InDel molecular markers and applications of the rice grain shape gene BG2 promoter

By developing the InDel molecular marker for the BG2 promoter of rice grain shape gene, and using PCR amplification and electrophoresis detection, the problem of accurately selecting high-quality and high-yield rice varieties in existing technologies has been solved, and rapid and efficient grain shape identification and breeding selection have been achieved.

CN120924717BActive Publication Date: 2026-03-06JIANGXI AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-14
Publication Date
2026-03-06

AI Technical Summary

Technical Problem

In existing technologies, there are few clones of rice grain shape genes, making it difficult to accurately breed high-quality and high-yield rice varieties with different grain shapes. Furthermore, existing molecular markers are not suitable for quickly and efficiently identifying allelic variations of grain shape genes.

Method used

InDel molecular markers for the promoter of rice grain shape gene BG2 were developed. PCR amplification was performed using primer pairs BG2_pro-InDel-F and BG2_pro-InDel-R. The length of the amplified products was detected by agarose gel electrophoresis to determine the grain shape type of rice germplasm materials.

Benefits of technology

It enables rapid, efficient, and accurate identification of rice germplasm material grain shape, reduces breeding costs, provides a theoretical basis for breeding selection, and can identify long, wide, and high length-to-width ratio slender grains or short, wide, and low length-to-width ratio short round grains of rice germplasm materials.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120924717B_ABST
    Figure CN120924717B_ABST
Patent Text Reader

Abstract

This application belongs to the field of marker-assisted breeding technology for rice, specifically relating to an InDel molecular marker for the promoter of the rice grain shape gene BG2 and its application. The nucleotide sequence of this InDel molecular marker is shown in SEQ ID No. 1, corresponding to the type BG2_pro promoter of the rice grain shape gene; the nucleotide sequence of the InDel molecular marker corresponding to its allelic promoter type BG2_PRO is shown in SEQ ID No. 2. The molecular marker provided by this invention can distinguish the nucleotide sequence type of the BG2 gene promoter in rice germplasm materials at the seedling stage, enabling rapid, efficient, and accurate identification and screening of target gene-related sequences in rice germplasm resources and their bred offspring. This provides a theoretical basis for cultivating high-yielding and high-quality rice varieties with long or short grains, narrow or wide grains, and slender or short round grain shapes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of molecular marker-assisted breeding technology for rice, specifically involving an InDel molecular marker for the promoter of the rice grain shape gene BG2 and its application. Background Technology

[0002] Grain shape is a key indicator of rice quality and appearance, and a crucial factor determining rice yield. The cultivation of long, slender-grained and short, round-grained rice varieties has regional characteristics in my country, and each of these two grain shapes appeals to different consumer groups. How to accurately breed high-quality, high-yield rice varieties with different grain shapes is a problem that breeders need to solve. Discovering allelic variations related to grain shape control genes and using them for predicting rice grain shape can advance the process of rice molecular breeding and is of great significance.

[0003] Rice grain shape involves grain length, grain width, length-to-width ratio, and grain weight, and is regulated by multiple quantitative trait loci (QTLs) or genes. To date, a large number of QTLs or genes related to grain shape have been reported, but the vast majority have only been located in specific rice germplasm materials. Cloned grain shape genes are few, and the allelic variations associated with these cloned grain shape genes have been even fewer discovered in different rice germplasm materials. By using conventional rice varieties with different grain shapes and performing sequencing analysis on the gene regions and promoter regions of cloned grain shape genes, and by mining novel allelic variations of these grain shape genes, important genetic resources can be provided for breeding high-quality, high-yield rice varieties with different grain shape requirements. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of existing technologies and provide an InDel molecular marker for the rice grain shape gene BG2 promoter and its application, specifically employing the following technical solution:

[0005] In a first aspect, the present invention provides an InDel molecular marker for the promoter of the rice grain shape gene BG2, the nucleotide sequence of which is shown in SEQ ID No. 1, and the type of the rice grain shape gene BG2 promoter is BG2_pro; the nucleotide sequence of which is shown in SEQ ID No. 2 is the nucleotide sequence of the InDel molecular marker corresponding to the allelic promoter type BG2_PRO.

