Monoclonal antibody for resisting porcine CD163 molecule FP14 epitope peptide, hybridoma cell strain 1F9E2 and application

Abstract

The invention discloses a hybridoma cell strain 1F9E2 obtained from the FP14 key epitope on the surface of the Loop5-6 region of the SRCR5 structural domain of a porcine reproductive and respiratory syndrome virus receptor porcine CD163 molecule, and a monoclonal antibody and application of the hybridoma cell strain 1F9E2. The 1F9E2 monoclonal antibody prepared by using the hybridoma cell is only combined with an IPAMM-CD163 cell and a MARC-145 cell which express CD163, and is not combined with an IPEC-J2 cell which does not express CD163; the 1F9E2 monoclonal antibody can be used for effectively inhibiting the infection of susceptible cells, namely MARC-145 cells and IPAM-CD163 cells, by NADC30-Like PRRSV (Reproductive and Respiratory Syndrome Virus) and HP-PRRSV JXA1. The monoclonal antibody aiming at the FP14 key epitope mediating PRRSV infection has a potential application prospect in the treatment and prevention of the PRRSV antibody.

Description

Technical Field

[0001] This invention belongs to the field of veterinary biological products technology, specifically relating to a monoclonal antibody against the FP14 epitope peptide of porcine CD163 molecule, the hybridoma cell line 1F9E2, and its application, particularly a monoclonal antibody targeting a key epitope mediating PRRSV infection in the Loop5-6 region of the SRCR5 domain of the porcine reproductive and respiratory syndrome virus receptor CD163 molecule and its application. Background Technology

[0002] Given the current lack of effective drugs against Porcine reproductive and respiratory syndrome virus (PPRSV), and the numerous safety and efficacy issues with traditional vaccines as the primary prevention and control method, it is noteworthy that targeted PRRSV control strategies face challenges due to PRRSV's high variability. The first step in PRRSV invasion of susceptible host cells is binding to receptors on the cell. Currently, the most effective anti-PRRSV strategy is considered to be blocking the binding of PRRSV to host receptors, directly interfering with the initial stage of PRRSV infection. Therefore, antibody therapy that directly targets the viral receptor has become an alternative option for PRRSV prevention and control. Several studies have demonstrated that Cluster of Differentiation 163 (CD163) is an essential receptor for PRRSV infection, and the SRCR5 domain of CD163 plays an important role in PRRSV infection. However, CD163 SRCR5 is still a large membrane protein domain, and the key regions within SRCR5 that directly mediate PRRSV infection need further clarification. Studies based on the crystal structure analysis of SRCR5 from different species have found that the Loop5-6 functional domain in SRCR5 may play a key role in PRRSV infection. However, the direct functional role of the Loop5-6 region in PRRSV infection requires further experiments and precise verification. Currently, there are no reports on whether the Loop5-6 region can form B cell epitopes and stimulate the body to produce specific antibodies. Furthermore, no monoclonal antibody has been developed to directly test and verify the Loop5-6 functional domain of the porcine CD163 molecule SRCR5.

[0003] Antigen immunization is the first step in monoclonal antibody preparation. Traditional monoclonal antibody preparation techniques primarily use heterologously expressed protein antigens. It's important to note that intact protein antigens, besides containing the target antigenic determinant (target epitope), also contain many non-target antigenic determinants and redundant parts. Considering the limitations of the host immune response, antibodies targeting non-target antigenic determinants and redundant parts typically constitute the majority, while the content of unique antibodies targeting the target epitope is low. To overcome the inherent limitations of intact protein antigens, using synthetic peptides to replace them is a strategy. Compared to natural or recombinant protein antigens, synthetic peptide antigens can accumulate dominant epitopes, aiming to better stimulate the body to produce antibodies. However, synthetic peptides containing large amounts of leucine, valine, phenylalanine, or isoleucine in some peptide sequences tend to form α-helical structures, while peptides with high glycine content can induce β-sheets. These synthetic peptides have high hydrophobicity, exhibit high aggregation, and have low solubility in water or organic solvents, leading to difficulties in processing, synthesis, and purification. More importantly, synthetic peptides or synthetic peptides conjugated with other compounds may not have the function of stimulating the body to produce specific antibodies, requiring precise validation for confirmation. Synthetic peptides are also relatively expensive.

[0004] Traditional monoclonal antibody preparation techniques use intact protein antigens as animal immunogens. Furthermore, the screening of hybridoma cells that secrete monoclonal antibodies is also based on intact protein antigens. The resulting monoclonal antibody then recognizes and reacts with this intact protein antigen. However, due to the presence of many redundant regions and unknown epitope determinants on the surface of the protein antigen, the specific epitope targeted by the selected monoclonal antibody is unknown. This presents a technical bottleneck in the identification and analysis of epitopes for monoclonal antibodies, requiring subsequent complex and costly epitope identification analysis. The identification experiments are costly and technically demanding, making them very difficult. Summary of the Invention

[0005] Purpose of the invention: In order to overcome the technical bottlenecks and limitations in the identification and analysis of antigenic epitopes of monoclonal antibodies, this invention uses the guest-carrying structural domain of the bacterial V-type secretion system to present target epitopes on the bacterial surface, and prepares target epitope expression vector bacteria for immunizing mice and target epitope expression vector bacteria for screening and detection of monoclonal antibodies, respectively.

[0006] Compared to recombinant expressed protein antigens and artificially synthesized antigenic peptides, the immunization vector bacteria in this invention can present a large number of target epitopes and can directly and effectively stimulate mice to produce antibodies against the target epitopes. At the same time, the immunization vector bacteria eliminate the purification steps of protein antigens and synthetic peptides, making them easy to produce on a large scale. No adjuvants are required during immunization, which reduces the cost of monoclonal antibody preparation and simplifies the monoclonal antibody preparation process.

[0007] This invention uses monoclonal antibodies to screen and detect the target epitope expression vector bacteria, which have the same target epitope as the immunization vector bacteria, so that they can jointly target the target epitope and prepare monoclonal antibodies against the same target epitope.

[0008] Given the potential key role of the Loop5-6 region of the SRCR5 domain in the recipient porcine CD163 molecule in PRRSV infection, this invention successfully verified the function of the Loop5-6 region in forming B cell epitopes and stimulating the body to produce specific antibodies. Furthermore, monoclonal antibodies targeting the Loop5-6 region epitope were prepared for further testing and validation. This invention has broad application prospects in studying the biological function of the Loop5-6 region, its role in PRRSV infection, and the treatment and prevention of PRRSV.

