Varicella zoster virus nucleic acid detection kit based on fluorescent PCR method and detection method

Abstract

The invention relates to a varicella-zoster virus nucleic acid detection kit based on a fluorescent PCR method and a detection method, and belongs to the technical field of virus nucleic acid detection. The kit comprises a specific primer probe combination, a positive control system, a negative control system and an internal reference system which are designed aiming at conserved regions such as VZV genome ORF62, ORF29 / 28 and the like, supports a single-tube premixing or double-tube split reaction system, has the detection limit of 500 copies / mL, can finish detection within 40 minutes at the soonest, has good specificity, interference resistance and stability, is suitable for various fluorescent PCR instruments such as ABI 7500, Roch LC480 and the like, and can be widely applied to detection of VZV genomes. The kit can be widely applied to clinical diagnosis, epidemic situation monitoring and vaccine effect evaluation of varicella and herpes zoster.

Description

Technical Field

[0001] This invention relates to the field of viral nucleic acid detection technology, and in particular to a varicella-zoster virus nucleic acid detection kit and detection method based on fluorescence PCR. Background Technology

[0002] Varicella-zoster virus (VZV) is a type 3 human herpesvirus belonging to the alphaherpesvirus subfamily of the herpesviridae family. Humans are its only natural host. This virus can cause two distinct diseases: primary infection, most commonly in children, manifests as chickenpox; while reactivation of the virus, which lies dormant in the dorsal root ganglia of the spinal cord or intracranial ganglia, when the immune system is weakened, leads to herpes zoster (HZ). Typical lesions of herpes zoster present as clusters of painful vesicles distributed unilaterally along the dermatomes, and may be accompanied by mild fatigue, low-grade fever, loss of appetite, and other systemic symptoms. The most common complication is postherpetic neuralgia (PHN), which severely impacts the patient's quality of life. With the aging population, the incidence of herpes zoster is increasing annually, and in recent years it has shown a trend towards affecting younger people. Adults with immunodeficiency or immunosuppression also have a relatively higher risk of developing the disease, making it a significant public health issue.

[0003] The pathogenic mechanism of VZV mainly involves the virus entering the human body through the respiratory tract, eyes, pharynx, and skin. It first proliferates in local lymph nodes, then spreads through the bloodstream to all internal organs, multiplying extensively. The characteristic rash appears after an incubation period of approximately 2-3 weeks. Immune responses, especially cellular immunity (VZV-CMI), play a crucial role in controlling viral replication and preventing reactivation. Vaccination can increase VZV-CMI levels and is the most economical and effective means of preventing shingles. Currently, globally approved shingles vaccines include live attenuated vaccines (ZVL) and recombinant vaccines (RZV). RZV is preferred by many countries due to its safety and efficacy advantages; however, live attenuated vaccines should be carefully considered for use in immunocompromised or immunosuppressed individuals.

[0004] Diagnostic methods for VZV infection have evolved from traditional techniques to molecular detection. Early diagnosis relied on staining of cells at the base of herpes lesions to examine eosinophilic intranuclear inclusions and multinucleated giant cells, or on detecting viral antigens through immunofluorescence or immunoenzyme staining. However, these methods have limited sensitivity and are cumbersome. Plaque counting, as a classic method for detecting viral infectivity titers, is difficult to meet the needs of rapid diagnosis due to its long detection cycle and complex procedures.

[0005] In recent years, advancements in molecular detection technologies have provided new tools for VZV diagnosis. Real-time fluorescence PCR (PCR) technology, with its advantages of high specificity, high sensitivity, and rapid detection, has become the mainstream method for pathogen nucleic acid detection. Its core principle involves adding fluorescently labeled probes to the PCR system. By monitoring the dynamic changes in fluorescence signals, the amplification process is reflected in real time, enabling both qualitative and quantitative analysis. Furthermore, it eliminates the need for post-PCR processing steps, significantly shortening detection time and reducing the risk of contamination. TaqMan probe technology, as an important application of real-time fluorescence PCR, further improves detection specificity by releasing fluorescence signals through probe hydrolysis. In clinical trials of shingles vaccines, PCR results have become a crucial basis for determining endpoint cases, especially for collected skin lesion specimens (prioritized by vesicle fluid, crusts, and maculopapular rashes). Infection status must be confirmed by PCR testing. Only when there are no skin lesion samples or the nucleic acid detection system is invalid can a clinically diagnosed case be used as the endpoint.