[0006] The InDel molecular marker (BG2_pro-InDel) described in this invention represents an allelic variant BG2_pro in the promoter region of the rice grain shape gene BG2. This allelic variant BG2_pro is closely linked to long-grain, narrow-grain, and high aspect ratio slender grain shapes in rice, while its allelic variant BG2_PRO is closely linked to short-grain, wide-grain, and low aspect ratio short round grain shapes in rice. This InDel molecular marker (BG2_pro-InDel) can be used to identify whether rice germplasm materials contain a BG2_pro type promoter or a BG2_PRO type promoter, thereby enabling rapid, efficient, and accurate breeding of rice germplasm materials with target phenotypic traits such as long-grain, narrow-grain, high aspect ratio slender grain shapes or short-grain, wide-grain, and low aspect ratio short round grain shapes.

[0007] The nucleotide sequence of the InDel molecular marker of the BG2_pro promoter type mentioned above is shown in SEQ ID NO.1: TAAGTTAGATTGAACGGCATGGAATTGAAATGTTGTTCTCTTAATTTTATTTTACACTATCACACCATTACAAATTCCAAACTCTTGTTCTAAACAGGCACCATCCTTTTCAGTTACATCTACACTAATTTCAATAGTAATGCCATTATTATGTAGTCCTATATTTAAGGAAGAAACTAATGACCCTTTGATTACGCTATCATTACTGACAATGACATGTGGGGCCAGAGTGTCAGATAATTGGAGGTCCAAATTTTTGGAGTGGCAAAATGGTCTATTTAAAGCACCAGGTGTTTATTAGCTTCTCTCCACGTCTTCTTCCTCCCAAGAAAACTCCTCTCACT. The nucleotide sequence of its allele BG2_PRO is shown in SEQ ID NO.1. As shown in ID NO.2: TAAGTTAGATTGAACGGCATGGAATTGAAATGTTGTTCTCTTAATTTTATTTTACACTATCACACCATTACAAATTCCAAACTCTTGTTCTAAACAGGCACCATCTTTTTCAGTTACATCTACACTAATTTCAATAGTAATGCCATTATTATGTAGTCCTATATTTAAGGAAGAAACTAATGATATATACGCAGATATTGTTAATAATGACCCTTTGATTACGCTATCATTACTGACAATGACATGTGGGGCTAGAGTGTCAGATAATTGGAGGTCCAAATTTTTGGAGTGGCAAAATGGTCTATTTAAAGCACCAGGTGTTTATTAGCTTCTCTCCACGTCTTCTTCCTCCCAAGAAAACTCCTCTCACT; The nucleotide sequence of the InDel molecular marker of the BG2_pro promoter type provided by this invention has a deletion of the TAATGATATATACGCAGATATTGTTAA sequence.

[0008] Secondly, the present invention provides a primer pair for detecting the above-mentioned InDel molecular marker, the primer pair comprising BG2_pro-InDel-F and BG2_pro-InDel-R; the nucleotide sequences of BG2_pro-InDel-F and BG2_pro-InDel-R are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0009] SEQ ID NO.3: TAAGTTAGATTGAACGGCATGG;

[0010] SEQ ID NO. 4: AGTGAGAGGAGTTTTCTTGGGA.

[0011] Thirdly, the present invention provides a kit for detecting rice grain shape, the kit comprising the primer pairs described above.

[0012] As a further preferred embodiment, the kit also includes Taq DNA polymerase, 10×Taq buffer containing 20 mM MgCl2, dNTPs, and water.

[0013] Fourthly, the present invention provides a method for detecting rice grain shape, comprising the following steps:

[0014] Genomic DNA was extracted from the rice germplasm materials to be tested;

[0015] Using the genomic DNA of the rice germplasm material to be tested as a template, PCR amplification was performed using the primer pairs or the kits described above.

[0016] The amplification products were detected by agarose gel electrophoresis, and the grain shape of the rice germplasm material to be tested was determined based on the length of the amplification products.

[0017] As a further preferred embodiment, when the length of the amplification product is 344 bp, the promoter type of the grain shape gene BG2 in the rice germplasm material to be tested is BG2_pro, and the grain shape is characterized by long grains (average grain length ≥ 8.60 mm), narrow grains (average grain width ≤ 2.66 mm), and slender grains with high length-to-width ratio (average length-to-width ratio ≥ 3.54 mm).