[0009] To prepare a monoclonal antibody targeting the key epitope in the Loop5-6 region of the SRCR5 domain of the porcine CD163 molecule, the technical problem to be solved by this invention is to provide a hybridoma cell line.

[0010] The technical problem to be solved by the present invention is to provide a monoclonal antibody 1F9E2.

[0011] Another technical problem to be solved by the present invention is the application of the monoclonal antibody in the preparation of drugs for the prevention or treatment of PRRS and in the preparation of kits for the detection of porcine CD163.

[0012] Technical Solution: To solve the above-mentioned technical problems, the present invention provides a hybridoma cell line 1F9E2, which is deposited at the China Center for Type Culture Collection (CCTCC), classified and named Hybridoma cell line 1F9E2, with a deposit date of June 17, 2025, accession number CCTCC NO: C2025190, and deposit address in Wuhan, China.

[0013] The present invention also includes a monoclonal antibody 1F9E2, which is secreted by the hybridoma cell line 1F9E2.

[0014] The monoclonal antibody 1F9E2 is obtained by injecting the hybridoma cell line 1F9E2 into the peritoneal cavity of mice, collecting the ascites fluid, centrifuging to remove cell debris and other precipitates, and then purifying the supernatant.

[0015] The present invention also includes the use of the hybridoma cell line 1F9E2 in the preparation of a drug for the prevention or treatment of porcine reproductive and respiratory syndrome (PRRS).

[0016] The present invention also includes the use of the monoclonal antibody 1F9E2 in the preparation of a medicament for the prevention or treatment of PRRS.

[0017] The present invention also includes the application of the monoclonal antibody 1F9E2 in the preparation of a kit for detecting porcine CD163.

[0018] The monoclonal antibody 1F9E2 is detected by binding to cells expressing CD163. Preferably, the cells include, but are not limited to, IPAM-CD163 and MARC-145 susceptible cells.

[0019] The present invention also provides that the amino acid sequence of the FP14 epitope in the Loop5-6 region of the SRCR5 domain of the recipient porcine CD163 molecule recognized by the monoclonal antibody 1F9E2 is FQCEGHESHLSLCP.

[0020] The present invention also provides the nucleotide sequence encoding the key epitope of FP14 as TTCCAGTGTGAGGGGCACGAGTCCCACCTTTCACTCTGCCCA.

[0021] The present invention also provides a recombinant expression vector, the nucleotide sequence of which is shown in SEQ ID NO.1 or SEQ ID NO.3.

[0022] The present invention also provides a recombinant strain or immunogen, which is obtained by introducing the recombinant expression vector as described in SEQ ID NO. 1 into a host bacterium.

[0023] The present invention also provides a recombinant strain or detection system, wherein the recombinant strain or detection system is obtained by introducing the recombinant expression vector as described in SEQ ID NO.3 into an inert vector bacterium S9H.

[0024] This invention also provides a method for preparing and screening monoclonal antibodies targeting the Loop5-6 region of the SRCR5 domain of the recipient porcine CD163 molecule that mediates key epitopes of PRRSV infection, comprising the following steps:

[0025] (1) B cell epitopes in the Loop5-6 region of the SRCR5 domain of porcine CD163 molecules were predicted using an online B cell epitope prediction website. Based on the prediction scores of amino acids, amino acids with higher scores were selected as preferred B cell epitopes and named FP14.

[0026] (2) Construction of immunogenic bacteria: The FP14 epitope was inserted into the MisL carrier domain of the Salmonella V-type secretion system and introduced into DH5α engineered bacteria. DH5α (pBR322-MisL-CD163-SRCR5-FP14) expressing the FP14 epitope on the bacterial cell surface will be used as immunogenic bacteria.

[0027] (3) Construction of screening and detection antigen bacteria: The coding gene of the FP14 epitope was inserted into the nucleotide sequence of the major subunit pegA of Salmonella peg fimbriae and introduced into the inert vector bacteria S9H. Through the fimbriae presentation system, the FP14 epitope can be functionally presented on the surface of S9H. S9H (pBR322-peg-CD163-SRCR5-FP14) was used as the detection antigen bacteria and S9H (pBR322-peg) was used as the control antigen bacteria. Only the S9H (pBR322-peg-CD163-SRCR5-FP14) detection antigen bacteria can specifically recognize the antibodies against the FP14 epitope in serum and produce an agglutination reaction, thereby qualitatively and quantitatively monitoring the specific antibodies against the FP14 epitope in the serum of immunized mice.

[0028] (4) Animal immunization: BALB / c mice were subcutaneously injected into the neck and back to immunize them with DH5α (pBR322-MisL-CD163-SRCR5-FP14) immunizing antigen bacteria at a dose of 1×10⁻⁶. 8 CFU / mouse, a second immunization was given 14 days after the first immunization, a third immunization was given 12 days after the second immunization, and on the third day after the third immunization, mice were given a booster immunization by intraperitoneal injection of DH5α (pBR322-MisL-CD163-SRCR5-FP14) immunizing antigen bacteria.

[0029] (5) Fusion of spleen cells and myeloma cells in immunized mice: spleen cells from boosted immunized mice were fused with myeloma cells SP / 20 in vitro.

[0030] (6) Screening of positive wells: Indirect ELISA was used to screen positive wells. When the OD of the antigen well was positive, the positive serum was detected. 450nm Value / Negative serum detection antigen well OD 450nm The test is valid when the value is ≥2.1; when the antigen detection OD of the cell supernatant is ≥2.1, the test is valid. 450nm Value - OD of control antigen wells in the supernatant of the cells to be tested 450nm If the value is greater than 0.2, the well is considered a positive well.

[0031] (7) Subcloning of hybridoma cell line: The positive wells that can secrete antibodies against the FP14 epitope obtained in step (6) were subcloned three times using the limiting dilution method until all single cell wells in the culture plate were detected as ELISA positive, and finally a hybridoma cell line 1F9E2 that can stably secrete antibodies against the FP14 epitope was obtained.

[0032] (8) Specificity verification of monoclonal antibody 1F9E2: Hybridoma cell line 1F9E2 was injected with 1×10 6 Eight-week-old BALB / c female mice were intraperitoneally injected with antibodies. Ascites fluid was collected to verify the binding of monoclonal antibody 1F9E2 to CD163-expressing cells (IPAM-CD163 cells, MARC-145 cells) and non-CD163-expressing cells (IPEC-J2 cells) by indirect immunofluorescence assay. The results showed that monoclonal antibody 1F9E2 could specifically recognize the CD163 receptor on IPAM-CD163 and MARC-145 cells, but not bind to IPEC-J2 cells.

