Specific primer for white azalea variety identification and application thereof

Abstract

The invention discloses specific primers for identifying varieties of white azalea and application of the specific primers. Sequences of the specific primers are shown as SEQ ID NO.1 and SEQ ID NO.2 respectively. When the specific primer is used, firstly, DNA of a white rhododendron sample to be detected is extracted to serve as a template, then the specific primer serves as a PCR primer for PCR amplification, an amplification product is subjected to electrophoresis detection, a strip is compared, and if a strip exists at 1800 bp, it can be indicated that the sample to be detected is a white butterfly variety. The obtained PCR primer has high specificity and stability, can accurately identify the white butterfly variety from other white rhododendron varieties, has repeatability, can quickly obtain an identification result only through PCR amplification and electrophoretic analysis, and improves the identification efficiency.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a specific primer for the identification of white rhododendron varieties and its application. Background Technology

[0002] Rhododendron (Rhododendron simsii Planch.) is a world-renowned ornamental flower with extremely high horticultural and economic value. White rhododendrons, in particular, are highly sought after in the horticultural market due to their flower color and unique ornamental characteristics. However, the morphological differences between white rhododendron varieties are relatively small, and traditional identification methods mainly rely on morphological characteristics such as flower shape, number of petals, and leaf shape. These characteristics often show a high degree of similarity among white rhododendron varieties, lacking the important distinguishing factor of flower color, which poses a significant challenge to traditional morphological identification methods in differentiating white rhododendron varieties. Furthermore, in the seedling stage of white rhododendrons, the morphological differences between varieties are also very small, making accurate differentiation by visual observation difficult, which brings great challenges to the early identification and selection of varieties.

[0003] In the field of molecular marker technology, traditional molecular markers such as simple sequence repeats (SSRs) and random amplified polymorphic DNA (RAPDs) have been widely used in plant variety identification. However, these markers have certain limitations in the identification of white azalea varieties. Although SSR markers have high polymorphism, their development cost is high, and there may be a lack of sufficient polymorphic sites among white azalea varieties, making it difficult to distinguish highly similar cultivars. Although RAPD markers are simple to operate, their repeatability and stability are poor, and they are easily affected by experimental conditions, leading to reduced reliability of identification results.

[0004] Therefore, there is an urgent need to develop a method for identifying white rhododendrons that is based on molecular biology principles and has high variety specificity. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies by providing a specific primer for the identification of white rhododendron varieties and its application, which can distinguish the 'White Butterfly' variety from other white rhododendron varieties (such as 'White Screen', 'Danxiuyu', 'Water Mountain and River', 'Flower and Moon', 'Silver-edged Peony', 'Four Seas Waves', 'Daiyu', or 'Xiao Qiao').

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides a specific primer for the identification of white rhododendron varieties, the primer sequence of which is as follows:

[0008] B4S3(2)6F: CCTACTATAGATTGCCGAAAGGAC (SEQ ID NO.1)

[0009] B4S3(2)6R: ACAACTGGTTCCAGAGTAGACTGC (SEQ ID NO. 2).

[0010] Secondly, the present invention provides a method for identifying white rhododendron varieties using the aforementioned specific primers, the method comprising the following steps:

[0011] DNA was extracted from the white azalea flower sample to be tested and used as a template. PCR amplification was performed using the specific primers mentioned above, and the amplification products were detected.

[0012] Furthermore, the PCR amplification system is as follows:

[0013] The reaction system had a volume of 20 µL, including 8 µL of ddH2O, 1 µL of DNA template extracted from the white rhododendron sample to be tested, 1 µL of specific primers, and 10 µL of 2×EasyTaqPCR SuperMix; the concentration of the DNA template was 100 ng / µL, and the concentration of the specific primers was 10 µM.

[0014] Furthermore, the PCR amplification procedure is as follows:

[0015] Pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 s, annealing at 56 ℃ for 30 s, extension at 72 ℃ for 1 min, for a total of 35 cycles; final extension at 72 ℃ for 7 min.

