Soybean mosaic virus disease resistant gene GmNAL1 of soybean and application thereof
By cloning and expressing the soybean disease resistance gene GmNAL1, constructing recombinant vectors and engineered bacteria, the problem of insufficient resistance to soybean mosaic virus disease was solved, achieving highly efficient enhancement of soybean's resistance to the virus, which has significant economic and application potential.
Patent Information
- Application Number
- CN202511145384.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-15
- Publication Date
- 2025-11-14
AI Technical Summary
The lack of effective genes for resisting soybean mosaic virus in existing technologies has severely affected soybean yield and quality, and there is a lack of safe and economical control measures.
The soybean disease resistance gene GmNAL1 was cloned and expressed. A recombinant vector and recombinant engineered bacteria were constructed. The gene was overexpressed in soybeans by Agrobacterium-mediated transformation to improve soybean resistance to soybean mosaic virus.
Overexpression of the GmNAL1 gene in soybeans significantly enhances resistance to soybean mosaic virus, reduces viral symptoms, and lowers viral expression levels, demonstrating significant economic value and application prospects.
Smart Images
Figure CN120944906A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and specifically to the recombinant vector, recombinant engineered bacteria, and applications of the soybean resistance gene GmNAL1 against soybean mosaic virus. Background Technology
[0002] Soybeans are an important food crop, economic crop, and forage crop, with their unique plant-based oils and proteins being essential for human and animal nutrition. Throughout their growth cycle, soybeans are susceptible to more than 120 kinds of pests and diseases, among which Soybean Mosaic Virus (SMV) is the most serious. SMV infection typically causes soybean plants to exhibit typical symptoms such as mosaic patterns, curling, stunting, or systemic necrosis. In severe cases, it affects soybean growth and development, reducing yield and quality, resulting in significant economic losses. Therefore, improving and enhancing resistance to soybean mosaic virus and developing new varieties with broad-spectrum resistance to soybean mosaic virus are of great significance for the safe production of soybeans in my country.
[0003] Currently, there are no safe and effective physicochemical methods for controlling SMV. Therefore, discovering disease-resistant genes and breeding disease-resistant varieties remain the most economical, safe, and effective means. The prerequisite for breeding new disease-resistant soybean varieties is the discovery of new disease-resistant genes. Currently, 35 gene loci with single dominant quality resistance to SMV have been identified in soybeans, but only a few resistance genes have been cloned. Therefore, continuously discovering new soybean disease-resistant genes can accumulate valuable genetic resources for the breeding of new soybean mosaic virus-resistant varieties. Summary of the Invention
[0004] The purpose of this invention is to provide a recombinant vector, recombinant engineered bacteria, and application of the soybean anti-soybean mosaic virus gene GmNAL1, in order to make up for the deficiencies of existing soybean anti-soybean mosaic virus genes. Applying it to soybeans can improve soybean resistance to soybean mosaic virus.
[0005] The technical problem solved by this invention is achieved by the following technical solution.
[0006] A soybean mosaic virus resistance gene GmNAL1, the coding region sequence of which is shown in SEQ ID NO:1, and the encoded protein amino acid sequence is shown in SEQ ID NO:2.
[0007] Recombinant vectors containing the aforementioned soybean disease resistance gene GmNAL1.
[0008] Recombinant engineered bacteria containing the aforementioned soybean disease resistance gene GmNAL1.
[0009] The application of the soybean disease resistance gene GmNAL1 in improving soybean mosaic virus resistance.
[0010] The application of the recombinant expression vector in improving resistance to soybean mosaic virus disease.
[0011] The application of the recombinant engineered bacteria in improving resistance to soybean mosaic virus disease.
[0012] The functional identification of the soybean disease resistance gene GmNAL1 included the following steps:
[0013] S1. The soybean disease resistance gene GmNAL1 was cloned into the pCAMBIA3301 vector to obtain an overexpression vector;
[0014] S2. The expression vector was used to infect the susceptible variety Williams82 with Agrobacterium tumefaciens to obtain gene-overexpressing plants.
[0015] S3. Take an appropriate amount of seeds from plants that overexpress the aforementioned gene, culture them until the first pair of true leaves are fully expanded, inoculate them with fresh diseased leaves of SMV-SC3, and after 15 days of culture, observe, record, and analyze the degree of disease on the leaves.