[0033] (9) Functional verification of monoclonal antibody 1F9E2: Monoclonal antibody 1F9E2 was incubated on PRRSV-susceptible cells (IPAM-CD163 and MARC-145 cells), and the cells were infected with NADC30-like PRRSV and HP-PRRSV JXA1 at the same time. Virus blocking assay was performed. The results showed that monoclonal antibody 1F9E2 could inhibit the infection of IPAM-CD163 and MARC-145-susceptible cells by two PRRSV strains, NADC30-like PRRSV and HP-PRRSV JXA1, in a dose-dependent manner.

[0034] Beneficial Effects: This invention utilizes the guest-carrying domain of the bacterial V-type secretion system and bacterial fimbriae to amplify and present the target epitope on the bacterial surface, thus preparing immunogenic bacteria and detection antigen bacteria respectively. Compared to recombinant expressed protein antigens and artificially synthesized antigen peptides, the immunogenic bacteria of this invention can present the target epitope in large quantities and can directly and effectively stimulate mice to produce antibodies against the target epitope. Furthermore, the immunogenic bacteria eliminate the purification steps of protein antigens and synthetic peptides, facilitating large-scale production. No adjuvant is required during immunization, reducing the cost of monoclonal antibody preparation and simplifying the process. In addition, compared to monoclonal antibodies with unknown epitopes and functions screened during traditional monoclonal antibody preparation, the target epitope expression vector bacteria and immunization vector bacteria of this invention use the same target epitope as the immunogenic bacteria, jointly targeting the same epitope to prepare monoclonal antibodies against the same target epitope. Given the crucial role of the Loop5-6 region of the porcine CD163 receptor SRCR5 domain in PRRSV infection, this invention successfully verified the function of the Loop5-6 region in forming B cell epitopes and stimulating the body to produce specific antibodies. Furthermore, it successfully prepared monoclonal antibodies targeting the Loop5-6 region epitope, which have broad application prospects in studying the biological function of the Loop5-6 region, its role in PRRSV infection, and the treatment and prevention of PRRSV. Attached Figure Description

[0035] Figure 1 This image shows the identification of the DH5α (pBR322-MisL-CD163-SRCR5-FP14) recombinant bacteria. Lane M is the Trans2K plus II DNA Marker; Lane 1 is the negative control (template is double-distilled water ddH2O); Lane 2 is the amplification product of the DH5α (pBR322-MisL-CD163-SRCR5-FP14) recombinant bacteria; Lane 3 is the amplification product of the DH5α (pBR322-MisL-CD163-SRCR5-FP14) recombinant bacteria.

[0036] Figure 2 This image shows the identification of the S9H(pBR322-peg-CD163-SRCR5-FP14) recombinant bacteria. Lane M is the Trans2K DNA Marker; Lane 1 is the negative control (template is double-distilled water ddH2O); Lane 2 is the amplification product of the S9H(pBR322-peg) recombinant bacteria; Lane 3 is the amplification product of the S9H(pBR322-peg-CD163-SRCR5-FP14) recombinant bacteria.

[0037] Figure 3To monitor the production of FP14 epitope-specific antibodies in mice after immunization, five mice were able to produce specific antibodies against the FP14 epitope after immunization. On day 7 after the second immunization, the agglutination titer of the FP14 epitope-specific antibody in mouse #4 was 1:256. Therefore, mouse #4 was selected as the mouse for subsequent booster immunization and cell fusion experiments.

[0038] Figure 4 The image shows the indirect immunofluorescence results of monoclonal antibody 1F9E2 on IPAM-CD163 cells and MARC-145 cells. Under a fluorescence microscope, specific red fluorescence can be observed in the IPAM-CD163 cell experimental group and the MARC-145 cell experimental group, while no specific red fluorescence can be observed in the IPEC-J2 cell experimental group and the control group of the above three cell types.

[0039] Figure 5 The figure shows the results of the viral blocking assay of monoclonal antibody 1F9E2 against NADC30-like PRRSV and HP-PRRSV JXA1 in MARC-145 cells. Compared with the control group that was only infected with the virus, the number of genomes of NADC30-like PRRSV and HP-PRRSV JXA1 strains in MARC-145 cells was significantly reduced. Moreover, the inhibitory effect of the 20-fold dilution of monoclonal antibody 1F9E2 was stronger than that of the 100-fold dilution. When the dilution reached 200-fold, the inhibitory effect of monoclonal antibody 1F9E2 on the virus was not obvious.

[0040] Figure 6 The figure shows the results of the viral blocking assay of monoclonal antibody 1F9E2 against NADC30-Like PRRSV and HP-PRRSV JXA1 in IPAM-CD163 cells. The results of the viral blocking assay in IPAM-CD163 cells are similar to those in MARC-145 cells. Monoclonal antibody 1F9E2 can effectively inhibit the infection of IPAM-CD163 cells by NADC30-Like PRRSV and HP-PRRSV JXA1. Detailed Implementation

[0041] The embodiments of the present invention will be further described below with reference to examples. Obviously, the embodiments are intended to illustrate the present invention and should not be regarded as limiting the scope of the present invention. In addition to the specific methods, devices and materials used in the embodiments, based on the mastery of the prior art by those skilled in the art and the description of the present invention, any prior art methods, devices and materials similar to or equivalent to those described, devices and materials in the embodiments of the present invention can be used to implement the present invention.

[0042] Example 1: Construction of DH5α (pBR322-MisL-CD163-SRCR5-FP14) immunized recombinant bacteria

[0043] The amino acid sequence of porcine CD163 protein (GenBank accession number: NP_999141.1) was predicted using the B-cell epitope prediction website (https: / / www.iedb.org / ). Based on the amino acid score, the amino acid with the highest score in the CD163SRCR5 loop 5-6 region was selected as the preferred B-cell epitope and named FP14. (FP14 amino acid sequence: FQCEGHESHLSLCP, nucleotide sequence: TTCCAGTGTGAGGGGCACGAGTCCCACCTTTCACTCTGCCCA).

