Sugarcane endogenous U6 promoter and application thereof
By replacing the rice U6 promoter with the sugarcane endogenous U6 promoter ScU6-29, ScU6-23, or ScU6-48, the efficiency of sugarcane gene editing was improved, the species limitation problem was solved, and the efficient application of various gene editing tools was realized, thus promoting the progress of sugarcane breeding and gene function research.
Patent Information
- Application Number
- CN202511034315.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-25
- Publication Date
- 2025-11-14
AI Technical Summary
Existing sugarcane gene editing vectors mostly utilize the rice U6 promoter to drive the expression of sgRNA, which is species-restricted, resulting in low sugarcane gene editing efficiency and making it difficult to meet the needs of breeding and gene function research.
Provide sugarcane endogenous U6 promoters ScU6-29, ScU6-23, or ScU6-48 to replace the rice U6 promoter in existing vectors, thereby driving sgRNA expression and improving gene editing efficiency.
It significantly improves the efficiency of sugarcane gene editing and is applicable to a variety of gene editing tools, such as base editing, AFID small fragment deletion system and CRISPR/Cas9, thus broadening the application scope of sugarcane gene editing and promoting the breeding process.
Smart Images

Figure CN120944880A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene editing technology, specifically to a sugarcane endogenous U6 promoter and its applications. Background Technology
[0002] Sugarcane is an important sugar crop and energy source, accounting for approximately 80% of the world's sugar and 40% of its ethanol production. However, most existing sugarcane cultivars are derived from hybrids of the ancestral species *Gesellus chinensis* and *Gaogui*, resulting in allologous aneuploids obtained through multiple rounds of crosses. These aneuploids have extremely complex genomes, approximately 8-12 ploids, and are difficult to flower. Furthermore, they result in large genetic segregation populations, requiring a massive amount of breeding work and proceeding slowly, making it difficult to meet my country's needs for sugarcane-related traits. Therefore, there is an urgent need to provide new sugarcane breeding strategies to obtain new sugarcane germplasm with superior qualities such as high yield, stress resistance, drought resistance, and high sugar content.
[0003] Crop breeding has evolved from domestication and selection, genetic breeding, and molecular breeding to precision breeding, which currently uses gene editing as the main technology. Gene editing can design a gRNA in different conserved regions of the target gene to simultaneously edit multiple copies, bringing revolutionary changes to the breeding of polyploid crops, including hexaploid wheat. However, due to the highly complex genome of sugarcane, there is still a lack of efficient genetic manipulation systems and efficient gene editing vectors, resulting in a generally low gene editing efficiency, which greatly restricts the progress of sugarcane gene function research and bio-breeding using gene editing technology.
[0004] The U6 promoter is a type III promoter that binds to eukaryotic RNA polymerase III. It is characterized by its high efficiency in driving the expression of short RNAs (such as shRNA and sgRNA). Using the U6 promoter to drive sgRNA expression is currently widely used in gene editing and is a key component of gene editing vectors; the expression level of sgRNA significantly affects gene editing efficiency. However, the U6 promoter exhibits species-specificity; using the plant's own endogenous U6 promoter to transform the species itself or closely related species yields higher gene editing efficiency. Currently, sugarcane gene editing vectors primarily utilize the rice U6 promoter to drive sgRNA expression, which presents a certain species limitation, resulting in lower gene editing efficiency for sugarcane editing vectors using the rice U6 promoter. Summary of the Invention
[0005] The purpose of this invention is to overcome the problem that existing sugarcane gene editing vectors mostly utilize rice U6 promoter to drive the expression of sgRNA, which has certain species limitations and leads to low gene editing efficiency of sugarcane editing vectors using rice U6 promoter. This invention provides a sugarcane endogenous U6 promoter that can improve the efficiency of sugarcane gene editing and its application.