[0018] When the length of the amplification product is 371 bp, the promoter type of the grain shape gene BG2 in the rice germplasm material to be tested is BG2_PRO, and the grain shape is short grain (average grain length ≤ 8.14 mm), wide grain (average grain width ≥ 2.85 mm), and short round grain with low length-to-width ratio (average length-to-width ratio ≤ 2.70 mm).

[0019] When the amplification product is a heterozygous type with both 344 bp and 371 bp present, the BG2 promoter type of the grain shape gene in the rice germplasm material to be tested is BG2_pro / BG2_PRO, and the grain shape is between long and short grains, wide and narrow grains, slender grains with high length-to-width ratio and short round grains with low length-to-width ratio.

[0020] As a further preferred embodiment, the rice germplasm materials to be tested are representative rice varieties from different sources, different ecological types, and different indica and japonica subspecies, including IR64, Nipponbare, Jinggang Ruanzhan, Yue Nong Simiao, Efeng Simiao, Meitezhan, Huahang 38, Suiyangzhan, Huangguangyouzhan, Wuyunjing 24, Longjing 25, Longjing 52, Aizizhan, Kendao 19, Jijing 88, and Longdun 1. 03. At least one of the following: Yuejinongzhan, Fudao 88, Yuebiao 5, Huangguangtaizhan, Mudanjiang 26, Longjing 57, Yulong 7, Shenfan 24, Tianfeng B, Nongxiang 39, Huangxianzhan, Yuehesimiao, Kendao 20, Jijing 515, Ganningjing 3, Suijing 4, Xiangyaxiangzhan, R9822, Nanguizhan, Wushansimiao, Xiushui 134, Longdao 24, Kendao 14, Zhonghua 11.

[0021] As a further preferred embodiment, the PCR amplification reaction system comprises: 5 μL of 10×Taq buffer containing 20 mM MgCl2, 2 μL of 10 mM dNTPs, 0.5 μL of 10 μM forward primer BG2_pro-InDel-F, 0.5 μL of 10 μM reverse primer BG2_pro-InDel-R, 0.25 μL of 5 U / μL Taq DNA polymerase, 1 μL of 10 pg – 1 μg DNA, and water to a total volume of 30 μL.

[0022] As a further preferred embodiment, the PCR amplification reaction program is as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 30 s, 38 cycles, and 72℃ extension for 5 min.

[0023] Fifthly, the present invention provides the application of the InDel molecular marker of the rice grain shape gene BG2 promoter, or the primer pair or the kit described above, in detecting the grain shape of rice germplasm materials.

[0024] In a sixth aspect, the present invention provides the application of the InDel molecular marker of the above-mentioned rice grain shape gene BG2 promoter, or the above-mentioned primer pair, or the above-mentioned kit, or the above-mentioned method in molecular marker-assisted breeding to improve rice grain shape.

[0025] The beneficial effects of this invention are as follows:

[0026] (1) This invention provides an InDel molecular marker for the promoter of rice grain shape gene BG2. By detecting the size of the amplified band of this molecular marker, it is possible to determine whether the material to be tested contains the allelic variant BG2_pro or BG2_PRO of the promoter region of the BG2 gene. This enables the prediction of grain shape of rice germplasm materials at the gene level or the improvement of rice grain shape through molecular marker-assisted breeding. It can be used to identify or screen rice germplasm materials with long grain, wide grain, and high length-width ratio slender grain phenotype, or short grain, wide grain, and low length-width ratio short round grain phenotype.

[0027] (2) The molecular markers described in this invention can identify and distinguish the nucleotide sequence type of the BG2 gene promoter in rice germplasm materials during the seedling stage. They can quickly, efficiently and accurately identify and screen the target gene-related sequences in rice germplasm resources and their breeding offspring, greatly reducing breeding costs and being unaffected by external factors. This provides a theoretical basis for cultivating high-yield and high-quality rice varieties with long grains, wide grains, and high length-to-width ratio, or short grains with short grains, wide grains, and low length-to-width ratio. Attached Figure Description

[0028] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0029] Figure 1 The figures show the amplification product sizes of the InDel molecular marker of the BG2 gene promoter in different grain shapes of rice germplasm materials; where M is the marker, indicating the 300 bp and 400 bp positions; numbers 1-16 represent: 1, IR64; 2, Nipponbare; 3, Jinggang Ruanzhan; 4, Yue Nong Simiao; 5, Efeng Simiao; 6, Meitezhan; 7, Huahang 38; 8, Suiyangzhan; 9, Huangguangyouzhan; 10, Wuyunjing 24; 11, Longjing 25; 12, Longjing 52; 13, Aizizhan; 14, Kendao 19; 15, Jijing 88; 16, Longdun 103.