[0006] However, existing VZV nucleic acid detection methods still have room for improvement: some kits only have a detection limit of over 1000 copies / mL, which is insufficient for detecting samples with low viral loads (such as early skin lesions or atypical cases); the reaction systems are mostly multi-part fractionation systems, which are cumbersome and prone to contamination; some kits have limited compatibility with certain instruments and are difficult to adapt to various clinically used quantitative PCR platforms (such as ABI 7500, Roche LightCycler 480, and SLAN-96). Furthermore, in vaccine clinical trials, case surveillance, emergency monitoring of outbreaks, or applications in primary healthcare institutions, there are higher requirements for detection efficiency and ease of operation; existing kits still need optimization in terms of rapid detection and stability.

[0007] Therefore, developing a VZV nucleic acid detection kit (fluorescent PCR method) that is highly sensitive, easy to operate, widely applicable, and stable is of great significance for improving the early diagnosis efficiency of varicella and herpes zoster, supporting the endpoint determination of vaccine clinical trials, guiding clinical treatment, and controlling the epidemic. Summary of the Invention

[0008] To address the shortcomings of existing technologies, the present invention aims to provide a varicella-zoster virus nucleic acid detection kit and detection method based on fluorescence PCR, which overcomes the deficiencies of existing varicella-zoster virus (VZV) nucleic acid detection technologies, such as insufficient sensitivity, cumbersome operation, limited applicable models, and long detection time. This invention achieves rapid, sensitive, and specific detection of VZV, meeting the needs of clinical diagnosis, epidemic monitoring, vaccine efficacy evaluation, and prevention of shingles complications.

[0009] The above-mentioned objective of this invention is achieved through the following technical solutions:

[0010] On one hand, this invention discloses a varicella-zoster virus nucleic acid detection kit based on fluorescent PCR, comprising:

[0011] The amplification reaction solution contains specific primers and TaqMan probes targeting the coding regions of ORF62, ORF29 / 28, ORF68, ORF31, ORF37 or ORF54 in the VZV genome.

[0012] Positive control: virus-like particles containing VZV-specific fragments;

[0013] The negative control was physiological saline.

[0014] The specific primers and probes are selected from at least one of the following groups:

[0015] (a) Primer VZV-WX-3-F: CCTTGGAAACCACATGATCGT, primer VZV-WX-3-R: AGCAAAGCCTCCTCGACAA, probe VZV-WX-3-P: TGCAACCCGGGCGTCCG;

[0016] (b) Primer VZV-WX-6-F: TCTCGACTGGCTGGGACTTG, primer VZV-WX-6-R: CGCCGCACGCTCTCTTT, probe VZV-WX-6-P: CGTAAACGATCATCCGGTGGACACACA;

[0017] (c) Primer VZV-ZS-3-F: TTCCACCCTTCAATCCAGAC, primer VZV-ZS-3-R: TCGAATCCTAGAAGCGTTACC, probe VZV-ZS-3-P: ATGCACGGGGATGACTCTAAGGC;

[0018] (d) Primer VZV-ZS-6-F: GAGAAACAAACTCACGACTCTT, primer VZV-ZS-6-R: GGAAGATCCCACGCACCA, probe VZV-ZS-6-P: TGGCTTTTTCTCCACTGGGCTGTC.

[0019] As a further technical solution of the present invention: the amplification reaction solution is a single-tube premixed form, containing magnesium ions, nucleotide mixture, primers and probes for VZV and internal control, DNA polymerase, reverse transcriptase and UNG enzyme, with a volume of 800-1000 μL.

[0020] As a further technical solution of the present invention: the amplification reaction solution is a dual-tube split type, comprising:

[0021] Nucleic acid amplification reaction solution: 600-800 μL, containing primers and probes with magnesium ions, NTP, VZV and internal control;

[0022] Enzyme mixture: 200 μL, containing DNA polymerase, reverse transcriptase and UNG enzyme.

[0023] As a further technical solution of the present invention, it also includes an internal control system, wherein the internal control system is an ACTB internal control primer-probe combination.

[0024] Primer ACTB-F2: GCATGGGTCAGAAGGATTCCTATT;

[0025] Primer ACTB-R2: TGTAGAAGGTGTGGTGCCAGATT;

[0026] Probe ACTB-P2: TCGAGCACGGCATCGTCACCAA, with its 5' end labeled CY5 and its 3' end labeled BHQ2.

