNA) that is complementary to the target DNA and is responsible for specifically recognizing the target site.

[0060] 2. The sequence of IDH1 wild-type gNDA in the following examples is as follows:

[0061] AAGCTATAAAGAAGCATAATGTTGGCGTCAAATGTGCCACTATCACTCCTGATGAGAAGAGGGTT

[0062] GAGGAGTTCAAGTTGAAACAAATGTGGAAATCACCAAATGGCACCATACGAAATATTCTGGGTGGCACG

[0063] GTCTTCAGAGAAGCCATTATCTGCAAAAATATCCCCCGGCTTGTGAGTGGATGGGTAAAACCTATCATC

[0064] ATAGGTCGTCATGCTTATGGGGATCAAGTAAGTCATGTTGGCAATAATGTGATTTTGCATGTTTTTTTT

[0065] TTCATGGCC, SEQ ID NO:11.

[0066] 3. The sequence of the IDH1-R132H mutant gNDA in the following examples is as follows:

[0067] AAGCTATAAAGAAGCATAATGTTGGCGTCAAATGTGCCACTATCACTCCTGATGAGAAGAGGGTT

[0068] GAGGAGTTCAAGTTGAAACAAATGTGGAAATCACCAAATGGCACCATACGAAATATTCTGGGTGGCACG

[0069] GTCTTCAGAGAAGCCATTATCTGCAAAAATATCCCCCGGCTTGTGAGTGGATGGGTAAAACCTATCATC

[0070] ATAGGTCATCATGCTTATGGGGATCAAGTAAGTCATGTTGGCAATAATGTGATTTTGCATGTTTTTTTT

[0071] TTCATGGCC, SEQ ID NO:12.

[0072] 4. Detection of nucleic acid fragments of IDH1 gene mutations in gliomas

[0073] This invention aims to verify the feasibility of using crRNA designed based on a non-traditional PAM sequence (VTTV) in the detection of R132H mutations in the IDH1 gene of gliomas. By designing specific crRNA, optimizing the relative positions of the spacer sequence and PAM, and combining this with RPA isothermal amplification technology to amplify the substrate, the invention seeks to more sensitively detect mutations. This addresses the issue of traditional VTTV-type PAM sequences being missing at the IDH1 mutation site, thereby achieving specific recognition and amplification of the target DNA.

[0074] The purpose of this invention is to verify the overall feasibility of the experiment and the effectiveness of non-traditional PAM design. First, RPA amplification is performed on the IDH1 R132H gene mutation region. Then, crRNA sequences are designed based on the IDH1 R132H gene mutation sequence. Finally, the effectiveness of non-traditional PAM sequence (VTTV) design is determined by designing different PAM types.

[0075] Example 1

[0076] 1.1 Design and synthesis of RPA primers and crRNA sequences for IDH1 R132H gene mutation

[0077] The IDH1 gene sequence R132H, genomic location chr2:208248318-208248598, was found in the NCBI GenBank database. Amplification primers were designed using the professional Invitroge amplification primer design software, and the final RPA amplification primers are as follows:

[0078] F:5'-CATACCTTGCTTAATGGGTGTAGATACCAAA-3', SEQ ID NO:1;

[0079] R: 5'-AAACCTATCATCATAGGTCGTCATGCTTATG-3', SEQ ID NO: 2;

[0080] The crRNA sequence consists of a spacer sequence and a backbone sequence. For the CRISPR-Cas12a system, the crRNA backbone sequence is a 21 bp sequence (5'-UAAUUUCUACUAAGUGUAGAU-3', SEQ ID NO:3). The design principles for the crRNA spacer sequence include: crRNA targets and recognizes the mutant sequence, with the mutant base located at the 5th or 6th base of the 5' end of the spacer sequence; the spacer sequence length is 28–35 bp, and it cannot overlap with the RPA primer; it avoids the formation of self-activating RNA secondary structures, and the spacer sequence is ligated to the 5' end backbone sequence to form a complete crRNA; the spacer sequence must be placed at the 3' end of the PAM (5'-TTTV-3'). Based on these principles, a 100 bp sequence at the target site was selected and entered into the CRISPOR website for searching, and the optimal spacer sequence was selected for system analysis.

[0081] Because there was no matching PAM TTTV sequence in the vicinity of the mutation site, but a VTTV (CTTG) site was present (located 15 bp downstream of the mutation site), we used the reverse complementary strand to locate the VTTV (original strand sequence: 5'-ATTG-3' → complementary strand shows VTTV: 5'-CAAT-3') as the standard, and selected the 5'- CTTG ATCCCCATAAGCATGATGAC-3' (where CAT is the spacer's 16th-18th (CAT) target mutation codon GTA (c.395G→A), and the underlined part CTTG is the PAM sequence) was synthesized by Beijing Qingke Biotechnology Co., Ltd., and used as crRNA in the subsequent target gene detection group.

