Detection primer probe group, kit and detection method for group A porcine rotavirus
By designing specific primer and probe sequences and combining them with droplet digital PCR technology, the problems of inflexibility and poor adaptability in the detection of group A rotavirus in pigs have been solved, achieving high sensitivity and high specificity in detection, and making it suitable for rapid diagnosis of group A rotavirus in pigs.
Patent Information
- Application Number
- CN202511212982.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-28
- Publication Date
- 2025-11-11
AI Technical Summary
The lack of highly sensitive and accurate detection methods for group A rotavirus in existing technologies makes it difficult to effectively control intestinal diseases in pigs caused by this virus.
We provide a primer and probe set and kit for detecting group A porcine rotavirus, including specific primer and probe sequences (SEQ ID NO. 1-3). Detection is performed using droplet digital PCR technology, which involves extracting RNA from samples and performing droplet digital PCR amplification. Optimized reaction conditions are used to achieve detection with high specificity, sensitivity, and repeatability.
It achieves highly sensitive, specific, and reproducible detection of group A porcine rotavirus, accurately identifying low-viral-load pathogens and improving detection accuracy and efficiency.
Smart Images

Figure CN120924728A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the technical field of molecular biology, specifically relating to the detection primer and probe set, reagent kit, and detection method for group A porcine rotavirus. Background Technology
[0002] Porcine rotavirus A (PoRVA) is a highly contagious enterovirus that is a major pathogen causing acute gastroenteritis in one-week-old piglets. The main clinical symptoms include loss of appetite, vomiting, and diarrhea, with a mortality rate as high as 50%-100%. PoRV belongs to the genus Rotavirus in the family Reoviridae. Its mature virus particles have a smooth surface and no envelope, with a diameter of approximately 65-75 nm. It is named for its "wheel-shaped" appearance under an electron microscope. In recent years, the diversity of PoRV genetic variations and the emergence of new recombinant circulating strains have exacerbated the complexity of viral diarrhea in pigs, seriously hindering the long-term healthy development of my country's pig farming industry. Therefore, establishing new rapid diagnostic methods is of great significance for improving the clinical prevention and control of PoRV.
[0003] Droplet Digital PCR (ddPCR), a highly sensitive nucleic acid quantification technique, primarily involves PCR amplification and fluorescence signal analysis. In the PCR amplification stage, ddPCR precisely distributes the qPCR system into a large number (often exceeding 10,000) of independent microwells or droplets. Ideally, each unit contains at most one analyte nucleic acid molecule, and the reaction process is similar to traditional qPCR. In the fluorescence signal analysis stage, ddPCR uses terminal detection to capture the fluorescence signal of each reaction unit. The amplified nucleic acid molecule emits a signal under fluorescence, labeled "1," and if no fluorescence signal is detected, it is labeled "0." Statistical analysis of these fluorescence signals using a Poisson distribution allows for precise determination of the nucleic acid content. Compared to traditional quantitative PCR, digital PCR directly quantifies the detection template, offering higher accuracy and sensitivity, high repeatability, and eliminating the need for standard curve construction, making it suitable for high-precision detection of porcine rotavirus.
[0004] Currently, there is no ideal droplet digital PCR detection method for group A swine rotavirus. Therefore, it is necessary to provide a detection primer and probe set, kit, and detection method for group A swine rotavirus to detect it. Summary of the Invention
[0005] To address the aforementioned technical problems, this invention provides a detection primer and probe set, reagent kit, and detection method for group A porcine rotavirus, which possesses excellent accuracy and sensitivity, thereby resolving the issues mentioned in the background section.
[0006] On the one hand, the invention provides the following technical solution: a detection primer and probe set for group A porcine rotavirus, the detection primer and probe set including primers and probes, the primers including upstream primers and downstream primers, the sequence of the upstream primer is shown in SEQ ID NO.1, the sequence of the downstream primer is shown in SEQ ID NO.2, and the sequence of the probe is shown in SEQ ID NO.3; The sequence shown in SEQ ID NO.1 is: CAGTAGCTTCCATTAGAAGCATG; The sequence shown in SEQ ID NO.2 is: AGGCTAACTACCTGGTATCCGA; The sequence shown in SEQ ID NO.3 is: AGGCTAACTACCTGGTATCCGA.