[0027] As a further technical solution of the present invention: the storage conditions of the kit are -20°C and below, the shelf life is 12 months, and it can withstand repeated freeze-thaw cycles of no more than 6 times.

[0028] On the other hand, the present invention also discloses a method for detecting VZV nucleic acid using the above-mentioned varicella-zoster virus nucleic acid detection kit based on fluorescence PCR, comprising the following steps:

[0029] Step S1: Extract nucleic acid from the sample to be tested. Sample types include herpes fluid, blood, cerebrospinal fluid, and nasopharyngeal secretions.

[0030] Step S2: Mix the extracted nucleic acid with the amplification reaction solution to prepare the reaction system. The total reaction volume is 20 μL.

[0031] Step S3: Perform a fluorescent PCR reaction. The procedure includes: 37°C digestion for 2 min, 95°C pre-denaturation for 30 s-5 min, followed by 40-45 cycles of 95°C denaturation for 10 s and 62°C or 66°C annealing extension for 30 s, with real-time collection of fluorescence signals.

[0032] Step S4: Determine the results based on the Ct value and amplification curve. Specifically, determine whether VZV nucleic acid exists in the sample based on the cycle threshold (Ct value) and amplification curve.

[0033] As a further technical solution of the present invention: the total volume of the reaction system for the fluorescent PCR detection is 20 μL, comprising: 10 μL of 2×TaqProU+MultipleProbeqPCRMix, 0.4 μL of primer F (10 μM), 0.4 μL of primer R (10 μM), 0.2 μL of TaqMan probe (10 μM), 5 μL of template DNA, and 4 μL of ddH2O.

[0034] As a further technical solution of the present invention, the method satisfies the following analytical performance:

[0035] Limit of detection: 500 copies / mL, with a detection rate of ≥90% after 20 replicates;

[0036] Specificity: No cross-reactivity with influenza A virus or influenza B virus;

[0037] Anti-interference ability: It can still be accurately detected in the presence of blood, mucin, and common drugs.

[0038] As a further technical solution of the present invention: the applicable models for the fluorescent PCR detection include ABI7500, Roche LC480 / Z480, and Hongshi SLAN-96.

[0039] As a further technical solution of the present invention: by optimizing the amplification program, the detection time is shortened to 40-70 minutes, specifically by reducing the denaturation time to 5-10 seconds, the extension time to 10-30 seconds, and the number of cycles to 40-42.

[0040] In summary, compared with the prior art, the present invention includes at least one of the following beneficial technical effects:

[0041] 1. High sensitivity and specificity: The primer-probe combination designed for the conserved coding region of VZV has a detection limit of up to 500 copies / mL, and has no cross-reactivity with common pathogens such as influenza A virus and respiratory syncytial virus. It also has strong anti-interference ability (it can tolerate interference from blood, mucin and various drugs).

[0042] 2. Simple and efficient operation: The single-tube premixed reaction solution does not require immediate preparation, reducing operation steps and the risk of contamination. The detection time is as short as 40 minutes, which is suitable for rapid diagnostic needs.

[0043] 3. Good stability: It has a shelf life of up to 12 months when stored at -20℃, can withstand 6 repeated freeze-thaw cycles, and its transportation stability has been verified to be unaffected by a 5-day simulation.

[0044] 4. Wide range of applications: Compatible with a variety of mainstream PCR instruments, it can detect various sample types such as herpes fluid, blood, and cerebrospinal fluid. It is suitable for clinical diagnosis, epidemic monitoring, and virus monitoring after vaccination, providing strong technical support for the prevention and control of herpes zoster. In particular, it can help evaluate the preventive effect of vaccination against VZV reactivation, and form a synergistic effect with the application of herpes zoster vaccine. Attached Figure Description

[0045] Figure 1 This is a melting curve of the qPCR of the present invention. Detailed Implementation

[0046] The technical solutions in the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of this application without creative effort are within the scope of protection of this application.