[0082] The sequence of the specific crRNA targeting IDH1 gene mutations in gliomas.

[0083] 5'- CTTG ATCCCCATAAGCATGATGAC-3', SEQ ID NO:4.

[0084] 1.2 RPA Amplification Assay

[0085] The RPA amplification steps are as follows:

[0086] Following the amplification system shown in Table 1 below, using IDH1-R132H mutant gDNA as a template, an RPA isothermal amplification experiment was performed on the target gene. The gDNA did not contain the target fragment. The RPA amplification kit used was the DNA isothermal amplification kit (basic type) from Shenzhen Yizhi Biotechnology Co., Ltd.

[0087] Table 1 Amplification System

[0088] Primers Forward primer (20 μM) 0.5μL Reverse primer (20 μM) 0.5μL ReactionBuffer(2X) 10μL E-mix(10X) 2μL P-mix(10X) 2μL DNA template 1μL <![CDATA[ddH2O]]> 2μL Start of reaction Starter (10X) 2μL

[0089] After mixing the above system on ice, bounce it several times to mix it thoroughly or invert it and toss it to mix it thoroughly. Centrifuge it briefly and repeat 3 times (make sure to mix it thoroughly and avoid violent shaking and vortexing).

[0090] The RPA reaction system was then incubated in a 39°C thermostat for 30 minutes to obtain the RPA amplification product. The amplification results are shown in the figure. Figure 1 .

[0091] The amplification products were purified by heating at 65℃ for 10 min, detected by 3% agarose gel electrophoresis, and imaged using a Bio-Rad gel imaging system.

[0092] 1.3 Comparison of mutation detection in different PAM sequences

[0093] After obtaining the RPA amplification products, we designed an experiment to verify the mutation detection capability of non-traditional VTTV type PAM sequences by comparing different PAM sequences. The experimental design is shown in Table 2.

[0094] Table 2 compares the feasibility of different PAM sequences in the detection of IDH1 gene R132H mutations.

[0095]

[0096] The crRNA sequence of the experimental group is as follows:

[0097] UAAUUUCUACUAAGUGUAGAU CTTG ATCCCCATAAGCATGATGAC, SEQ ID NO: 13;

[0098] The crRNA sequence of control group 1 is as follows:

[0099] UAAUUUCUACUAAGUGUAGAU TTTG ATCCCCATAAGCATGATGAC, SEQ ID NO:14;

[0100] The crRNA sequence of control group 2 is as follows:

[0101] UAAUUUCUACUAAGUGUAGUATCCCCATAAGCATGATGAC, SEQ ID NO: 15.

[0102] The comparison between the experimental and control groups validated the effectiveness of the non-traditional PAM design, resolving the core technical problem of PAM sequence mismatch in IDH1 R132H mutation detection. By optimizing the relative positions of the spacer sequence and PAM (the mutant base is located at positions 5-6 at the 5' end of the spacer), the specific recognition and cleavage of the target DNA by Cas12a was ensured. Results are as follows... Figure 1 As can be seen, compared with the control group, the experimental group (using VTTV type PAM) successfully amplified the target fragment, and the gel electrophoresis showed clear bands, while the control group (traditional TTTV or no PAM) did not amplify effectively, proving that VTTV type PAM can replace the traditional PAM sequence.

[0103] Example 1 systematically verified the feasibility and effectiveness of VTTV-type PAM-based crRNA design in IDH1 gene mutation detection, providing a reliable technical foundation for rapid clinical screening. Its innovation lies in overcoming the limitations of traditional PAM sequences, and the experimental data supports the practicality of the technical solution.

[0104] Example 2: Improving the Accuracy of IDH1 Mutation Detection Based on Multi-channel Calibration of Standard Ladder

[0105] Example 2 is designed by introducing a multi-channel calibration system based on a standard ladder.

[0106] First, the best-performing crRNA4 was screened through multiple crRNA experiments. Its fluorescence signal showed significant differences, ensuring specific recognition of the target sequence. Then, a concentration-fluorescence intensity standard curve was established using synthetic DNA fragments containing different percentages of mutant cells (0%-100%). Combined with real-time background correction, the problem of inaccurate fluorescence signal quantification was successfully solved.