[0006] To achieve the above objectives, the present invention provides a sugarcane endogenous U6 promoter, wherein the sugarcane endogenous U6 promoter is ScU6-29, ScU6-23 or ScU6-48, wherein the nucleotide sequence of ScU6-29 is shown in SEQ ID NO.2, the nucleotide sequence of ScU6-23 is shown in SEQ ID NO.3, and the nucleotide sequence of ScU6-48 is shown in SEQ ID NO.4.
[0007] The second aspect of this invention provides the application of the sugarcane endogenous U6 promoter as described above in improving the efficiency of sugarcane gene editing.
[0008] Preferably, the sugarcane editing uses any of the following gene editing tools: (1) Base editing; (2) Small fragment deletion system; (3) CRISPR / Cas9.
[0009] Preferably, the base editing is performed using the base editing vector BE3.
[0010] Preferably, the CRISPR / Cas9 uses the PHUE411 editing vector as a backbone, replaces the original sgRNA promoter with the sugarcane endogenous U6 promoter, and retains the original ubi promoter to drive Cas9 expression.
[0011] A third aspect of the present invention provides a sugarcane gene editing vector, wherein the promoter of the sugarcane gene editing vector is ScU6-29, ScU6-23 or ScU6-48, wherein the nucleotide sequence of ScU6-29 is shown in SEQ ID NO.2, the nucleotide sequence of ScU6-23 is shown in SEQ ID NO.3, and the nucleotide sequence of ScU6-48 is shown in SEQ ID NO.4.
[0012] The fourth aspect of this invention provides the application of the sugarcane endogenous U6 promoter and the sugarcane gene editing vector described above in sugarcane gene editing.
[0013] The fifth aspect of this invention provides the application of the sugarcane endogenous U6 promoter and the sugarcane gene editing vector described above in sugarcane breeding technology.
[0014] The sixth aspect of this invention provides the application of the sugarcane endogenous U6 promoter and the sugarcane gene editing vector described above in sugarcane gene function research.
[0015] The seventh aspect of this invention provides the application of the sugarcane endogenous U6 promoter and the sugarcane gene editing vector as described above in sugarcane gene genetic transformation.
[0016] This invention provides an endogenous U6 promoter for sugarcane, specifically ScU6-29 (SEQ ID NO. 2), ScU6-23 (SEQ ID NO. 3), or ScU6-48 (SEQ ID NO. 4). Compared to existing U6 promoters used for sugarcane gene editing (e.g., the rice U6 promoter with the sequence shown in SEQ ID NO. 1), this endogenous sugarcane U6 promoter significantly improves sugarcane gene editing efficiency. The sugarcane endogenous U6 promoter described in this invention can improve the efficiency of various gene editing tools (including base editing, the AFID small fragment deletion system, and CRISPR / Cas9), thereby meeting diverse needs for sugarcane gene editing. It has a wide range of applications, provides a theoretical basis for the subsequent optimization of sugarcane gene editing vectors, and greatly accelerates the sugarcane breeding process and the cultivation of high-quality new germplasm. Attached Figure Description
[0017] Figure 1 This is the sugarcane endogenous U6 promoter phylogenetic tree described in this invention; Figure 2 This is a schematic diagram of the gene editing vector V1 in Embodiment 1 of the present invention; Figure 3 This is a schematic diagram of the gene editing vector V3 in Embodiment 1 of the present invention; Figure 4 This is a schematic diagram of the base editing vector BE3 in Example 2 of the present invention; Figure 5 This is a bar chart showing the efficiency of sgRNA base editing driven by the sugarcane endogenous U6 promoter in Example 2 of the present invention. Figure 6 This is a sequence comparison diagram of the sugarcane endogenous U6 promoter and the OsU6 sequence in Embodiment 2 of the present invention; Figure 7 This is a schematic diagram of the small fragment deletion gene editing tool (AFID) in Embodiment 3 of the present invention; Figure 8 This is a bar chart showing the efficiency of sgRNA AFID editing driven by the sugarcane endogenous U6 promoter in Example 3 of the present invention. Figure 9 This is a schematic diagram of the PHUE411 editing vector and CRISPR / Cas9 in Embodiment 4 of the present invention; Figure 10 This is a bar chart showing the efficiency of sugarcane endogenous U6 promoter-driven sgRNA CRISPR / Cas9 editing in Example 4 of the present invention. Detailed Implementation
[0018] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the scope of the invention.