[0030] Figure 2The image shows the presence of BG2_pro and BG2_PRO allelic variations in 24 rice germplasm materials identified using the InDel molecular marker of the BG2 gene promoter. M represents the marker at 300 bp and 400 bp positions. Numbers 1-24 represent: 1. Yuejin Nongzhan; 2. Fudao 88; 3. Yuebiao 5; 4. Huangguangtaizhan; 5. Mudanjiang 26; 6. Longjing 57; 7. Yulong 7; 8. Shenfan 24. 9. Tianfeng B; 10. Nongxiang 39; 11. Huangxianzhan; 12. Yuehe Simiao; 13. Kendao 20; 14. Jijing 515; 15. Ganningjing 3; 16. Suijing 4; 17. Xiangyaxiangzhan; 18. R9822; 19. Nanguizhan; 20. Wushan Simiao; 21. Xiushui 134; 22. Longdao 24; 23. Kendao 14; 24. Zhonghua 11.

[0031] Figure 3 The image shows the identification of BG2_pro / BG2_PRO allelic variations in heterozygous F1 rice materials using the InDel molecular marker of the BG2 gene promoter; where M is a marker indicating the 300 bp and 400 bp positions; numbers 1 to 3 represent: 1, Huang Guangtaizhan; 2, Xiushui 134; 3, the F1 generation of the hybrid of Xiushui 134 / Huang Guangtaizhan. Detailed Implementation

[0032] The technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. Based on the embodiments of this application, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.

[0033] Example 1

[0034] Development and validation of the InDel molecular marker BG2_pro-InDel for the promoter of rice grain shape gene BG2.

[0035] (1) Discovery of sequence variation sites in the promoter region of rice grain shape gene BG2 and design of molecular marker BG2_pro-InDel

[0036] BG2 is a gene cloned on rice chromosome 7 that is related to grain shape, yield, embryo, and endosperm development, with the gene number LOC_Os07g41240. Compared with the wild type, the BG2 gene mutant bg2-D shows increased BG2 gene expression due to T-DNA insertion, resulting in increased grain length, width, and weight. Overexpression experiments also confirmed that increased gene expression leads to increased grain length, width, and weight (XU et al., 2015, Variations in CYP78A13 coding region influence grain size and yield in rice, Plant Cell and Environment, 2015, 38(4):800-811. doi: 10.1111 / pce.12452.). Based on this, we speculate that the promoter region of the BG2 gene in natural rice germplasm materials may contain sequences that regulate the differences in the transcriptional expression level of this gene to regulate rice grain shape traits. The promoter region of the BG2 gene in the high aspect ratio, slender grain variety IR64 was sequenced and compared with the corresponding genome sequence of the low aspect ratio, short, round grain variety Nipponbare, which has already undergone genome sequencing. A deletion of the sequence TAATGATATATACGCAGATATTGTTAA (SEQ ID NO. 5) was found in the promoter region of the BG2 gene in IR64. Based on this sequence variation, the InDel molecular marker BG2_pro-InDel for the BG2 promoter of the grain shape gene described in this invention was designed using Primer Premier 5 software. The primer sequences are shown in Table 1. The product sizes in IR64 and Nipponbare were 344 bp and 371 bp, respectively.

[0037] Table 1. Primer sequences of the InDel molecular marker BG2_pro-InDel for the promoter of the granular gene BG2.

[0038]

[0039] (2) The relationship between the molecular marker BG2_pro-InDel and the phenotypes of long / short grain, narrow / wide grain, and high length-to-width ratio slender grain / low length-to-width ratio short round grain was verified using 16 rice germplasm materials with different grain shapes.