[0016] Further, the detection specifically involves: taking 20 µL of the PCR product obtained in the amplification step and performing electrophoresis on a 1.5% agarose gel; wherein:

[0017] If a specific band is present at 1800 bp, it indicates that the variety of the rhododendron sample being tested is 'White Butterfly'; if no band is present, it indicates that the variety of the rhododendron sample being tested is not 'White Butterfly'.

[0018] Thirdly, the present invention provides a kit for identifying white rhododendron varieties, which includes the aforementioned specific primers.

[0019] Fourthly, the present invention provides the use of the above-mentioned specific primers in the preparation of a kit for identifying white rhododendron varieties.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0021] 1. The PCR primers designed in this invention have strong specificity and can accurately identify the 'White Butterfly' variety from other white azalea varieties, significantly improving the accuracy of identification and overcoming the shortcomings of traditional morphological identification methods that make it difficult to distinguish between white azalea varieties.

[0022] 2. The PCR-specific primers of the present invention have high stability and reproducibility, and can obtain consistent identification results in different samples.

[0023] 3. This invention can quickly obtain identification results through PCR amplification and electrophoresis analysis, which greatly simplifies the identification process and improves identification efficiency. Moreover, this method is not limited by the plant growth stage. Whether it is a rhododendron seedling in the growth and development stage or a mature plant, identification can be carried out by collecting its leaves, which provides strong support for the early screening and identification of varieties. Attached Figure Description

[0024] Figure 1 The images show the nine rhododendron varieties used in Embodiment 2 of the present invention.

[0025] Figure 2 This is an image showing the electrophoresis results of Embodiment 2 of the present invention.

[0026] Figure 3 This is an image showing the electrophoresis results of Example 3 of the present invention. Detailed Implementation

[0027] The present application will now be described in further detail with reference to the accompanying drawings and specific embodiments.

[0028] It should be noted that the technical features involved in the various embodiments of this application described below can be combined with each other as long as they do not conflict with each other. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain this application, and should not be construed as limiting this application.

[0029] The white peony varieties used in the embodiments of this invention are all freely available on the market. Specifically, the white peony varieties involved in this invention include 'White Butterfly', 'White Screen', 'Danxiu Jade', 'Water and Mountains', 'Flowers Bloom and Moon is Full', 'Silver-edged Peony', 'Four Seas Waves', 'Daiyu', and 'Xiao Qiao', all of which are white peony varieties available in the Zhejiang market. Those skilled in the art can obtain the above varieties from flower markets or relevant flower suppliers in Zhejiang based on these names, and operate according to the methods and conditions described in the embodiments to achieve the technical solution of this invention.

[0030] Example 1: Primer Design

[0031] To obtain a molecular marker that shows a positive signal only for 'White Butterfly' rhododendron, conventional PCR amplification technology was used. DNA fingerprinting analysis was employed to screen for 'White Butterfly' specific nucleotide sequences. These sequences were then recovered via gel extraction, cloned, and sequenced (sent to Shanghai Huajin Biotechnology Co., Ltd. for sequencing). Based on this DNA sequence, 'White Butterfly' specific primers B4S3(2)-6F / R were designed. The primer sequences are as follows:

[0032] B4S3(2)6F: CCTACTATAGATTGCCGAAAGGAC (SEQ ID NO.1)

[0033] B4S3(2)6R:ACAACTGGTTCCAGAGTAGACTGC (SEQ ID NO.2)

[0034] The primer sequences were synthesized by Shanghai Huajin Biotechnology Co., Ltd.

[0035] Example 2: Specificity Test

[0036] (1) Genomic DNA extraction: Various white azalea seedlings were used as azalea plant samples to be tested. Fresh leaves of the azalea plant samples to be tested were taken, ground into powder with liquid nitrogen, and then the genomic DNA of the samples to be tested was extracted using a polysaccharide and polyphenol plant genomic DNA extraction kit (ordered from Tiangen Biotech (Beijing) Co., Ltd.).

[0037] As shown in Table 1, the rhododendron plant samples to be tested included 9 varieties:

[0038] Table 1 Sample Information Table

[0039] Sample number name Sample number name 1 White screen 6 Silver-edged peony 2 Danxiuyu 7 Waves of the Four Seas 3 Water and Mountains 8 Daiyu 4 White butterfly 9 Xiao Qiao 5 Auspicious flowers and a full moon

[0040] Depend on Figure 1 It is evident that the appearances of the various varieties are very similar, making identification impossible through traditional morphological characteristics.