[0044] MisL is a type V secretion system of bacteria. Its passenger domain can exhibit functional peptides to the extracellular space during secretion. Therefore, the amino acid sequence of the passenger domain of the bacterial type V secretion system MisL protein was replaced with the FP14 epitope to construct a mouse immune recombinant bacterium DH5α (pBR322-MisL-CD163-SRCR5-FP14) that expresses the FP14 epitope. The B-cell epitopes in the MisL protein (GenBank accession number: CAR39455.1) of Salmonella Typhimurium strain 287 / 91 (GenBank accession number: AM933173.1) were analyzed using the B-cell epitope prediction website (https: / / www.iedb.org / ). The highly immunogenic epitopes were replaced with the FP14 epitope at the N-terminus 310-323aa of the MisL protein, with the replacement sequence: ASKAASYSKAPAGL. The replacement site in the misl gene was located at 928-969 bp, with the replacement sequence: GCCAGTAAGGCTGCATCCTATAGTAAAGCCCCTGCCGGTTTA. The recombinant expression vector pBR322-MisL-CD163-SRCR5-FP14 (SEQ ID NO.1) containing the chimeric gene misl-CD163-SRCR5-FP14 and the recombinant expression vector pBR322-MisL (SEQ ID NO.2) containing misl were synthesized by Beijing Qingke Biotechnology Co., Ltd. The synthesized pBR322-MisL-CD163-SRCR5-FP14 and pBR322-MisL plasmids were diluted to 100 ng / μL with enzyme-free water (Biosharp, catalog number: BL510B). The recombinant expression vectors pBR322-MisL-CD163-SRCR5-FP14 and pBR322-MisL were electroporated into DH5α competent cells (Shanghai Beyotime Biotechnology Co., Ltd., catalog number: D1031S) using an electroporator (Bio-Rad). The cells were then plated on solid medium containing 100 μg / mL ampicillin (Amp; Beijing Solarbio Science & Technology Co., Ltd., catalog number: A8180) for resistance selection. After incubation at 37℃ for 16 h, single colonies were picked from the plates and inoculated into a medium containing 100 μg / mL ampicillin. + After overnight incubation in LB liquid medium at 37°C and 200 rpm, the bacterial culture was subjected to PCR identification using identification primers to verify that the recombinant vector had been introduced into DH5α. The upstream primer misl-F: 5'-ATGCCAACTCCCCAAAATTACT-3', and the downstream primer misl-R: 5'-TCAGAAACTGTATTTCATCCCCAA-3'. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. The identification results are as follows: Figure 1As shown, the correctly identified recombinant bacteria were named DH5α(pBR322-MisL-CD163-SRCR5-FP14) and DH5α(pBR322-MisL), respectively.

[0045] To verify whether the DH5α(pBR322-MisL-CD163-SRCR5-FP14) recombinant bacteria could functionally express the FP14 epitope on their surface, overnight cultured DH5α(pBR322-MisL-CD163-SRCR5-FP14) and DH5α(pBR322-MisL) recombinant bacteria were centrifuged at 4000 rpm for 10 min, the supernatant was discarded, and the cells were resuspended in an equal volume of PBS (1×PBS instant soluble particles from Novizan dissolved in 1 L of ultrapure water, catalog number: G101). After washing twice, the cells were then resuspended with CD163 rabbit polyclonal antibody (Wuhan Boster Biological Engineering Co., Ltd., catalog number: [missing information]). A plate agglutination reaction was performed using A00812-1. The results showed that the recombinant bacteria DH5α (pBR322-MisL-CD163-SRCR5-FP14) only agglutinated with rabbit anti-CD163 polyclonal antibody, but did not react with serum from unimmunized healthy rabbits (prepared in our laboratory by collecting blood from the marginal ear vein of healthy rabbits, promoting coagulation, and centrifuging). The recombinant bacteria DH5α (pBR322-MisL) control did not react with either rabbit anti-CD163 polyclonal antibody or unimmunized rabbit serum, indicating that the FP14 epitope is functionally presented on the surface of the recombinant bacteria DH5α (pBR322-MisL-CD163-SRCR5-FP14).

[0046] Table 1. Verification of the presentation and expression of the FP14 epitope on the DH5α (pBR322-MisL-CD163-SRCR5-FP14) surface.

[0047]

[0048]

[0049] Note: "-" indicates no agglutinated particles were produced, which is negative; "+" indicates the presence of agglutinated particles, which is positive.

[0050] Example 2: Preparation and screening of monoclonal antibodies targeting the FP14 epitope of the key SRCR5 domain of the porcine CD163 receptor molecule.

[0051] 1. Construction of the detection system

[0052] To monitor the production of specific antibodies against the FP14 epitope in mice, the FP14 epitope was displayed on the surface of the inert vector bacterium S9H (patent number: ZL202010427735.8) developed in our laboratory using the same method as in Example 1. This constructed the detection recombinant bacterium S9H (pBR322-peg-CD163-SRCR5-FP14). The mouse immunization recombinant bacterium DH5α (pBR322-MisL-CD163-SRCR5-FP14) and the detection recombinant bacterium S9H (pBR322-peg-CD163-SRCR5-FP14) were identical only at the FP14 epitope. To construct the S9H(pBR322-peg-CD163-SRCR5-FP14) detection recombinant bacteria, the B-cell epitope prediction website (https: / / www.iedb.org / ) was first used to predict the major subunit pegA (position 1-177aa) of the peg operon of Salmonella pullorum CVCC526 (purchased from the China Institute of Veterinary Drug Control, stored in our laboratory, Yang Weifeng. Development and preliminary clinical application of anti-Salmonella PEG fimbriae monoclonal antibody [D]. Yangzhou University, 2016.). A highly immunogenic position in pegA was selected and replaced with the FP14 epitope. The replacement site was position 59-72aa from the N-terminus of the pegA protein, with the replacement sequence: DRLTDLNPGDIYTG. The replacement site was position 175-216bp in the pegA gene, with the replacement sequence: GATAGATTGACTGACTTAAACCCTGGCGATATATATACAGGA. The recombinant expression vector pBR322-peg-CD163-SRCR5-FP14 (SEQ ID NO.3) containing the chimeric gene peg-CD163-SRCR5-FP14 was synthesized by Beijing Qingke Biotechnology Co., Ltd. Simultaneously, Beijing Qingke Biotechnology Co., Ltd. synthesized a pair of identification primers targeting pegA: the upstream primer is pegA-F: 5′-ATGAAACGTTCACTTATTGCTGCT-3′; the downstream primer is pegA-R: 5′-TTAATCAGTTAATACCGTCATCGTCA-3′.