[0040] Sixteen rice germplasm materials with different grain shapes, including IR64, Nipponbare, Jinggang Soft Sticky Rice, Yue Nong Simiao, E Feng Simiao, Meitezhan, Huahang 38, Suiyang Sticky Rice, Huangguang Youzhan, Wuyunjing 24, Longjing 25, Longjing 52, Aizizhan, Kendao 19, Jijing 88, and Longdun 103, were analyzed for grain shape traits such as grain length, grain width, length-width ratio, and thousand-grain weight. Significant differences were found in grain length, grain width, and length-width ratio among them. R64, Jinggang Soft Sticky Rice, Yue Nong Simiao, E Feng Simiao, Meitezhan, Huahang 38, Suiyang Sticky Rice, and Huang Guangyouzhan have relatively long grains, narrow grains, and a large length-to-width ratio, exhibiting long grains, narrow grains, and a slender grain shape with a high length-to-width ratio. On the other hand, Nihonbashi, Wuyunjing 24, Longjing 25, Longjing 52, Aizizhan, Kendao 19, Jijing 88, and Longdun 103 have relatively short grains, wide grains, and a small length-to-width ratio, exhibiting short grains, wide grains, and a short round grain shape with a low length-to-width ratio (Table 2).

[0041] Leaves were taken from these 16 rice germplasm materials, and leaf DNA was extracted using the CTAB method. Using the extracted DNA as a template, PCR amplification was performed using forward and reverse primers of the InDel molecular marker BG2_pro-InDel.

[0042] The PCR reaction system consisted of: 5 μL of 10×Taq buffer containing 20 mM MgCl2, 2 μL of dNTPs (10 mM), 0.5 μL of 10 μM forward primer BG2_pro-InDel-F, 0.5 μL of 10 μM reverse primer BG2_pro-InDel-R, 0.25 μL of 5 U / μL Taq DNA polymerase, 1 μL of DNA (10 pg – 1 μg), and double-distilled water to a total volume of 30 μL.

[0043] The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 30 s, 38 cycles, and 72℃ extension for 5 min.

[0044] The PCR products obtained by amplifying the above 16 rice germplasm materials using the molecular marker BG2_pro-InDel were detected by 3% (g / 100 ml, m / v) agarose gel electrophoresis.

[0045] Electrophoresis results as follows Figure 1As shown, the PCR banding of long-grained, narrow-grained, and high length-to-width ratio slender-grained varieties such as IR64, Jinggang Ruanzhan, Yue Nong Simiao, E Feng Simiao, Meitezhan, Huahang 38, Suiyangzhan, and Huangguangyouzhan is about 344 bp, while the PCR banding of short-grained, wide-grained, and low length-to-width ratio short-rounded varieties such as Nihonbashi, Wuyunjing 24, Longjing 25, Longjing 52, Aizizhan, Kendao 19, Jijing 88, and Longdun 103 is about 371 bp.

[0046] The BG2 gene promoter allele with a 344 bp electrophoretic band and a deletion of the TAATGATATATACGCAGATATTGTTAA sequence was named BG2_pro; the BG2 gene promoter allele with a 371 bp electrophoretic band and an insertion of the TAATGATATACGCAGATATTGTTAA sequence was named BG2_PRO. Rice germplasm materials with the BG2 gene promoter allele of BG2_pro, such as IR64, Jinggang Ruanzhan, Yue Nong Simiao, E Feng Simiao, Meitezhan, Huahang 38, Suiyangzhan, and Huangguangyouzhan, exhibit long, narrow, and high length-to-width ratio slender grain shapes. Conversely, rice germplasm materials with the BG2 gene promoter allele of BG2_PRO, such as Nihonbare, Wuyunjing 24, Longjing 25, Longjing 52, Aizizhan, Kendao 19, Jijing 88, and Longdun 103, exhibit short, wide, and low length-to-width ratio short round grain shapes (Table 2). The BG2_pro allele variation of the BG2 gene promoter identified in this invention results in rice grains that are long, narrow, and high length-to-width ratio slender grain shapes, while the BG2_PRO allele results in rice grains that are short, wide, and low length-to-width ratio short round grain shapes.

