Molecular marker closely linked with rice stalk thickness QTL qPLAR2 and application of molecular marker

Abstract

The invention discloses a molecular marker closely linked with rice stalk thickness QTL qPLAR2 and application of the molecular marker, the QTL qPLAR2 is located in the 3, 146, 861-4, 134 and 217 bp interval of the second chromosome, the molecular marker is an InDel marker designed according to the 250th-261th nucleotide sequence difference of SEQ ID No.1, and when the genotype is homozygous 9311 type genotype Homo9311, the molecular marker is thick-stalk rice to be detected or a candidate material. According to the method, chromosome segment substitution line materials constructed by parents with significant difference in stem diameter are used as positioning populations, gene loci related to the stem diameter are excavated under the whole genome background, and the loci can be used for commercialized thick-stem rice molecular breeding. The molecular marker-assisted selection efficiency is high, molecular marker-assisted selection can be carried out in the rice seedling stage, the selection efficiency is improved, and the breeding process of strong-stalk lodging-resistant varieties is accelerated.

Description

Technical Field

[0001] This invention relates to rice genetics and breeding, specifically to a QTL (Quality of Thickness) for rice stems. qPLAR2 Tightly linked molecular markers and their applications. Background Technology

[0002] Rice is my country's largest grain crop, and its high and stable yields are of great significance to ensuring my country's food security. The promotion of large-panicle high-yield rice varieties and the widespread application of simplified cultivation techniques such as direct seeding and transplanting have led to lodging frequently occurring in the middle and late stages of rice growth. It has been reported that the annual yield reduction due to rice lodging is about 10-30%, which seriously restricts rice production (Zhu Zhonglin et al., Acta Agronomica Sinica, 2024, 50(5):1351-1360.). Therefore, cultivating high-yield and lodging-resistant rice varieties is of great practical significance.

[0003] Studies have shown that stem strength is significantly positively correlated with lodging resistance, and enhancing stem strength is an effective way to improve lodging resistance and ensure high and stable yields in rice (Liu Chang et al., Chinese Journal of Rice Science, 2016, 30(2):216–222.). Stem strength is a complex trait, influenced by various factors such as stem thickness, cavity wall thickness, and the number of vascular bundles. Numerous studies have confirmed that stem thickness is the main factor affecting stem strength (Kashiwagi T, et al. Theor Appl Genet, 2008, 117(5):749-757; Guan Yuping et al., Jilin Agricultural Sciences, 2004, 29(4):6-11; Wang Yi et al., Hubei Agricultural Sciences, 2015(9):2054-2057.). Since stem thickness is a typical quantitative trait (QTL) controlled by multiple genes, the limitations of using traditional breeding techniques to select for this trait are obvious.

[0004] Molecular marker-assisted selection (MAS) breeding offers significant advantages, enabling a shift from traditional empirical breeding to targeted and efficient precision breeding. Successful implementation of this technology relies on a large number of favorable gene loci and molecular markers capable of efficiently detecting target genes (Guo Rui et al., *Chinese Journal of Basic Sciences*, 2022, 24:9-17). Since molecular markers can select target plants at the DNA level at any stage of rice development, they can effectively improve the selection efficiency of individual plants. Currently, although some genes regulating stem thickness, such as… OsTB1 , SCM2 , SCM3 , IPA1 , DEP1While these genes have been reported, existing genetic resources are insufficient to meet the needs of breeding practices. Therefore, there is an urgent need to discover more key genes regulating stem diameter and develop molecular markers closely linked to them that can be used for efficient selection. Summary of the Invention

[0005] To address the problem that existing genetic resources cannot meet the breeding requirements for thick stems and lodging resistance, this invention provides a method related to the QTL of rice stem thickness. qPLAR2 Tightly linked molecular markers and their applications: Improving the breeding efficiency of strong-stem rice varieties by discovering new stem thickness sites and their tightly linked molecular markers.