[0047] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0048] It should be noted that the terminology used herein is for the purpose of describing particular implementations only and is not intended to limit the exemplary implementations according to this application. As used herein, the singular form includes the plural form unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this description, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0049] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0050] Example 1:

[0051] This invention discloses a varicella-zoster virus nucleic acid detection kit based on fluorescent PCR, specifically comprising:

[0052] 1. Kit Components

[0053] Amplification reaction solution: Contains specific primers and TaqMan probes designed for conserved regions in the VZV genome, and can be selected in either single-tube premixed or dual-tube split form.

[0054] (1) Single tube premixed type (800-1000μL): Contains magnesium ions, nucleotide mixture (NTP), VZV specific primer probe, internal reference primer probe, DNA polymerase, reverse transcriptase and UNG enzyme. It can be directly dispensed and used without preparation before use.

[0055] (2) Two-tube split type: includes nucleic acid amplification reaction solution (600-800μL, containing primers and probes for magnesium ions, NTP, VZV and internal control) and enzyme mixture (200μL, containing DNA polymerase, reverse transcriptase and UNG enzyme), which need to be mixed immediately before use.

[0056] Specific primers and probes: Designed based on conserved coding regions such as ORF62, ORF29 / 28, ORF68, ORF31, ORF37, and ORF54 in the VZV genome. Experimentally validated optimal combinations include:

[0057] (a) Primer VZV-WX-3-F: CCTTGGAAACCACATGATCGT, primer VZV-WX-3-R: AGCAAAGCCTCCTCGACAA, probe VZV-WX-3-P: TGCAACCCGGGCGTCCG;

[0058] (b) Primer VZV-WX-6-F: TCTCGACTGGCTGGGACTTG, primer VZV-WX-6-R: CGCCGCACGCTCTCTTT, probe VZV-WX-6-P: CGTAAACGATCATCCGGTGGACACACA;

[0059] (c) Primer VZV-ZS-3-F: TTCCACCCTTCAATCCAGAC, primer VZV-ZS-3-R: TCGAATCCTAGAAGCGTTACC, probe VZV-ZS-3-P: ATGCACGGGGATGACTCTAAGGC;

[0060] (d) Primer VZV-ZS-6-F: GAGAAACAAACTCACGACTCTT, primer VZV-ZS-6-R: GGAAGATCCCACGCACCA, probe VZV-ZS-6-P: TGGCTTTTTCTCCACTGGGCTGTC.

[0061] Internal control system: The ACTB internal control primer-probe combination is used to monitor the entire nucleic acid extraction and PCR reaction process, ensuring the reliability of the results.

[0062] (1) Primer ACTB-F2: GCATGGGTCAGAAGGATTCCTATT;

[0063] (2) Primer ACTB-R2: TGTAGAAGGTGTGGTGCCAGATT;

[0064] (3) Probe ACTB-P2: TCGGAGCACGGCATCGTCACCAA (5'-CY5 label, 3'-BHQ2 label).

[0065] Reference standard:

[0066] Positive control (500 μL): Virus-like particles containing VZV-specific fragments, used to verify the effectiveness of the detection system;

[0067] Negative control (500 μL): physiological saline, used to eliminate contamination.

[0068] 2. Detection Method

[0069] The steps for detecting VZV nucleic acid using the kit of this invention are as follows:

[0070] (1) Sample processing: Extract nucleic acid from the sample to be tested (herpes fluid, blood, cerebrospinal fluid, nasopharyngeal secretions, etc.), with an extraction efficiency of ≥90%;

[0071] (2) Preparation of reaction system: Mix the extracted nucleic acid with the amplification reaction solution in a certain proportion. The total reaction volume is 20 μL, including 10 μL of 2×TaqProU+MultipleProbeqPCRMix, 0.4 μL each of primer F / R (10 μM), 0.2 μL of TaqMan probe (10 μM), 5 μL of template DNA, and 4 μL of ddH2O;

[0072] (3) Fluorescent PCR detection: The optimized reaction program was used: 37℃ digestion for 2 min (UNG enzyme to remove aerosol contamination), 95℃ pre-denaturation for 30 s-5 min, followed by 40-45 cycles (95℃ denaturation for 10 s, 62℃ or 66℃ annealing extension for 30 s), and fluorescent signals were collected in real time.

[0073] (4) Result determination: Based on the cycle threshold (Ct value) and amplification curve, the positive control Ct value should be within a reasonable range, the negative control should not amplify, and the sample Ct value <38 is determined to be positive, otherwise it is negative.