[0007] On the other hand, the invention provides the following technical solutions, such as the application of the above-mentioned detection primer and probe set for group A rotavirus in the preparation of a group A rotavirus detection kit.
[0008] In another aspect, the invention provides the following technical solution: a kit for detecting group A rotavirus in pigs, the kit comprising the detection primer and probe set as described above.
[0009] In addition, the kit for detecting group A porcine rotavirus provided by the present invention may also have the following additional technical features: Preferably, the kit further includes one or more combinations of droplet generating oil, quality control solution, positive control, negative control, RNA positive template, and buffer.
[0010] On another aspect, the invention provides the following technical solution: a detection method for group A swine rotavirus, the method comprising: S1. Extract RNA from the sample to be tested to obtain a template for droplet digital PCR reaction; S2. Perform droplet digital PCR amplification on the droplet digital PCR reaction template using the detection primer and probe set to output the detection results.
[0011] In addition, the kit for detecting group A porcine rotavirus provided by the present invention may also have the following additional technical features: Preferably, in step S2, the reaction system for droplet digital PCR amplification is: 10 μL of 4x PCR Mix, 3 μL each of PoRV upstream and downstream primers, 1 μL of probe, 1 μL of cDNA template, and 22 μL of sterile ddH2O to bring the system to 40 μL.
[0012] Preferably, in step S2, the reaction program for droplet digital PCR amplification is as follows: 95℃ for 2 min, 95℃ for 15 s, 56℃ for 30 s, for a total of 40 cycles; the reaction ends at 12℃; the heating and cooling rate is 2.5℃ / s.
[0013] The beneficial effects of the present invention, including the detection primer and probe set, kit, and detection method for group A porcine rotavirus, are as follows: The primers and probes of this invention are used for droplet digital PCR detection of group A porcine rotavirus. This method has good specificity, high sensitivity (up to 3 copies), good repeatability, can be directly quantified, and is convenient, fast, accurate and reliable. Attached Figure Description
[0014] To more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0015] Figure 1 This is a diagram showing the identification results of the successfully recombined plasmid in Example 1 of the present invention; Figure 2 This is a diagram showing the optimized reaction conditions under different temperature conditions in Example 2 of the present invention; Figure 3 This is a diagram showing the optimization of reaction conditions under different upstream and downstream primer concentrations in Example 2 of the present invention; Figure 4 This is a diagram showing the specificity verification results of the PoRV droplet digital PCR method in Example 3 of the present invention; Figure 5 This is a graph showing the sensitivity results of PoRV droplet digital PCR in Example 4 of the present invention; Figure 6 This is a graph showing the qPCR sensitivity results in Example 4 of the present invention; Figure 7 This is a graph showing the PCR sensitivity results in Example 4 of the present invention; Figure 8 This is a standard curve diagram of qPCR amplification in Example 4 of the present invention.
[0016] The present invention will be further described below with reference to the accompanying drawings and description. Detailed Implementation
[0017] Embodiments of the present invention are described in detail below, examples of which are illustrated in the accompanying drawings, wherein the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain embodiments of the present invention, and should not be construed as limiting the present invention.
[0018] This invention provides a primer and probe set, kit, and detection method for group A porcine rotavirus. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments; those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.
[0019] For the detection primer and probe set of group A swine rotavirus of the present invention, the detection primer and probe set includes primers and probes, the primers include upstream primers and downstream primers, the sequence of the upstream primer is shown in SEQ ID NO.1, the sequence of the downstream primer is shown in SEQ ID NO.2, and the sequence of the probe is shown in SEQ ID NO.3; The sequence shown in SEQ ID NO.1 is: CAGTAGCTTCCATTAGAAGCATG; The sequence shown in SEQ ID NO.2 is: AGGCTAACTACCTGGTATCCGA; The sequence shown in SEQ ID NO.3 is: AGGCTAACTACCTGGTATCCGA; It should be noted that the above sequences are all expressions that omit the 3' and 5' connectors. Therefore, the above three sequences can actually be represented as 5'-CAGTAGCTTCCATTAGAAGCATG-3', 5'-AGGCTAACTACCTGGTATCCGA-3', and 5'-AGGCTAACTACCTGGTATCCGA-3'.