[0053] S9H cells, stored in cryovials at -80℃, were streaked onto LB agar plates. After overnight incubation at 37℃ with the plates inverted position, a single colony was picked and transferred to 4 mL of fresh LB medium. The plates were then incubated overnight at 37℃ with shaking at 220 rpm. After one generation, the bacterial culture was transferred to 40 mL of fresh LB medium at a volume ratio of 1:100. OD was then calculated. 600When the bacterial concentration was 0.4-0.6, the bacterial culture was incubated on ice for 30 min, centrifuged at 4000 rpm for 10 min at 4℃, and then resuspended in pre-chilled 10% glycerol (90 mL ultrapure water + 10 mL glycerol; glycerol purchased from Sinopharm Chemical Reagent Co., Ltd., catalog number: 10010618). The culture was centrifuged at 4℃, 4000 rpm for 10 min, and the cells were washed three times with 10% glycerol. Finally, each 4 mL of bacterial culture was resuspended in 40 μL of 10% glycerol, and 100 μL was aliquoted per vial to prepare S9H electroporation competent cells. The synthesized lyophilized plasmid was diluted to 100 ng / μL with enzyme-free water, and the recombinant expression vector pBR322-peg-CD163-SRCR5-FP14 was electroporated into S9H competent cells using an electroporator. The cells were then plated on solid medium containing 100 μg / mL ampicillin for resistance selection. After incubating upside down at 37°C for 16 hours, pick a single colony from the plate and inoculate it with 100 μg / mL of Amp. + After overnight incubation in LB liquid medium at 37°C and 200 rpm, the bacterial culture was subjected to PCR identification using identification primers to verify that the recombinant vector had been introduced into S9H. The identification results are as follows: Figure 2 As shown, the correctly identified recombinant bacteria were named S9H(pBR322-peg-CD163-SRCR5-FP14). After overnight incubation of both S9H(pBR322-peg-CD163-SRCR5-FP14) and S9H(pBR322-peg) (previously constructed in the laboratory, conserved neutralizing epitope QT7 of the major glycoprotein GP5 of North American porcine reproductive and respiratory syndrome virus envelope, nucleic acid molecule, expression vector, neutralizing antibody and its application, patent number: ZL202410695247.3), the bacteria were centrifuged at 4000 rpm for 10 min, the supernatant was discarded, and the bacteria were washed twice with PBS to adjust the bacterial concentration to 5 × 10⁻⁶. 9 CFU / mL, store at 4℃.

[0054] 2. Animal immunization and determination of antibody titers in immune serum

[0055] After overnight culture of DH5α (pBR-MisL-CD163-SRCR5-FP14) recombinant bacteria expressing the FP14 epitope, the supernatant was discarded after centrifugation at 4000 rpm for 10 min, and the bacteria were resuspended in an equal volume of PBS. After washing twice, the final bacterial concentration was adjusted to 1×10⁻⁶. 9CFU / mL. Five 6-week-old BALB / c mice (purchased from the Comparative Medical Laboratory of Experimental Animals, Yangzhou University) were immunized by subcutaneous injection of 100 μL of DH5α (pBR-MisL-CD163-SRCR5-FP14) recombinant bacteria at multiple sites on the nape of the neck. A second immunization was administered 14 days after the first, and a third immunization was administered 12 days after the second. Three days after the third immunization, the mice with the highest antibody titers were selected and intraperitoneally injected with 1×10 CFU / mL. 8 Boosting immunizations were performed using recombinant CFU containing DH5α (pBR-MisL-CD163-SRCR5-FP14). Blood was collected from immunized mice on day 7 after the first and second immunizations via the infraorbital venous plexus, and serum was separated. The serum was subjected to plate agglutination reactions with S9H (pBR322-peg-CD163-SRCR5-FP14) and S9H (pBR322-peg), respectively, to detect the levels of specific antibodies against the CD163 FP14 epitope in the immunized mice. The results are as follows: Figure 3 As shown, all five BALB / c mice immunized produced specific antibodies against the CD163 FP14 epitope. Among them, mouse #4 had the highest agglutination titer of specific antibody against the FP14 epitope in its serum on day 7 after the second immunization, at 1:256. Therefore, mouse #4 was selected as the mouse for subsequent booster immunization and cell fusion experiments.

[0056] 3. Cell fusion and positive well screening

[0057] (1) Preparation of SP2 / 0 cells

[0058] Two weeks prior to fusion, SP2 / 0 cells (preserved in our laboratory, Xia Pengpeng. Study on the specific protein receptor of enterotoxigenic Escherichia coli (ETEC) F4 fimbriae—porcine aminopeptidase N [D]. Yangzhou University, 2016.) were revived, their condition adjusted, and cultured to ensure that SP2 / 0 cells were in the logarithmic growth phase, in good condition, and with a viable cell count higher than 95% at fusion. On the day of fusion, cells were gently blown off in DMEM basal medium (gibco, catalog number: C11995500BT), collected in centrifuge tubes, centrifuged at 1000 rpm for 10 min, the supernatant was discarded, and the cells were resuspended in an appropriate amount of culture medium. After centrifugation and washing once, the cells were finally resuspended in 10 mL of DMEM basal medium to prepare a cell suspension. Cell counting was performed using a hemocytometer (Shanghai Qiujing, catalog number: XB-K-25).

[0059] (2) Preparation of feeder cells

[0060] On the second day after the booster immunization of the mice in step 2, another unimmunized BALB / c mouse was purchased, its eyeballs were removed, and blood was collected. The serum was then used as a negative control for antibody testing. Simultaneously, the mice were euthanized by cervical dislocation, immersed in 75% alcohol for 5 minutes, and fixed on a dissection board. The abdominal skin was lifted from the posterior abdomen using sterile scissors and forceps to expose the peritoneum, which was then disinfected with an alcohol swab. 8 mL of DMEM basal culture medium was injected into the peritoneal cavity using a syringe, taking care to avoid penetrating the intestines and causing contamination. The syringe was held in place with the needle in the peritoneal cavity; the abdomen was gently massaged with an alcohol swab for 1 minute with the left hand, and then the injected culture medium was aspirated. The cells were centrifuged at 1000 rpm for 10 minutes, and the supernatant was discarded. The cell pellet was resuspended in HAT medium (DMEM basal culture medium supplemented with 10% fetal bovine serum and 2% 50× HAT; fetal bovine serum: Nanjing Shenghang Biotechnology Co., Ltd., catalog number BC-SE-FBS06; HAT: Gibco, catalog number 21060017) to a cell concentration of 2×10⁶ cells / mL. 5 / mL. Add 100μL of the above cell suspension to each well of a 96-well plate (Nanjing Novizan Biotechnology Co., Ltd., catalog number: 7E0181K4), and then incubate at 37°C in a 6% CO2 incubator.