[0019] The endpoints and any values of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of the various ranges, the endpoint values of the various ranges and individual point values, and individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.
[0020] This invention provides a sugarcane endogenous U6 promoter, wherein the sugarcane endogenous U6 promoter is ScU6-29, ScU6-23 or ScU6-48, wherein the nucleotide sequence of ScU6-29 is shown in SEQ ID NO.2, the nucleotide sequence of ScU6-23 is shown in SEQ ID NO.3, and the nucleotide sequence of ScU6-48 is shown in SEQ ID NO.4.
[0021] The sugarcane endogenous U6 promoter described in this invention is derived from the sugarcane genome and can improve the sugarcane gene editing efficiency compared with existing rice U6 promoters (such as the rice OsU6 promoter, whose nucleotide sequence is shown in SEQ ID NO.1).
[0022] In a preferred embodiment, the sugarcane endogenous U6 promoter is ScU6-29, which is more efficient at editing sugarcane genes.
[0023] The sequence of OsU6 (SEQ ID NO.1) is shown below: GTCTCTTCGGAGACATCCGATAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCACAAATCGAGAAATGGTCCAAATTTTTTG.
[0024] The sequence of ScU6-29 (SEQ ID NO.2) is shown below: TAGGATTTTTGTATATATATAAATTTAGGAGGAGTCTAACATCTTACATGTAATCTTAGTTGAGTAGGAGTCTTACTTATATCATACGCGAAAATTTTGCCTCTTTATTATTAGGTATAGATACCACGAATATACGTTCCTGTTATTTTTCTCGGTGACTCTTTTTTCTATTGAGTTAATTAATGTATAAATGTAATTTATAGGTCGCTAGTAGGCTTGTTCATTGTGCATTTGGCTCTAATAATGCGTCAAAGCGAAGGACAGCACGTCACAAAACGGGCCTGCAATCTTCCAACAGAAAACACGAAGCCCGCTGTGCTGTTTCGCGTGATAGCTGGGCCGCGCTAAAGGATCCAGCCCACGTGGCGTGGCGTCGTTGCGAGCTTGCGGCTTGTGGCCTTGCGAGGAAGGGAACGAGCGACGAGCTCGGAGTTTAGTACCAAACCGGCTAGCGAACGACGCAAACACCAGCTTATAAGCTCCGCCGTGGCCACCGCAAC。
[0025] The sequence of ScU6-23 (SEQ ID NO.3) is shown below: TTAGGATTTTTGTATATATATAAATTTAGGAGGAGTCTAACATTTTACATGTAATCTTAGTTGAGTAGGAGTCTTACTTACATCTTGCGTGAAAATTTTGCCTCTTTATTATTAGGTATAGATACCAGGAATATACGTTCCTGTTATTTTTCTCGGTGACTCTTTTTTTATTGAGTTAATTAATGTATAAATGTAATTTATAGGTCGCTAGTAGGCTTGTTCATTGTGCATTTGGCTCTAATAATGCGTCAAAGCGAAGGACAGCACGTCACAAAACGGGCCTGCAATCTTCCAACAGAAAACACGAAGCCCGCTGTGCTGTTTCGCGTGATAGCTGGGCCGCGCTAAAGGATCCAGCCCACGTGGCGTGGCGTCGTTGCGAGCTTGCGGCTTGTGGCCTTGCGAGGAAGGGAACGAGCGACGAGCTCGGAGTTTAGTACCAAACCGGCTAGCGAACGACGCAAACACCAGCTTATAAGCTCCGCCGTGGCCACCGTAAC。
[0026] The sequence of ScU6-48 (SEQ ID NO.4) is shown below: GACTCACGAGAGCCGCACTATTCTTTTTTTTCCCCTCCAAAGAAAGATATACACGTTTCTAGATAGGAACAGAGGACGGCGATGACCATATTTGTTGTTTTTTATTATGTCGGAAATATAAATTTATCGCTATATTTTAATGATATAAGGAATATACGTACCTGTTATTTTTCTCAGTGACACTTTTTTCTATTGAGTTAATTAATGTATAAATGTAATTTATAGGTCACTAGTAGGCTTGTTCATTGTG CATTGGCTCTGATAATGCGTGAAAGCGAAGGACAGCACGTCACAAAACGGGCCTGCAATCTTCCAACAGAAAACACGAAGCGCATGATAGCTGGGCCGCGCTAAAGGATACAGCCCACGTGGCG TGGCGTCGTTGCGAGCTTGCGGCTTGTGGCCTTGCGAGGAAGGGAACGAACTCGGAGTTTAGTACCAAACCGGCCAGCGAACGACGCAAACACCAGCTTATAAGCTCCCGCCGTGGCCACCGCAAC.