[0016] Beneficial effects:
[0017] The soybean disease resistance gene GmNAL1 of this invention is the first to be cloned from soybean. Its CDS is 3546 bp long, encoding a protein of 1181 amino acids. This protein possesses NB-ARC and LRR domains. By comparing the resistance of soybean plants overexpressing GmNAL1 and wild-type soybeans to soybean mosaic virus, it was found that the GmNAL1 gene can enhance the soybean's resistance to soybean mosaic virus, demonstrating significant economic value and application prospects in the field of genetic engineering. Attached Figure Description
[0018] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1 GmNAL1 overexpression vector PCR detection electrophoresis image
[0020] Figure 2 Flowchart of Agrobacterium-mediated genetic transformation of soybean cotyledonary nodes
[0021] Figure 3 Identification using soybean plant herbicide application (A) and Bar test strips (B)
[0022] Figure 4PCR detection of target gene (A) and Bar gene (B) in overexpressed soybean plants
[0023] Figure 5 Comparison of leaves of wild-type and overexpressing soybeans after 15 and 30 days of inoculation with SMV-SC3.
[0024] Figure 6 Relative virus expression levels in leaves of wild-type and overexpressing soybeans 15 and 30 days after inoculation with SMV-SC3 Detailed Implementation
[0025] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. It should be understood that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and purpose.
[0026] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Where specific conditions are not specified in the examples, they should be performed under conventional conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.
[0027] The following describes in detail the recombinant vector, recombinant engineered bacteria, application, and functional identification of the soybean resistance gene GmNAL1 for soybean mosaic virus according to embodiments of the present invention. However, these descriptions should not be construed as limiting the scope of protection of the present invention.
[0028] Example 1
[0029] This embodiment provides the cloning and overexpression vector construction of the soybean resistance gene GmNAL1 against soybean mosaic virus, including the following steps:
[0030] (1) Primers containing vector homologous sequences were designed based on the full-length CDS sequence of GmNAL1 (gene number Glyma.13G184800) in the NCBI database:
[0031] F:atgaccatgattacgaattcATGCCAGTACTAGAAACCCTTGGTGGTGCT,
[0032] R:aggtcgactctagaggatccACTACCGTTTAATGACACGCGTTTAATGTG.
[0033] (2) Fresh soybean material PI96982 leaves were placed in liquid nitrogen and ground thoroughly to break the cells. Total RNA was extracted and cDNA was reverse-engineered according to the following steps:
[0034] 1) Add 1 mL of TRIzol to every 30-50 mg of tissue and homogenize using a homogenizer to ensure complete lysis of the sample. Incubate at room temperature for 5 min to allow complete separation of the nucleic acid-protein complex. Add chloroform, 200 μL of chloroform per 1 mL of TRIzol (Kangwei Century, China), tighten the cap, shake vigorously for 15 s, and incubate at room temperature for 2-3 min to promote phase separation.
[0035] 2) Centrifuge at 12000 rpm for 15 min at 4℃. After centrifugation, the sample clearly separated into three layers: the bottom layer was a red organic phase, the top layer was a colorless aqueous phase containing RNA, and an intermediate layer between the two. Transfer the RNA-enriched aqueous phase (approximately 60% of the TRIzol reagent used) to a new RNase-free 1.5 mL centrifuge tube.
[0036] 3) Add an equal volume of isopropanol to the obtained upper aqueous phase, invert to mix, and incubate at room temperature for 10 min to promote RNA precipitation. Centrifuge at 12000 rpm for 10 min at 4℃ and discard the supernatant.
[0037] 4) Add 1 mL of 75% ethanol and wash the precipitate. Centrifuge at 12000 rpm for 5 min at 4℃, discard the supernatant. Be extremely careful during the operation and avoid aspirating the RNA precipitate.
[0038] 5) Open the centrifuge tube and place it at room temperature for 2-3 minutes. After the precipitate has dried slightly, add 30-100 μL of RNase-free water, gently pipette to fully dissolve the RNA, and then store the RNA at -80℃ for later use.