[0107] Guide RNA selection: Based on multiple different target sites in the mutated gene (these sites can be distributed in different regions of the gene, including regions near and far from the mutation site), six sets of crRNA sequences were designed, namely:

[0108] crRNA1: UAAUUUCUACUAAGUGUAGAUCTTGATCCCCATAAGCATG(19), SEQ ID NO: 5;

[0109] crRNA2: UAAUUUCUACUAAGUGUAGAUCTTGATCCCCATAAGCATG(19)A, SEQ ID NO: 6;

[0110] crRNA3: UAAUUUCUACUAAGUGUAGAUCTTGATCCCCATAAGCATG(19)AT, SEQ ID NO:7;

[0111] crRNA4: UAAUUUCUACUAAGUGUAGAUCTTGATCCCCATAAGCATG(19)ATG, SEQ ID NO: 8;

[0112] crRNA5: UAAUUUCUACUAAGUGUAGAUCTTGATCCCCATAAGCATG(19)ATGA, SEQ ID NO:9;

[0113] crRNA6: UAAUUUCUACUAAGUGUAGAUCTTGATCCCCATAAGCATG(19)ATGAC, SEQ ID NO:10.

[0114] like Figure 2 Curves ① to ⑥ show that no IDH1 mutant gene fragment was added in the experiment; only the above 6 different crRNAs (synthesized by Beijing Qingke Biotechnology Co., Ltd.) were used to bind with IDH1 wild-type gDNA. Curves ⑦ to... In the experiment, IDH1-R132H mutant gDNA was added, and the above 6 different crRNAs were used to bind to IDH1-R132H mutant gDNA.

[0115] The results showed that the fluorescence value of crRNA4 was most significantly different after the addition of the IDH1 mutant gene fragment, so crRNA4 was selected for subsequent experiments.

[0116] 1.1 Materials and Instruments

[0117] (1) Standard ladder: Synthetic DNA fragments containing the IDH1 R132H mutant gene, i.e., wild-type IDH1 gDNA and mutant IDH1-R132H gDNA are mixed in the proportions of 0:100, 25:75, 50:50, 75:25, 100:0, and the total DNA concentration is uniformly 10 ng / μL.

[0118] (2) Samples to be tested: DNA extracted from two groups of clinical FFPE tissues, sample 1 and sample 2 (containing an unknown proportion of IDH1 mutant cells).

[0119] (3) Detection system:

[0120] CRISPR-Cas12a system (crRNA targets the IDH1 R132H mutation site).

[0121] Multichannel fluorescence detector (excitation wavelength 485nm, emission wavelength 520nm)

[0122] The ssDNA fluorescent probe can be an oligonucleotide conventionally designed in the field (such as 5'-FAM-TTATT-BHQ1-3').

[0123] (4) Control: Wild-type gDNA was used as a negative control.

[0124] 1.3 Experimental Procedure

[0125] 1.3.1 Construction of Standard Sample Signal Calibration Curve

[0126] The standard ladder (containing the percentages of 5 known mutations) was mixed with the Cas12a / crRNA complex and the fluorescent reporter probe, respectively. The mixture was incubated at 37°C for 10 min to allow for complete binding of crRNA and Cas12a. Three biological replicates were performed. Different concentration gradients were synthesized, namely, wild-type IDH1 gDNA and mutant IDH1-R132H gDNA were mixed at ratios of 0:100, 25:75, 50:50, 75:25, and 100:0, with a total DNA concentration of 10 ng / μL. The results were verified by agarose gel electrophoresis.

[0127] The above reaction system was gently mixed by pipetting and transferred to an opaque 96-well plate, ensuring the liquid completely covers the bottom of each well. The 96-well plate was then simultaneously monitored via multiple channels. The fluorescence detection program was set as follows: 6-FAM excitation wavelength (Exc wavelength) 485 nm, emission wavelength (Ems wavelength) 520 nm, incubation at 37°C, and fluorescence signal detection every 30 seconds for a total of 40 minutes. Channel 1: Target sample signal (fluorescence value of the mutant DNA cleavage probe); Channel 2: Standard signal (fluorescence value corresponding to the concentration gradient); Channel 3: Background correction (negative control signal). After detection, the values ​​were exported and statistically analyzed using GraphPad Prism 8.0.2 software to generate a concentration-fluorescence intensity standard curve. The results are shown below. Figure 3As the proportion of IDH1 gene mutant fragments increased, the fluorescence signal intensity gradually increased and became clearly distinguishable. This indicates that crRNA4 can effectively recognize and bind to the target sequence, and the signal intensity is positively correlated with the proportion of mutant fragments.

[0128] 1.3.3 Comparison of signals between the measured sample and the standard ladder

[0129] The test results for the two wild-type samples are as follows: Figure 4 As shown, by comparing the signal graphs with those of the standard, the results for sample 1 are between curves 3 and 4, indicating that the mutant gene content in sample 1 is between 25% and 50%; the results for sample 2 are between curves 1 and 2, indicating that the mutant gene content in sample 2 is between 70% and 100%. The detection results show 98% consistency with Sanger sequencing.

[0130] This demonstrates that the method can effectively improve the accuracy of identifying the content of IDH1 gene mutant cells.