[0027] This invention also provides the application of the sugarcane endogenous U6 promoter as described above in improving the efficiency of sugarcane gene editing.
[0028] In a specific implementation, the sugarcane editing uses any of the following gene editing tools: (1) Base editing; (2) Small fragment deletion system; (3) CRISPR / Cas9.
[0029] The sugarcane endogenous U6 promoter described in this invention can improve the gene editing efficiency of the above-mentioned gene editing tools and has wide applicability.
[0030] This invention does not limit the specific type of base editor used for base editing; any base editor commonly used in the art can be used. In some embodiments, the base editor used for base editing is the base editing vector BE3.
[0031] The present invention does not limit the specific structure of the small fragment deletion system, and can be any small fragment deletion system commonly used in the art.
[0032] This invention does not limit the specific structure of the CRISPR / Cas9 system, and can be any CRISPR / Cas9 system commonly used in the art. In some embodiments, the CRISPR / Cas9 uses the PHUE411 editing vector as a backbone, replaces the original sgRNA promoter with the sugarcane endogenous U6 promoter, and retains the original ubi promoter to drive Cas9 expression.
[0033] This invention also provides a sugarcane gene editing vector, wherein the promoter of the sugarcane gene editing vector is ScU6-29, ScU6-23, or ScU6-48, wherein the nucleotide sequence of ScU6-29 is shown in SEQ ID NO.2, the nucleotide sequence of ScU6-23 is shown in SEQ ID NO.3, and the nucleotide sequence of ScU6-48 is shown in SEQ ID NO.4. Because the sugarcane gene editing vector contains the aforementioned sugarcane endogenous U6 promoter, it can significantly improve the sugarcane gene editing efficiency compared to existing gene editing vectors using the rice U6 promoter.
[0034] This invention also provides the application of the sugarcane endogenous U6 promoter and the sugarcane gene editing vector as described above in sugarcane gene editing.
[0035] This invention also proposes the application of the sugarcane endogenous U6 promoter and the sugarcane gene editing vector as described above in sugarcane breeding technology.
[0036] This invention also proposes the application of the sugarcane endogenous U6 promoter and the sugarcane gene editing vector as described above in sugarcane gene function research.
[0037] This invention also proposes the application of the sugarcane endogenous U6 promoter and the sugarcane gene editing vector as described above in sugarcane gene genetic transformation.
[0038] The present invention will be described in detail below through embodiments, but the scope of protection of the present invention is not limited thereto. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods in the art. Unless otherwise specified, the experimental materials used in the following embodiments are commercially available products.
[0039] In the following embodiments, the raw materials involved include: The reagent kit (DC104-01) was purchased from Nanjing Novizan Biotechnology Co., Ltd.