[0061] (3) Preparation of spleen B lymphocytes from immunized mice

[0062] On day 3 of booster immunization of mice #4, blood was collected by enucleating the eyeballs of the mice. The serum was separated and used as a positive control serum for antibody testing. After cervical dislocation and euthanasia, the mice were immersed in 75% alcohol for 5 minutes, fixed on a dissection board, and the abdominal cavity was opened to expose the spleen. The spleen was aseptically removed in a laminar flow hood and placed in a petri dish containing 10 mL of HAT medium. The spleen was gently washed and the surrounding connective tissue was removed. After transferring to a new petri dish, the spleen cells were squeezed into the HAT medium and pipetted to prepare a single-cell suspension. The cell suspension was centrifuged at 1000 rpm for 5 minutes, washed twice with HAT medium, and resuspended in HAT medium for cell counting and subsequent use.

[0063] (4) Cell fusion

[0064] The prepared spleen cells and SP2 / 0 cells were added to a fusion tube at a ratio of 5:1 and mixed thoroughly. The mixture was centrifuged at 1000 rpm for 5 min, and the supernatant was discarded. The bottom of the fusion tube was gently tapped to loosen and evenly distribute the cell pellet. 1 mL of preheated 37°C polyethylene glycol PEG1500 (Roche, catalog number: 10783641001) was added slowly dropwise over 45 seconds, tapping the bottom of the tube continuously for 90 seconds, then the fusion process was terminated. DMEM basal medium was then added to a final volume of 30 mL, starting slowly and gradually increasing the volume. The fusion tube was sealed and incubated at 37°C for 30 min. After centrifugation at 1000 rpm for 5 min, the supernatant was discarded. The cell pellet was gently resuspended in 5 mL of HAT medium, and HAT medium was added to a final volume of 40 mL. The cell suspension was added to 100 μL / well of a 96-well plate containing feeder cells and then incubated at 37°C with 6% CO2. On day 5 after fusion, 100 μL of HAT medium was added to each well. After 10 days, all the medium in the 96-well plate was aspirated, and 200 μL of HT complete medium (DMEM basal medium with 10% fetal bovine serum and 1% 100× HT; HT: Gibco, catalog number 11067030) was added to each well. The growth of hybridoma cells was observed. When the cell culture supernatant turned yellow, the cell culture supernatant was aspirated for antibody detection by ELISA and agglutination assay.

[0065] (6) Screening of positive wells for hybridoma cells

[0066] Indirect ELISA was used for rapid screening of cell culture wells that secrete specific antibodies against the FP14 epitope. The 96-well plates coated with both detection and control antigens used in the indirect ELISA assay were prepared in our laboratory. The specific steps are as follows:

[0067] ① Antigen coating: S9H(pBR322-peg-CD163-SRCR5-FP14) was used as the detection antigen, and S9H(pBR322-peg) was used as the control antigen. The detection antigen and control antigen were mixed with carbonate buffer (0.73g sodium bicarbonate, 0.4g sodium carbonate, and 250mL ultrapure water; sodium bicarbonate and sodium carbonate were purchased from Sinopharm Chemical Reagent Co., Ltd., catalog numbers 10018960 and 10019260, respectively) at a ratio of 1:10. Then, 50μL / well of S9H(pBR322-peg-CD163-SRCR5-FP14) detection antigen and S9H(pBR322-peg) control antigen were added to two 96-well plates and dried at 40℃.

[0068] ② After drying, add 100 μL of pre-cooled methanol (Sinopharm Chemical Reagent Co., Ltd., catalog number: 10014118) at -20℃ to each well, fix at room temperature for 15 min, wash with PBS 3 times for 5 min each time, and pat dry.

[0069] ③ Add 150 μL of 5% BSA blocking buffer (Beijing Solarbio Science & Technology Co., Ltd., product number: A8020) to each well, block overnight at 4℃, then wash 3 times with PBST (PBS with 0.5% Tween-20 added, Tween-20 purchased from Beijing Solarbio Science & Technology Co., Ltd., product number: T8220), 5 min each time, and pat dry;

[0070] ④ Coat each well of the two 96-well plates with the antigen bacteria to be detected and the control antigen bacteria. Add 100 μL of the supernatant of the hybridoma cell culture medium to be tested to each well. At the same time, set up a positive serum control (the serum of mouse No. 4 prepared in step 3.(3) preparation of immune mouse lymphocytes) and a negative serum control (prepared in step 3(2) preparation of feeder cells). Dilute the serum with PBS at 1:200 and add 100 μL to each well. Incubate at 37°C for 2 h. Wash with PBST 3 times for 5 min each time and pat dry.

[0071] ⑤ Add 100 μL of HRP-labeled goat anti-mouse IgG secondary antibody (Beijing Bio-Sen Biotechnology Co., Ltd., catalog number: bs-0296G-HRP) diluted 1:20000 with PBS to each well, incubate at 37℃ for 1 h, wash 3 times with PBST for 5 min each time, and pat dry.

[0072] ⑥ Add 100 μL of TMB chromogenic solution (Shanghai Beyotime Biotechnology Co., Ltd., catalog number: P0209-500ml) to each well of a 96-well plate, incubate at 37°C in the dark for 30 min, then add 50 μL of ELISA stop solution (Absin (Shanghai) Biotechnology Co., Ltd., catalog number: abs9472). Use a microplate reader (BioTek) to read the OD values ​​of each well in the 96-well plate. 450nm value.

[0073] ⑦ Interpretation of ELISA results: When the OD of the antigen well in the positive serum test is... 450nm Value / Negative serum detection antigen well OD 450nm The test is valid when the value is ≥2.1; when the antigen detection OD of the cell supernatant is ≥2.1, the test is valid. 450nm Value - OD of control antigen wells in the supernatant of the cells to be tested 450nm If the value is greater than 0.2, the well is considered a positive well.

[0074] Finally, a primitive hybridoma cell line was selected and named 1F9. The indirect ELISA results of the 1F9 hybridoma cell supernatant are shown in the table below:

[0075] Table 2. Indirect ELISA results of 1F9 positive hybridoma cell supernatant

[0076]

[0077] 4. Cell subcloning

[0078] Three subclonings were performed on the positive cell line 1F9, which produced specific antibodies against the FP14 epitope, using the limiting dilution method. The specific steps were as follows: the hybridoma cells to be cloned were thoroughly mixed and diluted with HT complete medium to adjust the cell concentration to 10 cells / mL; the hybridoma cells were aliquoted into 96-well plates at 100 μL / well, with one hybridoma cell per well; the cells were cultured at 37°C and 6% CO2 for 7 days. After the appearance of visible cell clusters in the cell wells, indirect ELISA was used for identification until all single cell wells in the culture plate tested positive for ELISA, and finally a hybridoma cell line 1F9E2 that could stably secrete antibodies against the FP14 epitope was obtained. The hybridoma cell line 1F9E2 was deposited at the China Center for Type Culture Collection (CCTCC), and its classification name is Hybridoma cell line 1F9E2. The deposit date is June 17, 2025, the accession number is CCTCC NO: C2025190, and the deposit address is Wuhan, China.

