InDel molecular marker primer for screening sweet corn type with increased waxiness and application of InDel molecular marker primer

By designing InDel molecular marker primers, PCR amplification and agarose gel electrophoresis techniques were used to rapidly screen sweet corn germplasm resources that can improve waxiness, thus solving the problem of improving the waxiness of sweet corn and enhancing its taste and nutritional value.

CN120924705APending Publication Date: 2025-11-11JIANGSU ACAD OF AGRI SCI
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202511138279.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-14
Publication Date
2025-11-11

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively enhance the glutinous texture of fresh sweet corn, resulting in its inability to meet the diverse needs of consumers in terms of nutritional value and taste.

Method used

InDel molecular marker primers were developed to rapidly screen sweet corn germplasm resources that can improve waxiness through PCR amplification and agarose gel electrophoresis. Using InDel molecular marker primers starting at position 10350175bp on chromosome 9 of the B73-V4 genome, forward and reverse primers were designed for genomic DNA identification.

Benefits of technology

This method enables the rapid and convenient screening of sweet corn germplasm resources that can improve waxiness, thus accelerating the waxiness improvement process of sweet corn, enriching germplasm types, and increasing economic value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120924705A_ABST
    Figure CN120924705A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of crop breeding, in particular to an InDel molecular marker primer for screening a sweet corn type with increased waxiness and application of the InDel molecular marker primer, the InDel molecular marker primer comprises a forward primer and a reverse primer, and the sequences of the forward primer and the reverse primer are shown as SEQ ID NO: 1-2. The primer starts from the 10350175bp position of the No.9 chromosome of the B73-V4 genome, and whether the sweet corn type can achieve the purpose of waxiness enhancement or not can be determined through the InDel molecular marker primer. By adopting the InDel molecular marker primer provided by the invention for assistance, a technical support can be provided for breeding and improvement of the fresh corn.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of crop breeding technology, specifically to an InDel molecular marker primer for screening sweet corn varieties with increased waxiness and its application. Background Technology

[0002] Sweet corn, with its thin skin, sweet taste, crispness, and juiciness, combines the characteristics of whole grains, vegetables, and fruits. It can be eaten directly, steamed or boiled, or even eaten as a vegetable, and has higher nutritional value than regular corn. However, the development of sweet corn kernels inhibits the conversion of sugar into starch, resulting in low starch content, high water content, and a predominance of soluble sugars. This developmental characteristic of sweet corn kernels leads to a lower dry matter content and a lack of the characteristic glutinous texture, failing to meet the taste preferences of many consumers. Glutinous corn, on the other hand, has a high dry matter content, is soft and chewy, and has a low sugar content, making it popular with consumers. Adding glutinousness to sweet corn would enhance its crispness and sweetness, increasing its soft and chewy texture, diversifying the flavor profile of fresh corn, expanding its consumer base, and increasing its economic value.

[0003] However, not all sweet corn varieties can improve the waxiness of their kernels. Most sweet corn varieties, even after the introduction of waxy genes, still exhibit the sweet corn phenotype with double or multiple recessive sweet and waxy gene types, failing to achieve the goal of improving kernel waxiness. Therefore, analyzing the genetic basis for improving the waxiness of sweet corn kernels and applying it to the breeding of fresh corn will have significant economic value for the innovation, breeding, and improvement of germplasm resources of sweet and waxy corn varieties.

[0004] Currently, research on improving the waxiness of sweet corn is limited, and the related genetic mechanisms remain unclear. However, molecular markers can be used to identify germplasm resources, aiming to screen for sweet corn germplasm resources that can achieve improved waxiness. Therefore, it is necessary to develop molecular markers to identify sweet corn germplasm resources that can achieve improved waxiness, thereby promoting the breeding process of sweet corn with enhanced waxiness. InDel mutations are caused by the insertion or deletion of a certain number of bases, are genetically stable, widely distributed in the maize genome, exhibit co-dominance, are easily detected by PCR, and are low in cost. Developing InDel molecular markers has significant application value.