[0040] The CDS sequence of the target gene ScSUT4 is shown below (SEQ ID NO.5): ATGCCGCCGCGCACGGCTCCGGCGGCGACGGCGACCCCGCCGCGGAAGGTGCCCCTCCGGAAGCTGCTGCGTGCGGCGTCGGTCGCCTGCGGGGTGCAGTTCGGCTGGGCGCTGCAGCTGTCGCTGCTGACCCCGTACGTGCAGGAGCTGGGCATCCCGCACGCCTTCGCCAGCCTCGTCTGGCTGTGCGGCCCGCTGTCGGGCCTCCTCGTTCAGCCCCTCGTCGGCCACCTCTCCGACCGCATCGGCCCCGCCGCCTCGCCGCTCGGGCGCCGCAGGCCCTTCATCGCCGCCGGCGCCGCGTCCATCGCAGCAGCCGTGCTCACCGTCGGCTTCTCCGCCGACCTCGGCCGACTCTTCGGCGACGACGTCACCCCGGGGTCAACGCGCCTCGGCGCCATCTGCGTCTACCTCGTCGGATTCTGGCTGCTCGACGTCGGCAACAACGCCACGCAGGGGCCCTGCAGGGCGTTCCTCGCCGACCTCACAGAGAACGACCCAAGGAGGACTCGGATCGCTAATGCATACTTTTCACTCTTCATGGCCCTGGGAAACATACTTGGATATGCCACCGGAGCATACAGTGGATGGTATTTGATATTTCCTTTCACTGTTACAGAGTCCTGCGGCGTCAGTTGTGCCAACCTTAAGTCTGCCTTTCTTCTTGACATTATTATTCTGGTGATTACAACGTACATTACTGTAGCATCCGTGCAAGAGCCTCAAACTTTTGGAAGTGATGAAGCACAAAACCCAGGTGCTGAACAGGAAGCTTTCCTCTGGGAACTTTTTGGGTCATTAAGATACTTCACCTTACCAATTTGGATGGTCTTAATTGTCACTGCCCTTACGTGGATCGCATGGTTTCCTTTTACCCTCTTTGATACTGATTGGATGGGCCGAGAAATCTACCGAGGAAGCCCAGACAACCCAGGAGAGGCCCAAAGGTACCATGATGGT .
[0041] Base editing vector BE3: Structure as follows Figure 4 As shown, please also refer to the literature: Zong Y, Song Q, Li C, JinS, Zhang D, Wang Y, Qiu JL, Gao C. Efficient C-to-T base editing in plants using a fusion of nCas9 and human APOBEC3A. Nat Biotechnol. 2018 Oct 1. doi:10.1038 / nbt.4261. Epub ahead of print. Erratum in: Nat Biotechnol. 2025 Jun;43(6):1011. doi: 10.1038 / s41587-025-02676-y. PMID: 30272679.
[0042] Small Fragment Deletion Gene Editing Tool (AFID): Structure as follows Figure 7As shown, see also the following reference: Wang S, ZongY, Lin Q, Zhang H, Chai Z, Zhang D, Chen K, Qiu JL, Gao C. Precise, predictable multi-nucleotide deletions in rice and wheat using APOBEC-Cas9. Nat Biotechnol. 2020 Dec;38(12):1460-1465. doi: 10.1038 / s41587-020-0566-4. Epub 2020 Jun 29. Erratum in: Nat Biotechnol. 2025 Jun;43(6):1012. doi:10.1038 / s41587-025-02674-0. PMID: 32601432.
[0043] PHUE411 editing vector (PHUE411-OsU3P-sgRNA--OsU3 ter-ubi-Cas9-E9 ter): structure as follows Figure 9 As shown, see also the reference: A CRISPR / Cas9 toolkit for multiplex genome editing in plants. Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. BMC Plant Biol. 2014 Nov 29;14(1):327. 10.1186 / s12870-014-0327-y PubMed25432517.
[0044] Example 1 This embodiment illustrates the acquisition of the sugarcane endogenous U6 promoter and the construction of the gene editing vector described in this invention.