[0047] Table 2. Grain shape analysis and BG2 promoter allelic identification results of 16 rice germplasm materials

[0048]

[0049] Note: Data represent the mean ± standard deviation of at least 35 mature seeds for each rice germplasm material.

[0050] Example 2

[0051] The InDel molecular marker BG2_pro-InDel of the rice grain shape gene BG2 promoter was used to identify whether rice germplasm materials contained BG2_pro and BG2_PRO allelic variations.

[0052] Taking 24 rice germplasm materials, including Yuejin Nongnan, Fudao 88, Yuebiao 5, Huangguangtai, Mudanjiang 26, Longjing 57, Yulong 7, Shenfan 24, Tianfeng B, Nongxiang 39, Huangxianzhan, Yuehesimiao, Kendao 20, Jijing 515, Ganningjing 3, Suijing 4, Xiangyaxiangzhan, R9822, Nanguizhan, Wushansimiao, Xiushui 134, Longdao 24, Kendao 14, and Zhonghua 11, as examples, we identified whether they contained BG2_pro and BG2_PRO allelic variations. The specific steps are as follows:

[0053] (1) Extraction of DNA from materials: Leaf samples were taken from 24 rice germplasm materials during the seedling stage, and DNA was extracted from the leaves using the CTAB method;

[0054] (2) Amplify the molecular marker BG2_pro-InDel related fragments using the standard PCR amplification system: Using molecular marker primers BG2_pro-InDel-F and BG2_pro-InDel-R, PCR amplification was performed using the rice DNA to be detected as a template. The PCR reaction system and procedure were the same as those in step (2) of Example 1.

[0055] (3) Electrophoretic detection and analysis of amplified products: PCR products were detected by 3% (g / 100 ml, m / v) agarose gel electrophoresis. If the molecular marker amplified a 344 bp band, it indicated that the rice germplasm material tested contained a deletion of the TAATGATATATACGCAGATATTGTTAA sequence in the promoter region of the BG2 gene, and the promoter allele was BG2_pro; if the molecular marker amplified a 371 bp band, it indicated that the rice germplasm material tested contained an insertion of the TAATGATATATACGCAGATATTGTTAA sequence in the promoter region of the BG2 gene, and the promoter allele was BG2_PRO; if the molecular marker amplified a 344 bp / 371 bp heterozygous band, it indicated that the gene promoter allele of the material was BG2_pro / BG2_PRO; based on the electrophoresis results ( Figure 2The PCR banding of rice germplasm materials such as Yuejinongzhan, Fudao 88, Yuebiao 5, Huangguangtaizhan, Tianfeng B, Nongxiang 39, Huangxianzhan, Yuehesimiao, Xiangyaxiangzhan, R9822, Nanguizhan, and Wushansimiao was 344 bp, with a deletion of the TAATGATATATACGCAGATATTGTTAA sequence in the BG2 gene promoter region, and the promoter allele was BG2_pro. The PCR banding of rice germplasm materials such as Mudanjiang 26, Longjing 57, Yulong 7, Shenfan 24, Kendao 20, Jijing 515, Ganningjing 3, Suijing 4, Xiushui 134, Longdao 24, Kendao 14, and Zhonghua 11 was 371 bp, with an insertion of the TAATGATATATACGCAGATATTGTTAA sequence in the BG2 gene promoter region, and the promoter allele was BG2_PRO.

[0056] (4) Verification analysis of grain shape of 24 rice germplasm materials: At maturity, the grain length, grain width, length-width ratio, and thousand-grain weight of the mature grains of these 24 rice germplasm materials with different grain shapes were analyzed. The results are shown in Tables 3 and 4. It was found that the rice germplasm materials with the BG2 gene promoter allele of BG2_pro were Yuejin Nongzhan, Fudao 88, Yuebiao 5, Huangguangtaizhan, Tianfeng B, Nongxiang 39, Huangxianzhan, Yuehesimiao, Xiangyaxiangzhan, R9822, Nanguizhan, and Wushansimiao. The grains of rice with the BG2 gene promoter allele are relatively long, narrow, and have a large length-to-width ratio, exhibiting a long, narrow, and slender grain shape. In contrast, rice germplasm materials with the BG2_PRO promoter allele, such as Mudanjiang 26, Longjing 57, Yulong 7, Shenfan 24, Kendao 20, Jijing 515, Ganningjing 3, Suijing 4, Xiushui 134, Longdao 24, Kendao 14, and Zhonghua 11, have shorter, wider, and smaller length-to-width ratio grains, exhibiting a short, wide, and short, round grain shape with a low length-to-width ratio. The InDel molecular marker BG2_pro-InDel of the BG2 promoter in this invention can be used to identify whether rice germplasm materials contain BG2_pro or BG2_PRO allelic variations of the BG2 promoter, thereby predicting the grain shape of rice germplasm materials at the gene level.