[0074] 3. Performance optimization

[0075] S1. Detection limit optimization: By increasing the sample extraction loading volume (200μL→300 / 400μL), reducing the elution volume (100μL→75 / 50μL), and adjusting the amplification reaction system (such as reducing the reaction liquid volume to 15μL and increasing the sample loading volume to 30μL), the detection limit can reach 500 copies / mL (20 replicate detection rate ≥90%), and after optimization, it can be reduced to 150 copies / mL;

[0076] S2. Optimization of detection time: By shortening the denaturation time (10s→5s), extension time (30s→15s), and number of cycles (45→40), the detection time is reduced from 75 minutes to 40-70 minutes without affecting the detection performance;

[0077] S3. Expanded Applicable Models: Compatible with mainstream real-time PCR instruments such as ABI 7500, Roche LC480 / Z480, and Hongshi SLAN-96, ensuring universality for different laboratories.

[0078] Example 2: Primer and probe screening experiment

[0079] 1.1 Experimental Design

[0080] Eleven candidate primers and probes were selected, using VZV standard (2.6 × 10⁻⁶). 7 Using copies / mL as template, the sample was serially diluted to 1.00E+02 copies / mL. A 20μL reaction system (10μL qPCRMix, 0.4μL primers, 0.2μL probe, 5μL template, 4μL ddH2O) was used for amplification on a fluorescence PCR instrument (37℃ 2min → 95℃ 30s → 40 cycles (95℃ 10s → 62℃ / 66℃ 30s)).

[0081] (1) The primer sequence number correspondence is shown in Table 1:

[0082] Table 1

[0083]

[0084]

[0085] (2) The reaction system is shown in Table 2:

[0086] Table 2

[0087]

[0088]

[0089] (3) The preparation of standard products is shown in Table 3:

[0090] Table 3

[0091]

[0092] (4) Reaction Procedure

[0093] Primer numbers 1-5 are shown in Table 4:

[0094] Table 4

[0095]

[0096] Primer numbers 6-11 are shown in Table 5:

[0097] Table 5

[0098]

[0099] 1.2 Experimental Data

[0100] PCR results:

[0101] Primer numbers: 1-5, as shown in Tables 6 and 7:

[0102] Table 6

[0103]

[0104] Table 7

[0105]

[0106]

[0107] Primer numbers: 6-11, as shown in Tables 8 and 9:

[0108] Table 8

[0109]

[0110] Table 9

[0111]

[0112] The amplification efficiency is shown in Table 10:

[0113] Table 10

[0114]

[0115] Note: Primer 1 result is abnormal; amplification efficiency cannot be displayed. Error < 0.2, amplification efficiency is between 90% and 110%.

[0116] 1.3 Results Analysis

[0117] Primers 3, 4, 5 and 8, 11 met the requirements, and the detection LOD was 500 copies / mL, satisfying the customer's requirements. Further verification of the specificity of the amplified products was performed using melting curves (see attached). Figure 1 The melting curve of positive samples (containing VZV plasmid) showed a single specific peak (see attached image). Figure 1 A); Negative controls (NTC water, gDNA) showed no specific peak or the peak signal was significantly lower than the positive threshold (see attached image). Figure 1 B). This result indicates that the primer-probe combination of the present invention can specifically amplify VZV nucleic acid without significant non-specific amplification, further confirming the reliability of the detection system.

[0118] Example 3: Selection and Validation of Internal Reference System

[0119] 2.1 Internal reference primers and probe sequences

[0120] The ACTB internal control primer and probe sequences are shown in Table 11 below:

[0121] Table 11

[0122]

[0123] 2.2 Construction of the reaction system

[0124] The TERT internal control system (20 μL) is shown in Table 12:

[0125] Table 12

[0126]

[0127] The ACTB internal control system (20 μL, using primer 4 as an example) is shown in Table 13:

[0128] Table 13

[0129]

[0130] 2.3 Reaction Program Setup

[0131] TERT internal control system reaction procedure: same as the reaction procedure for primers 6-11 in Example 1 (annealing at 66°C).

[0132] ACTB internal control system reaction procedure: Same as the reaction procedure for primers 1-5 in Example 1 (annealing at 62℃).