[0045] 1. Acquisition of endogenous U6 promoter sequence in sugarcane, evolutionary relationship and analysis of conserved functional domains (1) Using rice U6 RNA (its sequence information is shown in SEQ ID NO.1) as the query sequence, a search and comparison were performed in the sugarcane Guitang 42 genome database to obtain several sugarcane homologous sequences. The conserved functional domains and phylogenetic tree construction analysis of the upstream 1kb sequence of the obtained U6 RNA were performed, including the eukaryotic transcription initiation element TATA box, as well as the MSP domain (RGCCCR) and USE domain (RTCCCACATCG) unique to monocotyledons, and promoters containing TATA box and USE functional domain were screened. (2) Since the number of MSP functional domains has a certain impact on promoter activity, the number of MSP functional domains contained in the promoters was further counted, and the obtained promoters were divided into several categories for subsequent screening of efficient promoters (see Figure 1 ).
[0046] 2. Construction of a gene editing vector for expressing sgRNA driven by the endogenous U6 promoter (1) Based on Figure 1 The promoters selected were ScU6-12, ScU6-13, ScU6-24, ScU6-41, ScU6-26, ScU6-6, ScU6-19, ScU6-23, ScU6-29, ScU6-47, ScU6-48, ScU6-14, ScU6-17, and ScU6-21 for experiments.
[0047] The SUT gene family plays a crucial role in long-distance sucrose transport (e.g., from source to sink), intracellular sugar allocation, reproductive development, responses to biotic and abiotic stresses, and metabolic regulation. SUTs are considered control points for sucrose storage in plants because they can carry sucrose across the cell membrane and play a vital role in a series of steps involving sucrose loading into the phloem system. Based on this, this experiment used ScSUT4 (sequence shown in SEQ ID NO.5) as the target gene and employed the editing target site (ST8: CTCCTCGTTCAGCCCCTCGTCGG) as the sgRNA.
[0048] (2) Construction of gene editing vectors: Based on the gene editing vector V1(pJIT163-OsU6-sgRNA-poly(T), see the schematic diagram of the vector. Figure 2The vector expresses sgRNA and scaffold driven by the OsU6 promoter (sequence shown in SEQ ID NO.1). To verify the activity of the sugarcane endogenous U6 promoter, the primer sequence of vector V1 (V2-F / R) was amplified by circular PCR. After ligation, intermediate vector V2 was obtained. Vector V2 was digested with BsaI and then ligated to obtain editing vector V3 (pJIT163-ScU6-sgRNA-poly(T)) that expresses ST8 driven by the sugarcane endogenous U6 promoter. A schematic diagram of the vector is shown in [image missing]. Figure 3 This is used for testing subsequent editing efficiency; The V2-F / R sequence is shown below: V2-F: ATGCCTGCAGGTCGACGATTTAGGATTTTTGTATATATATAAATTTAGGAGGAGTC; V2-R: GAGACCTTGTGTTGGTCTCAGTTGCGGTGGCCACGGCGGAG.
[0049] Example 2 This embodiment illustrates that the sugarcane endogenous U6 promoter described in this invention can improve the editing efficiency of the base editing BE3.
[0050] (1) The gene editing vector V3 successfully constructed in Example 1 was used to drive the expression of sgRNA, and then combined with the base editing vector BE3 ( Figure 4 Sugarcane protoplasts were co-transformed. The base of the young stems of sugarcane Guitang 42 was cut into thin slices. After isolating the protoplasts by enzymatic digestion, the gene editing vector V3 and the base editing vector BE3 were co-transformed into the sugarcane protoplasts using PEG-mediated transformation. After incubation in the dark at 28°C for 2 days, the genome was extracted according to the steps described in the kit (DC104-01). The sequence approximately 180 bp upstream and downstream of the target site was amplified by PCR (ST8-NGS-F / R, where ST8-NGS-F: CAGCCTCGTCTGGCTGTG; ST8-NGS-R: CGACGAGGTAGACGCAGATG). The reaction system is shown in Table 1, and the reaction conditions are shown in Table 2.