[0039] 6) RNA reverse transcription reference Follow the instructions for use of the II 1st Strand cDNA Synthesis Kit (+gDNAwiper) (Novozymes, China).
[0040] (3) Using 1 μL of cDNA as a template, add 1 μL each of F / R primers and 25 μL of... Max Master Mix (DyePlus) (Novizan, China) was added, and ddH2O was added to a final volume of 50 μL. The PCR reaction program was 95℃ for 5 min, 98℃ for 10 s, 58℃ for 15 s, and 72℃ for 2 min 30 s, for 35 cycles, followed by incubation at 4℃. Electrophoresis was then performed at 220V for 10 min to obtain bands of the expected size.
[0041] The sequence obtained by sequencing was verified as the CDS sequence of GmNAL1, with a full length of 3546 bp, encoding 1181 amino acids. The nucleic acid sequence and amino acid sequence are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. The structure of the GmNAL1 protein was analyzed using NCBI's CDD tool, revealing that the protein contains an NB-ARC domain and multiple conserved leucine-rich motif (LRR) domains. Based on these domains, the gene was named GmNAL1.
[0042] (4) The vector plasmid was extracted according to the instructions of TIANGEN plasmid extraction (TIANGEN, China). The pCAMBIA3301 vector was digested with EcoRI and BamHI (NEB, USA) at 37℃ for 2 hours. The reaction system is shown in Table 1. The linearized expression vector pCAMBIA3301 was obtained after purification. The vector fragment was recovered according to the instructions of FastPure Gel DNA Extraction Mini Kit (Novizan, China).
[0043] Table 1. Vector double enzyme digestion system, 50 μL
[0044]
[0045] The GmNAL1 target fragment obtained in step (3) was inserted into the linearized expression vector pCAMBIA3301 using homologous recombinase (Novizan, China) according to the instructions, to obtain the vector pCAMBIA3301-GmNAL1 overexpressing the soybean GmNAL1 gene. The plasmid was transformed into E. coli DH5α competent cells, and bacterial culture was picked for PCR identification. The reaction system and reaction procedure were the same as in step (3), and the identification primers were vector sequencing primers containing the target gene GmNAL1. The specific primer sequences are as follows: Gm1848OE-F:
[0046] GGACTTTTGCCATTTCTGAAGGAG and Gm1848OE-R: GCGATTAAGTTGGGTAACGC.
[0047] Bacterial test results as follows Figure 1 As shown, clones with a 3789 bp band are considered positive clones. Plasmids were extracted, transformed into Agrobacterium EHA105, and positive clones were selected and stored at -80°C for later use.
[0048] Example 2
[0049] This embodiment provides genetic transformation of soybean cotyledonary nodes using the soybean gene GmNAL1. The overexpression vector is transformed into the SMV susceptibility receptor Williams 82 to obtain the transformant. Figure 2The diagram shown is a flowchart of the soybean genetic transformation process of the present invention, which includes the following steps:
[0050] (1) Seed preparation
[0051] Seeds harvested in the same year for the transformation recipient were selected. The selection criteria were plump seeds, smooth surface, no lesions or damage, and uniform color. The selected seeds were gently wiped with a paper towel and sterilized by chlorine fumigation for six hours. The chlorine-sterilized soybean seeds were picked up with sterile forceps and inoculated into a pre-prepared germination medium with the hilum facing down. The seeds were then incubated in the dark at 25°C for 24 hours.
[0052] (2) Preparation of explants
[0053] Take fully germinated soybean seeds, use a sterile scalpel to cut vertically along the midline of the seed hilum, remove the axillary bud tissue in the growth point area of the explant, and create 3-5 wounds about 3-5 mm long and about 0.6 mm deep at the cotyledon node.
[0054] (3) Agrobacterium infection and co-culture
[0055] Agrobacterium EHA105 containing the target vector (pCAMBIA3301-GmNAL1) was cultured in YEP (50 mg / L Rif, 50 mg / L Kana) medium and resuspended to obtain Agrobacterium resuspension with OD 600 values between 0.8 and 1.0. The resuspension was then used to submerge the explants prepared in step (2) and infect them at room temperature for 30 min. The explants were then laid flat on a co-culture medium pre-coated with a layer of sterile filter paper with the adaxial surface facing up. The medium was then incubated in the dark at 25°C for 3-5 days.