[0041] (2) PCR amplification: Using the DNA extracted in step (1) as a template, and the molecularly specific marker primer B4S3(2)-6F / R as the amplification primer, PCR amplification was performed:

[0042] The PCR reaction system used was as follows: 1 μL of 10 μM primers, 10 μL of 2×EasyTaqPCRSuperMix, 1 μL of 100 ng / μL template DNA, and 8 μL of ddH2O, for a total volume of 20 μL. The 2×EasyTaqPCRSuperMix was ordered from Beijing TransGen Biotech Co., Ltd.

[0043] The PCR reaction program used was as follows: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 56 °C annealing for 30 s, 72 °C extension for 1 min, for a total of 35 cycles; and finally, 72 °C extension for 7 min.

[0044] (3) Electrophoresis detection: Take 20 μL of the PCR product obtained in step (2) and perform electrophoresis detection with 1.5% agarose gel. Then, use a gel imaging system (Tanon 3500Gel Image System + Tanon MP software) to take pictures and detect the DNA Marker. 5 μL of DNA Marker is applied.

[0045] The results are as follows Figure 2 As shown, M is the DNA molecular weight standard 2000 DNA Marker (ordered from Hangzhou Kaitai Biotechnology Co., Ltd.); channels 1-9 correspond to samples 'Bai Pingfu', 'Dan Xiuyu', 'Shui Zhi Shan Chuan', 'Bai Hudie', 'Hua Hao Yue Yuan', 'Yin Bian Hua Mu Dan', 'Si Hai Bo', 'Dai Yu', and 'Xiao Qiao', respectively. Only 'Bai Hudie' can amplify a specific band, which is located at 1800 bp.

[0046] Example 3: Stability Test

[0047] To further verify the stability and application range of the primer combination B4S3(2)-6F / R developed in this invention, PCR amplification and detection were performed on DNA samples from 12 different mature 'White Butterfly' plants using primer B4S3(2)-6F / R. The specific steps were the same as in Example 2.

[0048] The electrophoresis image after amplification is as follows Figure 3 As shown, M is the DNA molecular weight standard 2000 DNA Marker; channels 1-12 correspond to 12 different individual strains of 'White Butterfly'. Figure 3 This demonstrates that all mature 'White Butterfly' plant samples in this embodiment can amplify a specific band of 1800bp. Therefore, the specific marker primer B4S3(2)-6 F / R of this invention has good stability and applicability.

[0049] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A specific primer for identifying white rhododendron varieties, characterized in that, The primer sequences are as follows: B4S3(2)6F:CCTACTATAGATTGCCGAAAGGAC B4S3(2)6R:ACAACTGGTTCCAGAGTAGACTGC.

2. A method for identifying varieties of white rhododendrons, characterized in that, The method includes the following steps: DNA was extracted from the white azalea sample to be tested and used as a template for PCR amplification using the specific primers as described in claim 1. The amplification products were then detected.

3. The method according to claim 2, characterized in that, The PCR amplification system is as follows: The reaction system had a volume of 20 µL, including 8 µL of ddH2O, 1 µL of DNA template extracted from the white rhododendron sample to be tested, 1 µL of specific primers, and 10 µL of 2×EasyTaqPCR SuperMix; the concentration of the DNA template was 100 ng / µL, and the concentration of the specific primers was 10 µM.

4. The method according to claim 2, characterized in that, The procedure for PCR amplification is as follows: Pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 s, annealing at 56 ℃ for 30 s, extension at 72 ℃ for 1 min, for a total of 35 cycles; finally, extension at 72 ℃ for 7 min.

5. The method according to claim 2, characterized in that, The amplification products were detected by gel electrophoresis; among which: If a specific band is found at 1800 bp, the rhododendron sample being tested is of the 'White Butterfly' variety; if no band is found, the rhododendron sample being tested is not of the 'White Butterfly' variety.

6. A kit for identifying white rhododendron varieties, comprising the specific primers as described in claim 1.

7. The use of the specific primers as described in claim 1 in the preparation of a kit for identifying white rhododendron varieties.

Images