[0020] This invention also provides the application of the detection primer and probe set for group A porcine rotavirus as described above in the preparation of a detection kit for group A porcine rotavirus.
[0021] For a kit for detecting group A rotavirus in pigs, the kit includes the detection primer and probe set as described above.
[0022] The kit also includes one or more combinations of droplet generating oil, quality control solution, positive control, negative control, RNA positive template, and buffer.
[0023] For the detection method of group A rotavirus in this invention, the method includes: S1. Extract RNA from the sample to be tested to obtain a template for droplet digital PCR reaction; S2. Perform droplet digital PCR amplification on the droplet digital PCR reaction template using the detection primer and probe set to output the detection results.
[0024] In step S2, the reaction system for droplet digital PCR amplification is as follows: 10 μL of 4x PCR Mix, 3 μL each of PoRV upstream and downstream primers, 1 μL of probe, 1 μL of cDNA template, and 22 μL of sterile ddH2O to bring the system to 40 μL.
[0025] In step S2, the reaction program for droplet digital PCR amplification is as follows: 95℃ for 2 min, 95℃ for 15 s, 56℃ for 30 s, for a total of 40 cycles; the reaction ends at 12℃; the heating and cooling rate is 2.5℃ / s.
[0026] The reagents and consumables used in this invention are all commercially available products, as shown in Table 1 below: Table 1
[0027] The present invention will be further illustrated below with reference to the embodiments: Example 1: Primer design and establishment of VP6 gene standard for group A porcine rotavirus 1. Based on the VP6 gene sequence of the major circulating strain PoRV already included in GenBank, the VP6 gene sequence was expanded. Referring to the "Industry Standard for Technical Specifications for Quarantine of Porcine Rotavirus Infection," dPCR-specific primers and probes were designed using SanpGene software in the highly conserved regions of the VP6 gene, and online BLAST analysis was performed on the designed primers and probes. A FAM fluorescent group was added to the 5' end of the probe sequence, and an MGB quencher group was added to the 3' end. The primers and probes were synthesized by Qingke Biotechnology Co., Ltd. and purified by HPLC. The primer and probe sequences are shown in Table 2. Table 2
[0028] 2. RNA was extracted from strain YN-A using a nucleic acid extraction kit and reverse transcribed into cDNA. The dsRNA of VP6 from PoRV was specifically amplified using the VP6 gene primers listed in Table 2. The reaction mixture consisted of: 25 µL of 2×Taq Master Mix, 2 µL each of forward and reverse primers, 1 µL of template, and 20 µL of ddH2O. The reaction program was: pre-denaturation at 95 °C for 3 min, denaturation at 95 °C for 15 s, annealing at 49 °C for 15 s, extension at 72 °C for 60 s, and final extension at 72 °C for 5 min, for 35 cycles. The PCR products were subjected to agarose gel electrophoresis and purified using a Vazyme gel extraction kit. Following the pMD19-T vector instructions, the target product was ligated to the pMD19-T vector at 16 °C for 4 h to prepare the recombinant plasmid. The ligation system is shown in Table 3. Table 3