[0056] (4) Induction of clustered buds
[0057] After dark culture, the elongated hypocotyl of the explants was cut to 5-7 mm using a sterile scalpel. The explants were then washed with sterile water and liquid bud induction medium for 30 minutes each time. The hypocotyl was then inserted obliquely into the bud induction medium at a 30-45 degree downward angle. The growth conditions were light:dark = 18h:6h, 23-25℃. After 14 days, the large buds of the explants were removed, and the explants were transferred back to the bud induction medium for further induction.
[0058] (5) Bud elongation
[0059] Remove the explants that resemble clustered buds, discard any browned and necrotic tissue, and create a new wound at the base of the hypocotyl. Insert the explants into a bud elongation medium. Subculture every 14 days, repeating the above steps each time. Elongation culture lasts approximately 1-2 months, under the same growth conditions as for clustered bud induction.
[0060] (6) Rooting
[0061] When the regenerated shoot is about 3-6 cm long, cut it off along the base of the explant using sterile scissors. Immerse the base of the regenerated shoot in 1 mg / L IBA solution for a few seconds, then insert it into rooting medium for 8-14 days of rooting culture. The growth conditions are the same as for induction of clustered shoots.
[0062] (7) Seedling hardening and domestication
[0063] Once the root system is robust, add a small amount of sterile ddH2O to keep the petri dish moist, replacing the ddH2O every other day. After hardening off, thoroughly rinse the plant roots with water to remove the culture medium, then transfer them to a sterile substrate (nutrient soil: vermiculite = 1:2). Harvest individual plants upon maturity. The optimal growing conditions are light:dark = 18h:6h, 23-26℃.
[0064] Example 3
[0065] This embodiment provides the identification of positive soybean plants transgenic with the GmNAL1 gene, including the following steps:
[0066] (1) Apply herbicide
[0067] Mix 0.1g of Basta herbicide stock solution with 0.05g of Tween-20, and dilute to 50mL with pure water. Apply the solution lightly to one side of the main vein of the leaf using a brush, leaving the other side untreated as a control. After one week, if there is no significant difference between the treated and control areas, the plant is considered a positive plant; if the treated area shows yellowing or necrosis while the leaves in the control area remain green, the plant is considered a negative plant. Figure 3 A).
[0068] (2) Protein detection using PAT / bar test strips
[0069] Randomly collect leaves from the upper, middle, and lower layers of the transgenic plant and mix them in a 1.5 mL centrifuge tube containing 500 μL of buffer. Crush the leaves with a grinder. Insert the test strip vertically into the centrifuge tube as indicated by the arrow, ensuring the liquid submerges the bottom of the strip but does not exceed the black mark. Allow 3-5 minutes for the test strip to fully react and develop color. If the test strip shows two bands (upper and lower), the sample is positive; if only the upper band is shown, the sample is negative. Figure 3 B).
[0070] (3) PCR detection at the DNA molecular level
[0071] Upper leaves of transgenic plants were collected, and DNA was extracted using a high-efficiency plant genomic DNA extraction kit (TSP102, Qingke Biotechnology, China). Specific steps are detailed in Appendix 1-9. DNA samples were stored at -20°C. The DNA samples were then processed using the target gene GmNAL1 (…). Figure 4 A) Bar primers ( Figure 4B) and other vector sequencing primers were used, with the extracted DNA sample as a template. The reaction system (25 μL) consisted of: 1 μL template, 1 μL each of F / R primers, 12.5 μL 2×Rapid Taq Master Mix (P222, Novizan, China), and 9.5 μL ddH2O. The reaction program was: 95℃ for 5 min, 98℃ for 10 s, 58℃ for 15 s, 72℃ for 2 min, 35 cycles, followed by incubation at 4℃. Electrophoresis was performed to detect the presence of... Figure 4 If a band of the corresponding size is shown, then the plant is positive for PCR testing.
[0072] Gm1848OE-F: GGACTTTTGCCATTTCTGAAGGAG and Gm1848OE-R: GCGATTAAGTTGGGTAACGC, Bar-F: CCATCGTCAACCACTACATCGAGACA and Bar-R: CTTCAGCAGGTGGGTGTAGAGC GT.