[0133] 2.4 Results

[0134] TERT internal control system: The amplification efficiency and sensitivity of primer 11 with the TERT internal control met the requirements. Stable detection was achieved at a concentration of 500 copies / mL. A larger bias was observed at 1000 copies / mL, but this is acceptable given that this is a qualitative experiment. ACTB internal control system: The dual-channel PCR amplification efficiency and sensitivity of primers 4 and 6 with the ACTB internal control met the requirements, with amplification efficiency between 90% and 110%. The detection limit was met at a concentration of 500 copies / mL.

[0135] Example 4: Optimization and Performance Verification of the Detection System

[0136] 3.1 Detection limit optimization

[0137] The detection limit was optimized by increasing the sample extraction loading volume (200μL→300 / 400μL), decreasing the elution volume (100μL→75 / 50μL), adjusting the amplification reaction system volume (20μL→15 / 10μL), and adjusting the sample loading volume (5μL→25 / 30μL).

[0138] 3.2 Optimization of Detection Time

[0139] The detection time was optimized by shortening the denaturation time (10s→5s), extending the time (30s→15s), and increasing the number of cycles (45→40).

[0140] 3.3 Performance Indicator Verification

[0141] Validate the detection limit (500 copies / mL), specificity (no cross-reactivity), precision (intra-assay / inter-assay CV <5%), and stability (no effect after 12 months of storage at -20°C and 6 freeze-thaw cycles).

[0142] 3.4 Results

[0143] Limit of detection: The optimized limit of detection can reach 500 copies / mL (Option 1: 40 / 40; Option 2: 78 / 80).

[0144] Testing time: shortened from 75 minutes to 40-47 minutes, with no significant performance degradation.

[0145] Applicable models: No significant difference in test results across different PCR instruments.

[0146] Stability: Stable performance after 12 months of storage at -20℃ and 5 days of simulated transportation.

[0147] Example 5: Clinical sample testing and comparison with previous test results

[0148] 4.1 Patient Selection

[0149] In the experimental group, the prognostic results obtained according to this model are shown in Table 14 below:

[0150] Table 14

[0151] Reference test positive Reference test negative Positive test result pending evaluation 322 2 Negative test result pending evaluation 3 96

[0152] The calculated compliance rate data is as follows:

[0153] Positive compliance rate = A / (A+C)×100% = 99.08%;

[0154] Negative compliance rate = D / (B+D)×100% = 97.96%;

[0155] Positive predictive value = A / (A+B) × 100% = 99.38%;

[0156] Negative predictive value = D / (C+D) × 100% = 96.67%;

[0157] Overall compliance rate = (A+D) / (A+B+C+D)×100% = 98.82%;

[0158] Kappa value = 0.966915.

[0159] The implementation principle of this invention is as follows: This invention discloses a varicella-zoster virus nucleic acid detection kit and detection method based on fluorescence PCR, belonging to the field of viral nucleic acid detection technology. The kit includes specific primer and probe combinations designed for conserved regions of the VZV genome such as ORF62 and ORF29 / 28, a positive control, a negative control, and an internal control system. It supports single-tube premixed or dual-tube split-type reaction systems, with a detection limit of up to 500 copies / mL, and detection can be completed in as little as 40 minutes. It has good specificity, anti-interference, and stability, and is suitable for various fluorescence PCR instruments such as the ABI 7500 and Roche LC480. It can be widely used in the clinical diagnosis, epidemic monitoring, and vaccine efficacy evaluation of varicella and herpes zoster.

[0160] The embodiments described herein are preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Therefore, all equivalent changes made in accordance with the structure, shape, and principle of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A varicella-zoster virus nucleic acid detection kit based on fluorescent PCR, characterized in that, include: The amplification reaction solution contains specific primers and TaqMan probes targeting the coding regions of ORF62, ORF29 / 28, ORF68, ORF31, ORF37 or ORF54 in the VZV genome. Positive control: virus-like particles containing VZV-specific fragments; The negative control was physiological saline. The specific primers and probes are selected from at least one of the following groups: (a) Primer VZV-WX-3-F: CCTTGGAAACCACATGATCGT, primer VZV-WX-3-R: AGCAAAGCCTCCTCGACAA, probe VZV-WX-3-P: TGCAACCCGGGCGTCCG; (b) Primer VZV-WX-6-F: TCTCGACTGGCTGGGACTTG, primer VZV-WX-6-R: CGCCGCACGCTCTCTTT, probe VZV-WX-6-P: CGTAAACGATCATCCGGTGGACACACA; (c) Primer VZV-ZS-3-F: TTCCACCCTTCAATCCAGAC, primer VZV-ZS-3-R: TCGAATCCTAGAAGCGTTACC, probe VZV-ZS-3-P: ATGCACGGGGATGACTCTAAGGC; (d) Primer VZV-ZS-6-F: GAGAAACAAACTCACGACTCTT, primer VZV-ZS-6-R: GGAAGATCCCACGCACCA, probe VZV-ZS-6-P: TGGCTTTTTCTCCACTGGGCTGTC.