[0029] 3. Prepare an ice box. Take the DH5α competent cells out of the -80℃ freezer and quickly insert them into the ice box to dissolve for 5-10 minutes (until they are fully dissolved). 4. Add 10µL of the above ligation product (system) to 50µL of DH5α competent cells and mix gently; heat shock in a 42℃ water bath for 60s, then quickly place back on ice for 2min, being careful not to shake or stir. 5. Add 600 µL of antibiotic-free sterile LB liquid medium to the tube in the laminar flow hood and mix well; incubate at 37°C on a shaker for 1 hour (200 rpm); centrifuge at 6000 rpm for 5 min and resuspend the bacterial pellet in only 100 µL of supernatant. 6. Take out the previously prepared LB solid culture plate containing ampicillin resistance, warm it up on the clean bench, then use a pipette to add 100µL of the bacterial solution obtained in the previous step to the culture plate, and then spread it evenly with a sterilized glass rod. 7. Incubate at 37°C upright (30 min) until the liquid is absorbed, then incubate upside down in a 37°C incubator overnight. Observe the culture plate. When colonies appear on the plate, pick out a single colony on a clean bench (using a sterilized pipette tip) and put it into an EP tube (15 mL) containing 5 mL of ampicillin-resistant LB liquid medium. Shake at 200 rpm and incubate overnight. 8. Perform RT-PCR on the bacterial culture. For bacterial cultures that test positive, follow the instructions for the plasmid extraction kit to extract the successfully recombinant plasmid. The results of the identification of the successfully recombinant plasmid are then presented. Figure 1 As shown, in Figure 1 In the diagram, M: DL5000 DNA Marker; 1: VP6 gene amplification product (fragment length is 1356bp).
[0030] Example 2: Optimization of Reaction Conditions 1. The reaction system consists of the following components: 10 µL of 4×PCR Mix for digital PCR, 3 µL each of four different primer-probe combinations at concentrations of 600, 600, 900, and 900 nmol / L, 1 µL of probes at concentrations of 200, 300, 200, and 300 nmol / L, 1 µL of template, and finally, dd H₂O to make up to 40 µL. The reaction conditions are: 95℃ for 2 min, 95℃ for 15 s, and 56℃ for 30 s, for a total of 40 cycles; the reaction ends at 12℃. Maintaining the reaction system as described in 2.2.3.3, the reaction program is modified by setting four temperature gradients (52℃, 54℃, 56℃, and 58℃) to optimize the annealing temperature. When changing a particular temperature, other reaction conditions and programs remain unchanged. The experiment is repeated multiple times to determine the optimal reaction temperature. In this experiment, the copy numbers of the standards detected by digital PCR within the annealing temperature range of 52℃ to 58℃ were 220, 233, 251, and 214 copies / µL, respectively. Figure 2 The results showed that the difference was most obvious and the copy number was highest at 56℃. Figure 3 As can be seen, the difference is most obvious when the upstream and downstream primers are added at a concentration of 600 nmol / L with an amount of 3 μL, while the corresponding probe is added at a concentration of 300 nmol / L with an amount of 1 μL, and the copy number is the highest.
[0031] Example 3 Specificity Test 1. RNA from PoRV, SVA, PDCoV, PEDV, TGEV, CSFV, PRRSV, and JEV, as well as RNA and DNA from PRV, were extracted using the Axygen DNA / RNA extraction kit. The extracted RNA was reverse transcribed into cDNA and added to an optimized ddPCR reaction system for specificity assay. The specificity verification results of the PoRV droplet digital PCR method are as follows: Figure 4 As shown, from Figure 4 As can be seen, except for the specific amplification at the positive control location, the negative control and other porcine virus detection items were all negative.