[0057] Table 3. Grain shape results of 12 rice germplasm materials containing BG2_pro or BG2_PRO allelic differences.

[0058]

[0059] Table 4. Grain shape results of 12 rice germplasm materials containing BG2_pro or BG2_PRO allelic differences.

[0060]

[0061] Note: Data represent the mean ± standard deviation of at least 35 mature seeds for each rice germplasm material.

[0062] Example 3

[0063] The InDel molecular marker BG2_pro-InDel of the rice grain shape gene BG2 promoter was used to identify whether rice germplasm materials contained BG2_pro / BG2_PRO allelic variant heterozygotes.

[0064] Taking rice germplasm materials such as Huang Guangtai, Xiushui 134, and their first-generation hybrids (Xiushui 134 / Huang Guangtai) as examples, the specific steps for identifying whether they contain BG2_pro or / and BG2_PRO allelic variations are as follows:

[0065] (1) Extraction of DNA from materials: DNA was extracted from the leaves of these three rice germplasm materials during the seedling stage using the CTAB method;

[0066] (2) Amplify the molecular marker BG2_pro-InDel related fragments using the standard PCR amplification system: Using molecular marker primers BG2_pro-InDel-F and BG2_pro-InDel-R, PCR amplification was performed using the rice DNA to be detected as a template. The PCR reaction system and procedure were the same as those in step (2) of Example 1.

[0067] (3) Electrophoretic detection and analysis of amplified products: PCR products were detected by 3% (g / 100 mL, m / v) agarose gel electrophoresis. If the molecular marker could simultaneously amplify 344 and 371 bp heterozygous bands in the first generation of hybrid rice of Xiushui 134 / Huang Guangtai, it indicates that the detected first generation hybrid rice material simultaneously contains the deletion and insertion of the TAATGATATATACGCAGATATTGTTAA sequence in the promoter region of the BG2 gene, and the promoter allele is BG2_pro / BG2_PRO; according to the electrophoresis results ( Figure 3 The first-generation heterozygote of Xiushui 134 / Huang Guangtai can simultaneously generate 344 and 371 bp heterozygous bands, so its promoter allele is BG2_pro / BG2_PRO.

[0068] (4) Grain shape verification analysis: At maturity, the grain length, grain width, length-width ratio, and thousand-grain weight of the mature grains of these three rice germplasm materials with different grain shapes were analyzed. The results are shown in Table 5. It was found that the grain length, grain width, and length-width ratio of the Xiushui 134 / Huang Guangtaizhan hybrid first generation heterozygous germplasm material with the BG2 gene promoter allele of BG2_pro / BG2_PRO were all between those of the two parents, Xiushui 134 and Huang Guangtaizhan. The InDel molecular marker BG2_pro-InDel of the rice grain shape gene BG2 promoter of the present invention can be used to identify whether rice germplasm materials contain BG2_pro / BG2_PRO allele heterozygotes of the grain shape gene BG2 promoter, thereby predicting the grain shape of rice germplasm materials at the gene level.

[0069] Table 5. BG2_pro and / or BG2_PRO allelic information of the first generation hybrid of Xiushui 134 / Huangguangtai and its parents, and grain shape results of these three rice germplasm materials.

[0070]

[0071] Note: Data represent the mean ± standard deviation of at least 35 mature seeds for each rice germplasm material; Xiushui 134 / Huang Guangtaizhan represents the first generation of hybrids with Xiushui 134 as the female parent and Huang Guangtaizhan as the male parent.