2. The varicella-zoster virus nucleic acid detection kit based on fluorescent PCR according to claim 1, characterized in that, The amplification reaction solution is a single-tube premixed solution containing magnesium ions, a nucleotide mixture, primers and probes for VZV and internal control, DNA polymerase, reverse transcriptase and UNG enzyme, with a volume of 800-1000 μL.

3. The varicella-zoster virus nucleic acid detection kit based on fluorescent PCR according to claim 1, characterized in that, The amplification reaction solution is a dual-tube split type, comprising: Nucleic acid amplification reaction solution: 600-800 μL, containing primers and probes with magnesium ions, NTP, VZV and internal control; Enzyme mixture: 200 μL, containing DNA polymerase, reverse transcriptase and UNG enzyme.

4. The varicella-zoster virus nucleic acid detection kit based on fluorescent PCR according to claim 1, characterized in that, It also includes an internal control system, which is an ACTB internal control primer-probe combination: Primer ACTB-F2: GCATGGGTCAGAAGGATTCCTATT; Primer ACTB-R2: TGTAGAAGGTGTGGTGCCAGATT; Probe ACTB-P2: TCGAGCACGGCATCGTCACCAA, with its 5' end labeled CY5 and its 3' end labeled BHQ2.

5. The varicella-zoster virus nucleic acid detection kit based on fluorescent PCR according to claim 1, characterized in that, The reagent kit is stored at -20°C or below, has a shelf life of 12 months, and can withstand repeated freeze-thaw cycles no more than 6 times.

6. A method for detecting VZV nucleic acid using a varicella-zoster virus nucleic acid detection kit based on fluorescent PCR as described in any one of claims 1-5, characterized in that, Includes the following steps: Step S1: Extract nucleic acid from the sample to be tested; Step S2: Mix the extracted nucleic acid with the amplification reaction solution to prepare the reaction system; Step S3: Perform a fluorescent PCR reaction. The procedure includes: 37°C digestion for 2 min, 95°C pre-denaturation for 30 s-5 min, followed by 40-45 cycles of 95°C denaturation for 10 s and 62°C or 66°C annealing extension for 30 s, with real-time collection of fluorescence signals. Step S4: Determine the result based on the Ct value and amplification curve.

7. The method for detecting VZV nucleic acid using a varicella-zoster virus nucleic acid detection kit based on fluorescent PCR according to claim 6, characterized in that, The total volume of the reaction system for the fluorescent PCR detection is 20 μL, containing: 10 μL of 2×TaqProU+MultipleProbeqPCRMix, 0.4 μL of primer F (10 μM), 0.4 μL of primer R (10 μM), 0.2 μL of TaqMan probe (10 μM), 5 μL of template DNA, and 4 μL of ddH2O.

8. The method for detecting VZV nucleic acid using a varicella-zoster virus nucleic acid detection kit based on fluorescent PCR according to claim 6, characterized in that, The method satisfies the following analytical performance: Limit of detection: 500 copies / mL, with a detection rate of ≥90% after 20 replicates; Specificity: No cross-reactivity with influenza A virus or influenza B virus; Anti-interference ability: It can still be accurately detected in the presence of blood, mucin, and common drugs.

9. The method for detecting VZV nucleic acid using a varicella-zoster virus nucleic acid detection kit based on fluorescent PCR according to claim 6, characterized in that, The applicable models for the fluorescent PCR detection include ABI 7500, Roche LC480 / Z480, and Hongshi SLAN-96.

10. The method for detecting VZV nucleic acid using a varicella-zoster virus nucleic acid detection kit based on fluorescent PCR according to claim 6, characterized in that, By optimizing the amplification procedure, the detection time can be shortened to 40-70 minutes. Specifically, the denaturation time can be reduced to 5-10 seconds, the extension time to 10-30 seconds, and the number of cycles can be reduced to 40-42.

Images