[0006] To achieve the above objectives, the present invention provides a method for measuring the QTL of rice stem diameter. qPLAR2 Closely linked molecular markers, QTLs qPLAR2 Located within the 3,146,861-4,134,217 bp region of chromosome 2, the molecular marker is an InDel marker designed based on the nucleotide sequence difference between nucleotides 250-261 of SEQ ID No. 1. This marker is used when the genotype is homozygous (9311 genotype Homo). 9311 At that time, the rice or candidate material was coarse-stalked.

[0007] SEQ ID No. 1: ACTTGGCTTTTTTCTATTCCCCAATGACTTCTTCTTCCTCCTCCTCCACAGTCCACACTGTTCATCTCCTCCTCCCCTCCCTCCCAATTCGATTCCCAAATCCCAAAATTGACCACCCAAATCCGCGCCAATCCATGGATTGGATGCCTCCTCCGAAGCCCACCTCGCCGCGCTCCCCTCCCCTCCTCTGGGACTGGGCCGACGCCGCCGTGCCGGGCTCCTCCTCCGGCGAGGTATCCGCCGCCGC[CGC CGCCGCCGC / -----------]GGCTCATCCGGGAAGGCGGCGGAAGGAGAAGCGAGGCAGGGCGGAGGAAGGAGGAGGTGGTGGTGGGGAGGTGAGGTGCCAGGTGGAAGGGTGCGGGGTGGAGCT CGTCGGCGTCAAGGACTACCACCGGAAGCACCGCGTGTGCGAGGCCCACTCCAAGTTCCCCCGCGTCGTCGTCGCCGGCCAGGAGCGCCGCTTCTGCCAGCAGTGCAGCCGGTGAGCTCGCCGGAG. Among them, ----------- represents the corresponding base deletion.

[0008] A second aspect of the present invention provides primers for detecting the above-mentioned molecular markers, comprising the primers shown in SEQ ID No. 2 and SEQ ID No. 3.

[0009] SEQ ID No. 2: 5'- GATTGGATGCTCCTCCGAAG-3'; SEQ ID No. 3: 5'-ACCACCACCTCCTCCTTCCT-3'.

[0010] A second aspect of the present invention provides the application of the above-described primers in the detection of the above-described molecular markers.

[0011] A third aspect of the present invention provides PCR reagents and kits comprising the primers described above.

[0012] The fourth aspect of the present invention provides the application of the above-described PCR reagents or kits in the detection of the above-described molecular markers.

[0013] The fifth aspect of the present invention provides the application of the above-described molecular markers in any of the following: S1. Application in identifying or assisting in the identification of rice stem thickness; S2. Application in the preparation and identification or auxiliary preparation and identification of rice products with thick and strong stems; S3. Application in rice-assisted breeding or preparation of rice-assisted breeding products.

[0014] Through the above technical solution, the present invention achieves the following beneficial effects: This invention develops a new rice thick stalk site. qPLAR2 Corresponding InDel molecular markers were developed for rapid gene typing and identification, which can be applied to rice molecular breeding. At the same time, the phenotypic selection efficiency of the above loci is high, and the thick stem gene in rice can be detected quickly and accurately. Molecular marker-assisted selection can be carried out in the rice seedling stage to improve selection efficiency and accelerate the breeding process of thick-stemmed and lodging-resistant varieties. Attached Figure Description

[0015] Figure 1 The stem thickness phenotypes of the two parents are: a) for the indica rice variety 9311, and b) for the japonica rice variety Nipponbare. Figure 2 This is based on the Bin-Map genome-wide stem strength QTL mapping results; Figure 3 yes qPLAR2 Electrophoretic pattern of tightly linked molecular marker 9516-STS1, P1 is 9311, P2 is Nipponbare, P1+P2 represents the parental genotypes, i.e., heterozygous genotype. Figure 4 This is the sequencing map of chromosome segment substitution line N133. The blue rectangle represents the Nipponbare genome, and the red rectangle represents the 9311 genome. Detailed Implementation

[0016] The specific embodiments of the present invention will be described in detail below with reference to examples. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.