[0005] Therefore, developing InDel molecular markers that can quickly, easily, and efficiently screen fresh sweet corn germplasm resources that can improve waxiness, and using them for assisted breeding of fresh sweet corn, will help promote variety innovation of fresh sweet corn and enrich the types of sweet corn germplasm. Summary of the Invention

[0006] The purpose of this invention is to provide an InDel molecular marker primer for screening sweet corn varieties with increased waxiness and its application.

[0007] To achieve the above objectives, the present invention provides the following technical solution:

[0008] This invention uses 20 waxy sweet corn kernels and 22 waxy corn kernels isolated from the same ear as research subjects. Resequencing and BSA analysis were performed using the Illumina platform to obtain variant sites associated with waxy sweetness in corn. InDel molecular marker primers were designed near these variant sites using Primer 3.0 software. After PCR amplification and agarose gel electrophoresis, one InDel molecular marker primer was selected.

[0009] The InDel molecular marker primers of this invention originate at position 10350175 bp on chromosome 9 of the B73-V4 genome. The InDel molecular marker primers include a forward primer and a reverse primer, the sequences of which are shown in SEQ ID NO:1-2.

[0010] The specific information is as follows:

[0011] TN07:

[0012] F:TTCCAAGTGCAACACGTATTCG R:GTACGCAAATAGGGCCACTCC.

[0013] This invention provides applications of the above-mentioned InDel molecular marker primers, including rapid screening and identification of sweet corn germplasm resources that can achieve improved waxiness and / or marker-assisted breeding of maize.

[0014] The method for rapidly screening and identifying sweet corn germplasm resources that can improve waxiness includes the following steps:

[0015] 1) Extraction of genomic DNA from the leaves of seedlings of the sweet corn germplasm resources to be tested;

[0016] 2) PCR amplification of the genomic DNA and B73 genomic DNA of the sweet maize germplasm resources to be tested was performed using the InDel molecular marker primers described in claim 1 or 2;

[0017] 3) Agarose gel electrophoresis of PCR products;

[0018] 4) If the electrophoresis results of the PCR product of the germplasm DNA of the germplasm resource to be tested are inconsistent with those of B73, the waxiness of this type of sweet corn can be improved by backcrossing.

[0019] In step 2), the genomic DNA of the maize seedling to be tested is used as a template and B73 genomic DNA is used as a control. PCR amplification is performed using TN07 primers. The PCR amplification conditions include: 94℃ for 3 min; (94℃ for 30 s, 59℃ for 30 s, 72℃ for 30 s) × 38 cycles; 72℃ for 3 min; and storage at 4℃.

[0020] In step 3), the agarose gel electrophoresis conditions are as follows: prepare a 3% concentration agarose gel with added nucleic acid dye, maintain a constant voltage of 120V, electrophoresis time of 1h to 1.5h, develop color and take pictures under ultraviolet light, and then analyze.

[0021] In step 4), the electrophoresis results are compared with the electrophoresis results of the B73 genome PCR product. If the electrophoresis results of the test material are inconsistent with those of B73, then the waxy texture of this type of sweet corn can be improved. If they are inconsistent, it is not easy to improve the waxy texture.

[0022] This invention also provides a kit for rapidly screening sweet corn germplasm resources that can achieve improved waxiness, comprising the aforementioned InDel molecular marker primers. The kit may also include a 2×master MIX for PCR amplification, sterile water, and B73 genomic DNA.

[0023] Compared with the prior art, the beneficial effects of the present invention are:

[0024] This invention, through genome association analysis of the glutinous sweetness trait, identifies gene-related loci associated with glutinous sweetness and determines the relevant locus (10350175bp on chromosome 9 of the B73-V4 genome) that can improve the glutinousness of sweet corn. It also develops InDel molecular marker primers related to glutinous sweetness and further utilizes PCR amplification and agarose gel electrophoresis to rapidly screen fresh sweet corn germplasm suitable for glutinousness improvement, quickly identify the genotype of seedlings undergoing improvement, and determine the desired seedlings, providing a new method for improving the glutinousness of sweet corn. Attached Figure Description

[0025] Figure 1 The image shows the electrophoresis results of PCR for glutinous sweet corn and other types of sweet corn. The lane order from left to right is as follows: glutinous sweet corn, su1, wxwxsu1su1, bt1, wxwxbt1bt1, sh2, wxwxsh2sh2, glutinous corn, glutinous corn, B73.