[0131] Example 2 introduces a multi-channel calibration system based on a standard ladder. Multiple sets of crRNA experiments screened out the best-performing crRNA4, whose fluorescence signals showed significant differences, ensuring specific recognition of the target sequence. A concentration-fluorescence intensity standard curve was established using synthetic DNA fragments containing different percentages of mutant cells (0%-100%). Combined with real-time background correction, accurate quantification of mutant cell content was achieved. This successfully solved the problem of inaccurate fluorescence signal quantification.

[0132] In summary, the CRISPR-Cas12a-based glioma IDH1 gene mutation detection kit proposed in this invention solves two key problems of the prior art through two core embodiments:

[0133] 1. Breaking through the limitations of traditional TTTV-type PAM sequences, through VTTV-type PAM design and spacer sequence optimization, specific identification and amplification of IDH1 R132H mutations were achieved, laying the foundation for rapid detection.

[0134] 2. By introducing a standard ladder and a multi-channel calibration system, combined with a mathematical fitting model, the accuracy and repeatability of fluorescence signal quantification are significantly improved, solving the problem of detecting low-abundance mutations in clinical samples.

[0135] The combination of these two methods not only shortens the detection time (30 minutes) but also improves the reliability of the results (CV < 5%, 98% consistency with sequencing), providing an efficient tool for early screening and personalized treatment of gliomas. Future research should focus on further optimizing the detection stability of complex samples (such as low-concentration or degraded DNA) and expanding the application to other gene mutation types to promote the widespread use of this technology.

[0136] The above are merely a few preferred embodiments of the present invention, described in a relatively specific and detailed manner, but they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention.

Claims

1. A rapid detection kit for IDH1 gene mutations in gliomas based on CRISPR-Cas12a, characterized in that, include: (1) RPA-specific isothermal amplification primers for the IDH1-R132H mutant gene; (2) CRISPR-Cas12a detection system, including: Specific crRNA: The sequence of the crRNA is shown in SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8; Cas12a protein; ssDNA fluorescent probe; (3) Standard ladder containing wild-type IDH1 gDNA as shown in SEQ ID NO:11 and mutant IDH1-R132H gDNA as shown in SEQ ID NO:

12.

2. The rapid detection kit for IDH1 gene mutation in glioma based on CRISPR-Cas12a according to claim 1, characterized in that, The sequences of the RPA-specific isothermal amplification primers are shown in SEQ ID NO:1 and SEQ ID NO:

2.

3. The rapid detection kit for IDH1 gene mutation in glioma based on CRISPR-Cas12a according to claim 1, characterized in that, The fluorescence detection wavelength of the ssDNA fluorescent probe is 485nm for excitation and 520nm for emission.

4. A primer for RPA-specific isothermal amplification targeting the IDH1-R132H mutant gene in glioma, characterized in that, It contains: a forward primer with a sequence as shown in SEQ ID NO:1 and a reverse primer with a sequence as shown in SEQ ID NO:

2.

5. A CRISPR-Cas12a detection system for the IDH1-R132H mutation gene in gliomas, characterized in that, include: Specific crRNA: The crRNA is designed using a non-traditional PAM sequence, the non-traditional PAM sequence being CTTG, and the sequence of the crRNA is shown in SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8; Cas12a protein; ssDNA fluorescent probe.

6. A PAM sequence for the CRISPR-Cas12a detection system according to claim 5, characterized in that, The PAM sequence is a non-traditional PAM sequence, and the PAM sequence is CTTG.

7. A semi-quantitative detection method for IDH1 gene mutations in gliomas based on CRISPR-Cas12a, characterized in that, Includes the following steps: (1) Extract DNA from the sample to be tested; (2) DNA was amplified using RPA-specific isothermal amplification primers to obtain amplification products; (3) The amplification product is mixed with a CRISPR-Cas12a detection system, incubated, and then the fluorescence signal is detected; the detection system includes: Specific crRNA: The crRNA is designed using a non-traditional PAM sequence, and the sequence of the crRNA is shown in SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8; Cas12a protein; ssDNA fluorescent probe; (4) The fluorescence signal is quantitatively analyzed by a multi-channel calibration system of a standard ladder, wherein the standard ladder includes wild-type IDH1 gDNA as shown in SEQ ID NO:11 and mutant IDH1-R132H gDNA as shown in SEQ ID NO:

12.

8. The semi-quantitative detection method according to claim 7, characterized in that, The sequences of the RPA-specific isothermal amplification primers are shown in SEQ ID NO:1 and SEQ ID NO:

2.

9. The semi-quantitative detection method according to claim 7, characterized in that, The fluorescence detection wavelength of the ssDNA fluorescent probe is 485nm for excitation and 520nm for emission.

Images