[0017] Example 1: Selection of Gene Mapping Population Stem thickness is a typical quantitative trait, and the CSSL (Continuous Stranded Stratified Strains) population is an ideal population for locating this trait. The inventors' institution constructed a CSSL population with indica rice 9311 as the donor parent and japonica rice Nipponbare as the recipient parent, comprising 127 lines (Xu, et al Scientific Reports, 2017, 7: 12561.). To evaluate whether this population could effectively locate the stem thickness QTL, the 127 lines and their corresponding parent materials were first field-planted, with 8 rows and 10 plants per row for each material, under conventional cultivation management. The planting was conducted at the inventors' experimental base. First, the stem thickness of varieties 9311 and Nipponbare was measured. The measurement method was as follows: after the rice plants had headed, the second internode from the top of the panicle on 10 normally developing main stems was selected, and the stem thickness was measured using vernier calipers at a distance of 1 cm from the upper node. To reduce measurement error, each stem was measured three times, and the average value was taken as the stem thickness of the plant. The classification criteria for stem thickness are as follows: greater than 3.5 mm is considered coarse, 3.1-3.5 mm is intermediate, and less than 3.1 mm is fine. Measurements show that the stem thickness of 9311 is 4.32 ± 1.11 mm, and that of Nipponbare is 3.03 ± 0.87 mm. One-way ANOVA in SPSS 23.0 software was used to perform statistical analysis on the significance of data differences, with a significance level set at [value missing]. P <0.05, the highly significant level is set to P <0.01. The results showed that the stem thickness of 9311 was significantly greater than that of Nipponbare (…). Figure 1 Furthermore, the same method was used to analyze the stem thickness of 127 lines. The results showed that 16 lines exhibited a thin stem phenotype, 91 lines exhibited an intermediate phenotype, and 20 lines exhibited a thick stem phenotype. The Kolmogorov-Smirnov test confirmed that the phenotypic data conformed to a normal distribution. These results indicate that this population is an ideal population for locating the QTL for stem thickness.

[0018] Example 2: Localization of stem-thick QTLs and Development of Linked Molecular Markers Based on the phenotypic data of the population identified in Example 1, and combined with the Bin-Map of this population constructed by the inventors (Xu, et al Scientific Reports, 2017, 7: 12561.), the QTLs for rice stem strength were located using the composite interval mapping method in the Icimapping 4.0 CSL template. The threshold for QTL location, i.e., the LOD value, was set to 2.5. The number of stem strength QTLs and their positions on the chromosomes were then detected. Figure 2 The results showed that, against a genome-wide background, a total of four QTLs were identified that could increase stem thickness, namely: qPLAR2 , qPLAR5 , qPLAR6 and qPLAR9 Analysis of the contribution rates of these four sites revealed that qPLAR9 Highest contribution rate qPLAR2 Secondly, further analysis reveals that... qPLAR9 The location range includes cloned ones. DEP1 This gene can increase stem thickness, suggesting it may be a candidate gene. qPLAR2 The mapping interval does not contain any previously reported genes for stem thickness, therefore the focus is on... qPLAR2 Perform the analysis.

[0019] qPLAR2 Derived from the coarse-stemmed rice variety 9311, this sequence, when introduced into the Nipponbare japonica rice cultivar, can increase stem diameter. Referring to the Nipponbare genome information (MSU RGAP Release 7-Genomic Sequences), the corresponding physical region for this locus is located on chromosome 2, 3,146,861-4,134,217 bp. Based on the nucleotide sequence differences between 9311 and Nipponbare genomes in the NCBI database (http: / / www.ncbi.nlm.nih.gov / ), specifically the nucleotide sequence differences between SEQ ID No. 1 (nucleotides 250-261), a sequence design was performed using Primer 6.0 software. qPLAR2 Three closely linked pairs of molecular markers, InDel markers 9516-STS1 ~ 9516-STS3.