[0026] Figure 2 The image shows the PCR results of 28 randomly selected grains from a self-pollinated ear of the glutinous sweet hybrid type. The lane order from left to right is as follows: glutinous sweet, glutinous sweet, glutinous sweet, glutinous sweet, glutinous sweet hybrid, glutinous sweet hybrid, glutinous sweet hybrid, pure glutinous, pure glutinous, glutinous sweet hybrid, pure glutinous, pure glutinous, glutinous sweet hybrid, glutinous sweet hybrid, glutinous sweet hybrid, glutinous sweet, glutinous sweet hybrid, pure glutinous, pure glutinous, glutinous sweet hybrid, pure glutinous, pure glutinous, pure glutinous, pure glutinous, pure glutinous, pure glutinous, pure glutinous, pure glutinous, pure glutinous, pure glutinous, pure glutinous, pure glutinous, pure glutinous, pure glutinous, pure glutinous, pure glutinous, pure glutinous, pure glutinous, pure glutinous, pure glutinous, B73. Detailed Implementation

[0027] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0028] Unless otherwise specified, the test methods and reagents used in the following examples are all conventional methods and laboratory reagents.

[0029] Example 1

[0030] The genomic DNA extraction in this invention was carried out using a novel plant genomic DNA extraction kit produced by Shanghai Pudi Biotechnology to extract seedling DNA. The PCR system was a 20 μL system: 10 μL 2×master Mix, 2 μL ~50 ng / μL genomic DNA solution, 1 μL each of forward and reverse primers (10 μM), and 6 μL sterile water. PCR amplification conditions were: 94℃ for 3 min, (94℃ for 30 s, 59℃ for 30 s, 72℃ for 30 s) × 38 cycles, 72℃ for 5 min, and storage at 4℃. Agarose gel electrophoresis of the PCR products was performed using 3% agarose gel with added nucleic acid dye, at a constant voltage of 120 V, for 1 h to 1.5 h, followed by UV development, photographing, and analysis.

[0031] Genome resequencing was performed on 20 sweet and 22 waxy corn kernels differentiated from a mutant waxy corn plant. Using the B73-V4 genome as a reference, resequencing was performed using the Illumina platform, followed by BSA analysis to pinpoint the 10350 kb location on chromosome 9 of the B73-V4 genome. InDel molecular marker primers were designed for the relevant region. These InDel molecular marker primers included forward and reverse primers, with sequences shown in SEQ ID NO:1-2.

[0032] The specific information is as follows:

[0033] TN07:

[0034] F:TTCCAAGTGCAACACGTATTCG R:GTACGCAAATAGGGCCACTCC.

[0035] InDel molecular marker primers were used to perform PCR identification of genomic DNA from sweet corn, three types of sweet corn and their double-cryptic sweet corn materials, waxy corn, and B73. Electrophoresis results of the PCR products showed that primer TN07 could effectively distinguish sweet corn from other germplasms, indicating that a small 20bp-30bp sequence insertion in the sweet corn genome sequence caused differences in the PCR products of other germplasms. Figure 1 As shown. The TN07 molecular marker primer start position: 10350175bp-10350428bp, and the B73 genome PCR product length is 253bp.