[0072] The above results indicate that the InDel molecular marker BG2_pro-InDel of the rice grain shape gene BG2 promoter, along with its detection primers, kits, and methods, are primarily used to identify the presence of TAATGATATATACGCAGATATTGTTAA sequence deletions and insertions in the BG2 promoter region of the rice grain shape gene. Through PCR detection and electrophoresis, the presence of the allelic variant BG2_pro, which causes long, narrow, and high aspect ratio slender grains, and the allelic variant BG2_PRO, which causes short, wide, and low aspect ratio short round grains, can be determined early and accurately in the rice germplasm materials being tested. This enables rapid, efficient, and accurate breeding selection and accelerates the breeding process.

[0073] The embodiments of this application have been described above with reference to the accompanying drawings. Specific examples have been used to illustrate the principles and implementation methods of this application. The description of the above embodiments is only for the purpose of helping to understand the core ideas of this application. However, this application is not limited to the specific embodiments described above. The specific embodiments described above are merely illustrative and not restrictive. Those skilled in the art can make many other forms under the guidance of this application without departing from the spirit and scope of the claims, and all of these forms are within the protection scope of this application.

Claims

1. A method for detecting grain shape in rice, characterized by, The method comprises the following steps: extracting genomic DNA of the rice germplasm to be detected; performing PCR amplification using the genomic DNA of the rice germplasm to be detected as a template and using a primer pair to obtain an amplification product; detecting the amplification product by agarose gel electrophoresis, and judging the grain shape of the rice germplasm to be detected according to the length of the amplification product; when the length of the amplification product is 344 bp, the promoter type of the grain shape gene BG2 in the rice germplasm to be detected is BG2_pro, and the grain shape is long grain, narrow grain, and elongated grain with a high length-width ratio; when the length of the amplification product is 371 bp, the promoter type of the grain shape gene BG2 in the rice germplasm to be detected is BG2_PRO, and the grain shape is short grain, wide grain, and short round grain with a low length-width ratio; when the amplification product is a hybrid type of 344 bp and 371 bp, the promoter type of the grain shape gene BG2 in the rice germplasm to be detected is BG2_pro / BG2_PRO, and the grain shape is between long grain and short grain, wide grain and narrow grain, and elongated grain with a high length-width ratio and short round grain with a low length-width ratio; the primer pair comprises BG2_pro-InDel-F and BG2_pro-InDel-R, and the nucleotide sequences of BG2_pro-InDel-F and BG2_pro-InDel-R are shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

2. The method of claim 1, wherein, The rice germplasm to be detected comprises at least one of IR64, Nipponbare, Jingang Soft Sticky, Yannong Silk Miao, Ofeng Silk Miao, Metzcan, Huahang No. 38, Suiyang Sticky, Huangguang Youzhan, Wuyun Ji No. 24, Longjing No. 25, Longjing No. 52, Aiziazhan, Kendai No. 19, Jijing No. 88, Longdun No. 103, Yuetian Nongzhan, Fudai No. 88, Yuetiao No. 5, Huangguang Taizhan, Mudanjiang No. 26, Longjing No. 57, Yulong No. 7, Shenfan No. 24, Tianfeng B, Nongxiang No. 39, Huanglizhan, Yehexi Silk Miao, Kendai No. 20, Jijing No. 515, Gannin Ji No. 3, Suijing No. 4, Xiangyaxiangzhan, R9822, Nanguizhan, Wushan Silk Miao, Xiushui No. 134, Longdai No. 24, Kendai No. 14, Zhonghua No. 11, and Zhonghua No.

11.

3. The method of claim 1, wherein, The reaction system of the PCR amplification is 5 μL of 10×Taq buffer containing 20 mM MgCl2, 2 μL of 10 mM dNTPs, 0.5 μL of 10 μM forward primer BG2_pro-InDel-F, 0.5 μL of 10 μM reverse primer BG2_pro-InDel-R, 0.25 μL of 5 U / μL Taq DNA polymerase, 1 μL of 10 pg / μL-1 μg / μL DNA, and water added to a total volume of 30 μL; The reaction program of the PCR amplification is pre-denaturation at 95℃ for 3 min, denaturation at 95℃ for 15 s, annealing at 58℃ for 15 s, extension at 72℃ for 30 s, 38 cycles, and extension at 72℃ for 5 min.

4. Use of the method of any one of claims 1-3 in molecular marker-assisted breeding to improve the grain shape of rice.