[0032] Example 4: Determination of sensitivity and repeatability of ddPCR 1. PoRV standards were analyzed using a NanDrop ND-2000 micro-volume nucleic acid detection instrument. Recombinant plasmids of known concentrations were diluted to 10⁸–10⁻² copies / µL. Standards at each dilution were used as templates in optimized ddPCR, qPCR, and conventional PCR assays to evaluate the sensitivity of the established PoRV ddPCR method. Figure 5As can be seen, the theoretical minimum detection limit of digital PCR is 3.97 copies / µL. Figure 5 In the middle, the concentrations of plasmids 1 to 9 were 3.97 × 10⁹. 8 ~3.97×10 0 Copies; 10 copies were used as a negative control. Figure 6 As can be seen, the theoretical minimum detection limit for qPCR is 39.7 copies / µL. Figure 6 In the middle, the concentrations of plasmids 1 to 9 were 3.97 × 10⁹. 8 ~3.97×10 0 Copies; 10 copies were used as a negative control. Figure 7 As can be seen, the minimum detection limit for conventional PCR is 3970 copies / µL. Figure 7 In the diagram, M represents DL2000 DNA Marker; 1-8 represent plasmid concentrations of 3.97 × 10⁻⁸ respectively. 8 ~3.97×10 1 copies / µL (fragment length 115bp), from Figure 8 As can be seen from the data, the standard curve equation for the qPCR detection method is y = -3.639x + 37.175, with an amplification efficiency of 99.5% and a correlation coefficient R^2 = 0.999. For four different template concentrations, the same sample was subjected to three different droplet digital PCR detections, as shown in Table 4. The results showed that the coefficients of variation between groups were 1.2%, 1.9%, 6.4%, and 8.1%. After storage at -20℃ for 3 days, the samples were retested, and the results showed coefficients of variation of 1.9%, 5.2%, 8.2%, and 9.8%, indicating that the method has good intra- and inter-group repeatability and stable detection data.
[0033] Table 4
[0034] Example 5: Detection of clinical samples 1. The ddPCR method established in this invention, along with existing qPCR and PCR methods, were used to detect and compare 142 collected pig anal swabs, intestinal tissues, and intestinal contents. The samples were obtained from pig farms in Guangdong, Sichuan, and Yunnan provinces from 2021 to 2023. The experiment was repeated three times, and the results are shown in Table 5. Table 5
[0035] As shown in Table 5 above, the ddPCR method established in this application detected the most positive samples. Its sensitivity is superior to qPCR and PCR methods, and it can detect pathogens with lower viral loads or weaker signals. At the same time, it can more accurately identify true positives.
[0036] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention are equivalent substitutions and are included within the protection scope of the present invention.
Claims
1. A primer and probe set for detecting group A porcine rotavirus, characterized in that, The detection primer-probe set includes primers and probes. The primers include an upstream primer and a downstream primer. The sequence of the upstream primer is shown in SEQ ID NO.1, the sequence of the downstream primer is shown in SEQ ID NO.2, and the sequence of the probe is shown in SEQ ID NO.
3. The sequence shown in SEQ ID NO.1 is: CAGTAGCTTCCATTAGAAGCATG; The sequence shown in SEQ ID NO.2 is: AGGCTAACTACCTGGTATCCGA; The sequence shown in SEQ ID NO.3 is: AGGCTAACTACCTGGTATCCGA.
2. The application of the detection primer and probe set for group A porcine rotavirus as described in claim 1 in the preparation of a detection kit for group A porcine rotavirus.
3. A kit for detecting group A porcine rotavirus, characterized in that, The kit includes the detection primer and probe set as described in claim 1.
4. The kit for detecting group A porcine rotavirus according to claim 3, characterized in that, The kit also includes one or more combinations of droplet generating oil, quality control solution, positive control, negative control, RNA positive template, and buffer.
5. A method for detecting group A porcine rotavirus, characterized in that, The method includes: S1. Extract RNA from the sample to be tested to obtain a template for droplet digital PCR reaction; S2. Perform droplet digital PCR amplification on the droplet digital PCR reaction template using the detection primer and probe set to output the detection results.
6. The detection method for group A porcine rotavirus according to claim 5, characterized in that, In step S2, the reaction system for droplet digital PCR amplification is as follows: 10 μL of 4x PCR Mix, 3 μL each of PoRV upstream and downstream primers, 1 μL of probe, 1 μL of cDNA template, and 22 μL of sterile ddH2O to bring the system to 40 μL.
7. The detection method for group A porcine rotavirus according to claim 5, characterized in that, In step S2, the reaction program for droplet digital PCR amplification is as follows: 95℃ for 2 min, 95℃ for 15 s, 56℃ for 30 s, for a total of 40 cycles; the reaction ends at 12℃; the heating and cooling rate is 2.5℃ / s.