[0036] Example 2

[0037] A mutant waxy corn plant differentiated into sweet corn kernels with enhanced waxiness and waxy corn kernels (segregation ratio approximately 1:3) and sown them separately. DNA was extracted from 28 of the seedlings, and PCR and electrophoresis were performed using TN07 primers. Figure 2 As shown, the lane order is as follows: glutinous sweet, glutinous sweet, glutinous sweet, glutinous sweet, glutinous sweet heterozygous, glutinous sweet heterozygous, glutinous sweet heterozygous, pure glutinous, pure glutinous, glutinous sweet heterozygous, pure glutinous, pure glutinous, glutinous sweet heterozygous, glutinous sweet heterozygous, glutinous sweet, glutinous sweet heterozygous, glutinous sweet, glutinous sweet heterozygous, pure glutinous, pure glutinous, glutinous sweet heterozygous, glutinous sweet heterozygous, pure glutinous, pure glutinous, glutinous sweet heterozygous, glutinous sweet heterozygous, pure glutinous, B73. The glutinous sweet grain phenotype is consistent with the PCR results, and the grain phenotype of the self-pollinated ears of heterozygous plants shows a 1:3 segregation. Furthermore, no phenotypic segregation was observed in the pure glutinous grains. The TN07 primer can effectively distinguish between the glutinous sweet, glutinous sweet heterozygous, and non-glutinous sweet gene types.

[0038] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. An InDel molecular marker primer for screening sweet corn varieties with increased waxiness, characterized in that: The InDel molecular marker primers include a forward primer and a reverse primer, the sequences of which are shown in SEQ ID NO:1-2.

2. The InDel molecular marker primer according to claim 1, characterized in that: The InDel molecular marker primers are initiated at position 10350175bp on chromosome 9 of the B73-V4 genome.

3. The application of the InDel molecular marker primers according to claim 1 or 2, characterized in that: This includes rapid screening and identification of sweet corn germplasm resources that can improve waxiness and / or marker-assisted breeding of maize.

4. The application of the InDel molecular marker primer according to claim 3, characterized in that: The method for rapid screening and identification of sweet corn germplasm resources that can achieve improved waxiness includes the following steps: 1) Extraction of genomic DNA from the leaves of seedlings of the sweet corn germplasm resources to be tested; 2) PCR amplification of the genomic DNA and B73 genomic DNA of the sweet maize germplasm resources to be tested was performed using the InDel molecular marker primers described in claim 1 or 2; 3) Agarose gel electrophoresis of PCR products; 4) If the electrophoresis results of the PCR product of the germplasm DNA of the germplasm resource to be tested are inconsistent with those of B73, the waxiness of this type of sweet corn can be improved by backcrossing.

5. The application of the InDel molecular marker primer according to claim 4, characterized in that: In step 2), the PCR amplification conditions include: 94℃ for 3 min; 94℃ for 30 s, 59℃ for 30 s, 72℃ for 30 s, 38 cycles; 72℃ for 3 min; and storage at 4℃.

6. The application of the InDel molecular marker primer according to claim 5, characterized in that: In step 3), the agarose gel electrophoresis conditions are: agarose gel concentration of 3%, constant voltage of 120V, and electrophoresis time of 1h to 1.5h.

7. The application of the InDel molecular marker primer according to claim 6, characterized in that: In step 4), the electrophoresis results are compared with the electrophoresis results of the B73 genome PCR product. If the electrophoresis results of the test material are inconsistent with those of B73, then the waxy texture of this type of sweet corn can be improved. If they are inconsistent, it is not easy to improve the waxy texture.

8. A kit for rapid screening of sweet corn germplasm resources that can improve waxiness, characterized in that: Includes the InDel molecular marker primers as described in claim 1 or 2.

Citation Information

Patent Citations

  • Molecular marker for detecting Wx1, and method of applying marker to waxy maize breeding

    CN111518940A

  • InDel molecular marker co-separated from corn brittle gene and application thereof

    CN112430682A

  • InDel marker closely linked with sweet-glutinous same-grain character of corn ear and application of InDel marker

    CN120400418A

  • Method for breeding fresh-eating waxy corn variety with sweet taste

    US20230337614A1

  • Maize dwarfing-related molecular marker having semi-dominance and use thereof

    WO2024077984A1