[0051] The expression of sgRNA (ST8) was driven by the endogenous U6 promoter sequence to be tested, with the rice OsU6 promoter as a control, in order to detect the editing efficiency.
[0052] Table 1 PCR reaction system
[0053] Table 2 PCR reaction procedures
[0054] (2) The amplification products were gel-cleaved, purified, and recovered. The samples were sent to Genewiz for next-generation sequencing. PE150 paired-end sequencing was performed using the Illumina Novaseq 6000 instrument manual. The obtained high-throughput sequencing results were decoded and the editing efficiency was statistically analyzed. The editing efficiency of sgRNA expression driven by different promoters was analyzed. The results are as follows: Figure 5 As shown.
[0055] Depend on Figure 5 It can be seen that three editing efficiencies are significantly higher than those of the sugarcane endogenous U6 (ScU6) promoter of rice OsU6, namely ScU6-29 (sequence in SEQ ID NO.2), ScU6-23 (sequence in SEQ ID NO.3) and ScU6-48 (sequence in SEQ ID NO.4). Among them, ScU6-29 drives the expression of sgRNA with the highest editing efficiency, which is about three times that of OsU6.
[0056] (3) Next, DNAMAN analysis software was used to perform multiple sequence alignment analysis on ScU6-29, ScU6-23, ScU6-48 and OsU6 promoters and U6 RNA. The results are as follows: Figure 6 As shown.
[0057] The results showed that ( Figure 6 The U6 RNA sequences of ScU6-29, ScU6-23, ScU6-48 and OsU6 are highly conserved, and a conserved TATA box exists 30 bp upstream of the U6 RNA.
[0058] Since ScU6-29 has the highest editing efficiency, we used ScU6-29 for all subsequent experiments.
[0059] Example 3 This embodiment illustrates how the sugarcane endogenous U6 promoter described in this invention can improve the editing efficiency of the Small Fragment Deletion System (AFID).
[0060] Based on the highly efficient promoter ScU6-29 obtained in Example 2, the editing efficiency of the small fragment deletion gene editing tool AFID was further tested to broaden its applicability.
[0061] The test was conducted according to the method described in Example 2, except that ST8 expression was driven by the editing vector V3, and the base editing vector BE3 was replaced with the small fragment deletion gene editing tool AFID. Figure 7 The test results are as follows: Figure 8 As shown.
[0062] The results show that ( Figure 8By testing in protoplasts and combining high-throughput sequencing analysis, the editing efficiency of the sugarcane endogenous promoter ScU6-29 was significantly higher than that of the rice-derived promoter OsU6.
[0063] Example 4 This embodiment illustrates how the use of the sugarcane endogenous U6 promoter can improve CRISPR / Cas9 editing efficiency.
[0064] After improving the efficiency of base editing and AFID editing, we further tested whether ScU6-29 could improve the efficiency of CRISPR / Cas9 to further meet the diverse needs of sugarcane gene editing. The specific testing method is as follows: (1) Using the PHUE411 editing vector as the basic backbone, the sgRNA expression cassette and the Cas9 expression cassette are in the same vector. The construction method is as follows: The PHUE411 backbone vector (PHUE411-OsU3P-sgRNA--OsU3 ter-ubi-Cas9-E9 ter) was digested with HindIII. Using the gene editing vector V3 successfully constructed in Example 1 as a template, the ST8sgRNA expression cassettes (411-OsU6-F / R, 411-ScU6-F / R) were amplified. The amplification products were purified and recovered. The vectors PHUE411-OsU6-sgRNA-ploy(T)-ubi-Cas9-E9 ter and PHUE411-ScU6-sgRNA-ploy(T)-ubi-Cas9-E9 ter were constructed by homologous recombination. These vectors were used to test whether endogenous U6 in sugarcane could improve the efficiency of CRISPR / Cas9 gene editing. The structures of the