[0020] The polymorphism of these markers between 9311 and Nipponbare was further analyzed. DNA was first extracted from young leaves of 9311 and Nipponbare using the CTAB method. Then, the target fragment was amplified using a 20 μL PCR reaction system. The reaction system consisted of: 1.0 μL template DNA, 1 μL each of primers (pre- and post-primer), 8 μL working solution, and 9 μL double-distilled water. The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 40 s, followed by annealing at a suitable temperature (50–58°C) for 40 s, extension at 72°C for 40 s, for 32 cycles; after the cycles, a final extension at 72°C for 10 min, and finally incubation at 18°C. The amplified products were then detected by electrophoresis on a 3% agarose gel. The results showed that the molecular marker 9516-STS1 exhibited the best polymorphism between 9311 and Nipponbare. When amplifying variety 9311 using this molecular marker, the target fragment size was 175 bp; when amplifying variety Nipponbare, the target fragment size was 186 bp. Figure 3 ). Can be used as qPLAR2The closely linked markers are SEQ ID No. 2 and SEQ ID No. 3. Sequences SEQ ID No. 2 and SEQ ID No. 3 are single-stranded DNA at positions 140-160 and 306-325 of SEQ ID No. 1.

[0021] The application characteristics of the above-mentioned markers are: rice to be tested or candidate rice. qPLAR2 The locus genotype is homozygous 9311 genotype Hom 9311 At that time, the rice material to be tested was coarse-stalked; qPLAR2 The genotype at this locus is homozygous Nipponbare type Hom. NP At that time, the rice material being tested was normal; however, this locus was a heterozygous Het site. 9311 / NP At that time, and qPLAR2 The genotype at the locus is Homo NP There were no significant differences in stem strength among the tested rice varieties of different genotypes.

[0022] Example 3: Stem Thickness Gene qPLAR2 Application of linked molecular marker 9516-STS1 in marker-assisted selection of rice plants with thick stems and strong stalks To test the present invention qPLAR2 The practicality of loci and linkage markers was demonstrated by utilizing the stem-thickness line N133 (stem thickness 3.78 ± 0.28 mm) from the substitution line population constructed in Example 1, which carried an introduced fragment containing... qPLAR2 ( Figure 4 The plants were crossed with the recipient parent, Nipponbare, to obtain the F1 population. Self-pollination of the F1 population produced the F2 segregating population, totaling 168 plants. The genotypes of the segregating population were detected using the linkage molecular marker 9516-STS1, and the stem thickness of the corresponding individual plants was measured (Table 1). The marker detection and stem thickness measurement methods were as described in Examples 1 and 2. Consistency analysis was performed on the stem thickness phenotypic data and the corresponding genotype data. The results showed that... qPLAR2 The genotype at the locus is Hom 9311 Of the 37 individual plants selected, all 37 exhibited thick stems, resulting in a 100% selection efficiency for thick-stemmed plants. These results further confirm that... qPLAR2 The results confirm the authenticity of the gene and demonstrate its high practicality in screening for thick-stemmed rice plants. Furthermore, the results show that using the molecular marker 9516-STS1 to screen for thick-stemmed individual plants is highly efficient and yields stable results.

[0023] Table 1. Stem diameter phenotype and genotype of the N133 / Nipponbare F2 population

[0024] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0025] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0026] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. A QTL for controlling rice stem diameter qPLAR2 Closely linked molecular markers, characterized by, QTL qPLAR2 Located within the 3,146,861-4,134,217 bp region of chromosome 2, the molecular marker is an InDel marker designed based on the nucleotide sequence difference between nucleotides 250-261 of SEQ ID No.

1. This marker is used when the genotype is homozygous (9311 genotype Homo). 9311 At that time, the rice or candidate material was coarse-stalked.

2. A primer for detecting the molecular marker of claim 1, characterized in that, Includes the primers shown in SEQ ID No. 2 and SEQ ID No.

3.

3. The use of the primers of claim 2 in detecting the molecular markers of claim 1.

4. PCR reagents and kits containing the primers described in claim 2.

5. The use of the PCR reagent or kit according to claim 4 in detecting the molecular marker according to claim 1.

6. The use of the molecular marker of claim 1 in any of the following: S1. Application in identifying or assisting in the identification of rice stem thickness; S2. Application in the preparation and identification or auxiliary preparation and identification of rice products with thick and strong stems; S3. Application in rice-assisted breeding or preparation of rice-assisted breeding products.

Images