[0079] 5. Preparation of monoclonal antibodies against ascites fluid from hybridoma cell line 1F9E2

[0080] Eight-week-old BALB / c female mice were intraperitoneally injected with 0.3 mL of liquid paraffin per mouse. Seven days later, they were intraperitoneally injected with 1F9E2 hybridoma cell line at a cell count of 1×10⁻⁶. 6 Cells / mouse, injection volume 0.1 mL, continuous monitoring started 6 days later. When the mouse abdomen swelled and felt tense to the touch, ascites fluid was collected using a syringe, centrifuged at 4000 r / min for 10 min, and the supernatant was separated to obtain the ascites monoclonal antibody of hybridoma cell line 1F9E2.

[0081] Example 3: Specificity verification of monoclonal antibodies targeting the FP14 epitope of the key SRCR5 domain of the porcine CD163 receptor molecule.

[0082] IPAM-CD163 cells were kindly donated by Associate Professor Peng Jun of Shandong Agricultural University. These cells were created by integrating the CD163 gene, amplified from PAM cells (primary porcine alveolar macrophages), into 3D4 / 21 cells (an immortalized cell line created by transfecting primary PAM cells with a plasmid carrying the SV40 large T antigen, but which lost its susceptibility to PRRSV) using a lentiviral expression system, thus obtaining a PRRSV-susceptible cell line stably expressing porcine CD163 (VetMicrobiol. 2020; 244:108690.). MARC-145 cells were kindly donated by Yangzhou Youbang Biopharmaceutical Co., Ltd., although they are monkey-derived cells... However, monkey-derived CD163 and porcine-derived CD163 share the same FP14 epitope, thus they can also bind to monoclonal antibodies targeting the FP14 epitope. Simultaneously, since CD163 is primarily expressed in monocytes and macrophages, IPEC-J2 porcine small intestinal epithelial cells (preserved in our laboratory, Xia Pengpeng. Study on the specific protein receptor of enterotoxigenic Escherichia coli (ETEC) F4 fimbriae—porcine aminopeptidase N [D]. Yangzhou University, 2016.) were used as control cells. Indirect immunofluorescence was used to verify the specific binding of monoclonal antibodies targeting the FP14 epitope to CD163 on IPEC-CD163 and MARC-145 cells. The specific steps are as follows:

[0083] 1. One day in advance, seed healthy IPAM-CD163 cells, MARC-145 cells, and IPEC-J2 cells into 24-well plates (the cell culture medium used for all three cell types is DMEM basal medium supplemented with 10% fetal bovine serum. In addition, IPAM-CD163 cells require the addition of 0.4 μg / mL puromycin hydrochloride, Shanghai Aladdin Biochemical Technology Co., Ltd., catalog number: p113126). After the cells grow to a monolayer, discard the supernatant culture medium and wash three times with PBS for 5 min each time.

[0084] 2. Add 200 μL of 4% paraformaldehyde (Biosharp, catalog number: BL539A) and fix at room temperature for 10 min, then wash three times with PBS for 5 min each time;

[0085] 3. Add 200 μL of 5% BSA blocking solution, block at 37°C for 1 h, and wash three times with PBST for 5 min each time;

[0086] 4. Add 200 μL of 1F9E2 ascites antibody (diluted 1:100 with PBS) to each well, incubate overnight at 4°C, and wash three times with PBS for 5 min each time;

[0087] 5. Prepare the secondary antibody working solution (goat anti-mouse secondary antibody, DyLight594 labeled, red fluorescence, diluted 1:500 with PBS, purchased from Boster Biological Engineering Co., Ltd., catalog number: BA1141) in the dark, add 200 μL to each well, incubate at 37℃ in the dark for 1 h, wash 3 times with PBST for 5 min each time;

[0088] 6. Add 100 μL of DAPI dye (Shanghai Beyotime Biotechnology Co., Ltd., catalog number: P0131-25 ml) in the dark, stain at 37℃ in the dark for 10 min, wash 3 times with PBST in the dark, 5 min each time;

[0089] 7. Observe the results using an inverted fluorescence microscope (OLYMPUS) in the dark.

[0090] The results are as follows Figure 4 As shown, under a fluorescence microscope, specific red fluorescence was observed in the IPAM-CD163 and MARC-145 cell experimental groups, while no specific red fluorescence was observed in the IPEC-J2 cell experimental group and the control groups of the above three cell types. These results indicate that the monoclonal antibody 1F9E2 can specifically recognize the CD163 receptor on IPAM-CD163 and MARC-145 cells.

[0091] Example 4: Functional validation of a monoclonal antibody targeting the FP14 epitope of the key SRCR5 domain of the porcine CD163 receptor molecule.

[0092] To investigate whether the prepared monoclonal antibody 1F9E2 targeting the FP14 epitope could block the binding of PRRSV to CD163 and thus inhibit the infection of susceptible cells (IPAM-CD163 cells and MARC-145 cells) by various PRRSV strains, a viral blocking assay was performed. The specific steps are as follows:

[0093] 1. One day in advance, seed healthy MARC-145 cells and IPAM-CD163 cells into 24-well plates. Once the cells have grown into a monolayer, dilute the 1F9E2 ascites antibody with an agglutination titer of 1:2048 20-fold, 100-fold, and 200-fold with DMEM basal medium and maintenance medium (DMEM basal medium + 2% fetal bovine serum), respectively. Use the African swine fever p12 protein monoclonal antibody (patent number: ZL202311372834.0) with an agglutination titer of 1:2048 as an irrelevant antibody control. Treat the African swine fever p12 protein monoclonal antibody in the same way. Store the dilutions of both antibodies at 4°C for later use.

[0094] 2. Discard the supernatant from the 24-well cell plate and add 0.5 mL of 1F9E2 ascites antibody, p12 monoclonal antibody diluted with DMEM basal medium at different concentrations as experimental group, irrelevant antibody control group and virus-only control group, respectively. Incubate at 37°C for 1 h.