PHUE411 backbone vectors (PHUE411-OsU3P-sgRNA--OsU3 ter-ubi-Cas9-E9 ter), PHUE411-OsU6-sgRNA-ploy(T)-ubi-Cas9-E9 ter, and PHUE411-ScU6-sgRNA-ploy(T)-ubi-Cas9-E9 ter are as follows: Figure 9 As shown; The primer sequences are as follows: 411-OsU6-F: TTGTAAAACGACGGCCAGTGCCATGCAAGAACGAACTAAGCCGG; 411-OsU6-R: CCGAGACCTTGTGTTGGTCTCAAACACAAGCGGCAGCGCG; 411-ScU6-F: TTGTAAAACGACGGCCAGTGCCTAGGATTTTTGTATATATATAAATTTAGGAGGAGT; 411-ScU6-R: CCGAGACCTTGTGTTGGTCTCAGTTGCGGTGGCCACGG; (2) Using the successfully constructed PHUE411-OsU6-sgRNA-ploy(T)-ubi-Cas9-E9 ter and PHUE411-ScU6-sgRNA-ploy(T)-ubi-Cas9-E9 ter editing vectors, the editing efficiency was tested using sugarcane protoplasts (the protoplast transformation method and high-throughput sequencing method were the same as in Example 2). PE150 paired-end sequencing was performed using the Illumina Novaseq 6000 instrument manual. The obtained high-throughput sequencing results were decoded and the editing efficiency was statistically analyzed. The results are as follows: Figure 10 As shown.
[0065] The results show that ( Figure 10 ScU6-29 has a significantly higher editing efficiency than OsU6, further expanding the application scope of the sugarcane endogenous U6 promoter.
[0066] In summary, the sugarcane endogenous U6 promoter described in this invention can improve the efficiency of various gene editing tools (including base editing, AFID small fragment deletion system and CRISPR / Cas9), has a wide range of applications, provides a theoretical basis for the subsequent optimization of sugarcane gene editing vectors, and greatly accelerates the sugarcane breeding process and the cultivation of high-quality new germplasm.
[0067] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.
Claims
1. A sugarcane endogenous U6 promoter, characterized in that, The sugarcane endogenous U6 promoter is ScU6-29, ScU6-23, or ScU6-48, wherein the nucleotide sequence of ScU6-29 is shown in SEQ ID NO.2, the nucleotide sequence of ScU6-23 is shown in SEQ ID NO.3, and the nucleotide sequence of ScU6-48 is shown in SEQ ID NO.
4.
2. The application of the sugarcane endogenous U6 promoter as described in claim 1 in improving the efficiency of sugarcane gene editing.
3. The application according to claim 2, characterized in that, The sugarcane editing was performed using any of the following gene-editing tools: (1) Base editing; (2) Small fragment deletion system; (3) CRISPR / Cas9.
4. The application according to claim 3, characterized in that, The base editing is performed using the base editing vector BE3.
5. The application according to claim 3, characterized in that, The CRISPR / Cas9 uses the PHUE411 editing vector as a backbone, replacing the original sgRNA promoter with the sugarcane endogenous U6 promoter, while retaining the original ubi promoter to drive Cas9 expression.
6. A sugarcane gene editing vector, characterized in that, The promoter of the sugarcane gene editing vector is ScU6-29, ScU6-23 or ScU6-48, wherein the nucleotide sequence of ScU6-29 is shown in SEQ ID NO.2, the nucleotide sequence of ScU6-23 is shown in SEQ ID NO.3, and the nucleotide sequence of ScU6-48 is shown in SEQ ID NO.
4.
7. The application of the sugarcane endogenous U6 promoter of claim 1 and the sugarcane gene editing vector of claim 6 in sugarcane gene editing.
8. The application of the sugarcane endogenous U6 promoter as described in claim 1 and the sugarcane gene editing vector as described in claim 6 in sugarcane breeding technology.
9. The application of the sugarcane endogenous U6 promoter of claim 1 and the sugarcane gene editing vector of claim 6 in sugarcane gene function research.
10. The application of the sugarcane endogenous U6 promoter of claim 1 and the sugarcane gene editing vector of claim 6 in sugarcane gene genetic transformation.