[0095] 3. Add 100 TCID to each of the above groups. 50 The NADC30-like PRRSV (a gift from Huaweite (Jiangsu) Biopharmaceutical Co., Ltd.) and HP-PRRSV JXA1 (a gift from Yangzhou Youbang Biopharmaceutical Co., Ltd.) were incubated at 37°C for 1 hour.

[0096] 4. Discard the supernatant and add 0.5 mL of 1F9E2 ascites antibody, p12 monoclonal antibody and maintenance medium diluted with maintenance medium to each of the above groups. Incubate at 37°C for 12 h and 24 h respectively.

[0097] 5. Discard the supernatant, add 0.5 mL of TRNzol reagent (Tiangen Biotech (Beijing) Co., Ltd., catalog number: DP424) to each well to lyse the cells, take 150 μL of cell lysate to extract total RNA, and perform RT-qPCR according to the method in the reference (Transbound EmergDis.2019Nov;66(6):2271-2278.) to detect the PRRSV genome copy number.

[0098] RT-qPCR results showed that after incubation with 20-fold and 100-fold diluted monoclonal antibody 1F9E2 targeting the FP14 epitope before, during, and after viral inoculation, Figure 5As shown, compared with the control group that was only exposed to the virus, the number of genomes of NADC30-like PRRSV and HP-PRRSV JXA1 strains was significantly reduced in MARC-145 cells, and the 20-fold dilution of 1F9E2 monoclonal antibody had a stronger antiviral effect than the 100-fold dilution. At 12 hpi (hours post-infection), the 20-fold and 100-fold dilutions of ascites antibody 1F9E2 showed antiviral inhibition rates of 98.31%, 76.37%, 98.10%, and 84.63% against NADC30-like PRRSV and HP-PRRSV JXA1 strains, respectively, on MARC-145 cells, and the antiviral inhibition rates at 24 hpi were 95.93% and 75.90%, and 95.19% and 75.49%, respectively. When the dilution factor reached 200-fold, the 1F9E2 monoclonal antibody dilution showed no significant inhibitory effect on NADC30-like PRRSV and HP-PRRSV JXA1 strains. Using an unrelated ascites antibody (p12 protein monoclonal antibody) dilution as a control, and with the same incubation stage and time, it did not significantly reduce the genome size of NADC30-like PRRSV and HP-PRRSV JXA1 strains in MARC-145 cells compared to the control group that only received the virus.

[0099] like Figure 6As shown, the results in IPAM-CD163 cells were similar to those in MARC-145 cells in inhibiting PRRSV infection. Compared with the control group that was only infected with the virus, the 20-fold and 100-fold dilutions of 1F9E2 monoclonal antibody significantly inhibited the infection of IPAM-CD163 cells with NADC30-like PRRSV and HP-PRRSV JXA1 strains. At 12 hpi, the virus inhibition rates of 20-fold and 100-fold dilutions of 1F9E2 ascites antibody against NADC30-like PRRSV and HP-PRRSV JXA1 strains in IPAM-CD163 cells were 97.76% and 85.37%, and 98.28% and 81.20%, respectively, and the virus inhibition rates at 24 hpi were 92.71% and 76.66%, and 97.50% and 82.09%, respectively. However, a 200-fold dilution of the 1F9E2 monoclonal antibody or an unrelated ascites antibody dilution did not significantly affect the infection of IPAM-CD163 cells by NADC30-like PRRSV and HP-PRRSV JXA1 strains. These results indicate that the prepared monoclonal antibody 1F9E2, targeting the FP14 epitope of the porcine CD163-binding domain SRCR5 of the PRRSV receptor, can dose-dependently inhibit the infection of IPAM-CD163 and MARC-145 susceptible cells by both NADC30-like PRRSV and HP-PRRSV JXA1 PRRSV strains.

[0100] In summary, this invention successfully prepared a 1F9E2 monoclonal antibody targeting the FP14 key epitope mediating PRRSV infection in the Loop5-6 region of the porcine CD163 SRCR5 domain, verifying the function of the Loop5-6 region in forming a B-cell epitope and generating specific antibodies. The prepared monoclonal antibody exhibits excellent specificity; indirect immunofluorescence assays showed that the 1F9E2 monoclonal antibody binds only to IPAM-CD163 and MARC-145 cells expressing CD163, but not to IPEC-J2 cells not expressing CD163. Virus blocking assays using ascites antibodies demonstrated that the 1F9E2 monoclonal antibody effectively inhibited NADC30-like PRRSV and HP-PRRSV JXA1 infection of susceptible MARC-145 and IPAM-CD163 cells. Monoclonal antibodies targeting the FP14 key epitope mediating PRRSV infection have potential applications in PRRSV antibody therapy and prevention.

Claims

1. A hybridoma cell line 1F9E2, characterized in that, The hybridoma cell line 1F9E2 is deposited at the China Center for Type Culture Collection (CCTCC), and its classification name is Hybridoma cell line 1F9E2. The deposit date is June 17, 2025, and the accession number is CCTCC NO: C2025190.

2. A monoclonal antibody 1F9E2, characterized in that, The monoclonal antibody 1F9E2 is secreted by the hybridoma cell line 1F9E2 described in claim 1.

3. The monoclonal antibody 1F9E2 according to claim 2, characterized in that, The monoclonal antibody 1F9E2 is obtained by injecting the hybridoma cell line 1F9E2 into the peritoneal cavity of mice, collecting the ascites fluid, centrifuging to remove cell debris and other precipitates, and then purifying the supernatant.

4. A recombinant expression vector, characterized in that, The nucleotide sequence of the recombinant expression vector is shown in SEQ ID NO.1 or SEQ ID NO.

3.

5. A recombinant bacterial strain or immunogen, characterized in that, The recombinant strain or immunogen is obtained by introducing the recombinant expression vector as described in claim 4, such as SEQ ID NO.1, into a host bacterium.

6. A recombinant bacterial strain or detection system, characterized in that, The recombinant strain or detection system is obtained by introducing the recombinant expression vector as described in claim 4, such as SEQ ID NO.3, into an inert vector bacterium S9H.

7. The use of the hybridoma cell line 1F9E2 according to claim 1 in the preparation of a medicament for the prevention or treatment of porcine reproductive and respiratory syndrome.

8. The use of the monoclonal antibody 1F9E2 according to claim 2 or 3 in the preparation of a medicament for the prevention or treatment of porcine reproductive and respiratory syndrome.

9. The use of the monoclonal antibody 1F9E2 according to claim 2 or 3 in the preparation of a kit for detecting porcine CD163.

10. The application according to claim 9, characterized in that, The monoclonal antibody 1F9E2 was detected by binding to cells expressing CD163.

Images