[0073] (4) Identification of soybean mosaic virus resistance in soybean plants transgenic with the GmNAL1 gene, including the following steps:
[0074] Seeds of positive GmNAL1 transgenic soybeans (OE-2 and OE-3) and wild-type Williams82 obtained in (3) were sown in small flowerpots (10 cm in diameter) filled with soil, 10 seeds per pot. They were cultured in a light incubator at 25℃, 75% humidity, 16h light / 8h darkness until the first true leaf of the soybean fully unfolded. Fresh diseased leaves of SMV-SC3 were inoculated, with 0.01M phosphate-buffered saline (PBS) as the control. The specific inoculation method was as follows: Diseased leaves and a small amount of carborundum were placed in a sterile mortar, and an appropriate amount of PBS buffer was added. The volume of PBS buffer should be 5 to 20 times the volume of the diseased leaves. Then, the mixture was ground until homogeneous using a sterile grinding stick. A No. 10 paintbrush was used to apply the inoculation solution obtained after grinding to the plant leaves. Two weeks later, the phenotypic observation of the plants was recorded, and the symptom types were classified. The specific symptom type classification criteria are shown in Table 2.
[0075] The results are as follows Figure 5 As shown, soybean plants overexpressing GmNAL1 showed no symptoms 15 and 30 days after inoculation with SMV-SC3, while wild-type plants were severely affected, exhibiting typical mosaic and wrinkled leaves. Leaves were collected from the plants, and the severity of leaf disease was analyzed at the molecular level, specifically by detecting SMV accumulation using qRT-PCR.
[0076] Table 2. Criteria for classifying symptom types
[0077]
[0078] Positive and control plants were collected 15 and 30 days after SC3 inoculation. Total RNA was extracted and cDNA was reverse-engineered according to step (2) of Example 1. SMV CP gene qPCR primers were designed. Following the recommended reaction system of ChamQ SYBR qPCR Master Mix (Novizan, China), the relevant reagents were thoroughly mixed and qRT-PCR experiments were performed in a real-time PCR instrument. The results of the relative quantification calculation expression were obtained through 2 -ΔΔCt Methods were calculated, and the significance of differences between samples was analyzed using t-tests (P < 0.05). qPCR primers: qSMV CP-F: TTCTGAAAGTCCGTATATGCCTAG and qSMV CP-R: GCCTTTCAGTATTTTCGGAGTT.
[0079] The results are as follows Figure 6 As shown, the virus expression levels in overexpressing plants (OE-2, OE-3) were significantly lower than those in the control wild-type Williams 82, indicating that overexpression of GmNAL1 can enhance the soybean's resistance to soybean mosaic virus.
[0080] As can be seen from the above implementation examples, the present invention provides the application of the soybean GmNAL1 gene in resistance to soybean mosaic virus disease. The soybean GmNAL1 gene is overexpressed in soybean and has important application value in soybean disease resistance genetic engineering breeding.
[0081] The embodiments described above are some, but not all, implementations of the present invention. The detailed description of the implementations of the present invention is not intended to limit the scope of the claimed invention, but merely to illustrate selected implementations. All other implementations obtained by those skilled in the art based on the implementations of the present invention without inventive effort are within the scope of protection of the present invention.
[0082] CDS sequence of GmNAL1
[0083]
[0084]
[0085] GmNAL1 protein sequence
[0086]
Claims
1. A gene GmNAL1 for resistance to soybean mosaic virus, characterized in that, The coding region sequence of the soybean disease resistance gene GmNAL1 is shown in SEQ ID NO:
1.
2. A recombinant expression vector containing the soybean disease resistance gene GmNAL1 as described in claim 1.
3. The recombinant expression vector according to claim 2, characterized in that, The soybean disease resistance gene GmNAL1 was obtained by inserting it between EcoRI and BamHI in the linearized expression vector pCAMBIA3301 using homologous recombinase.
4. Recombinant engineered bacteria containing the soybean disease resistance gene GmNAL1 as described in claim 1.
5. The application of the soybean disease resistance gene GmNAL1 as described in claim 1 in improving soybean mosaic virus resistance.
6. The application of the recombinant expression vector according to claim 2 or 3 in improving resistance to soybean mosaic virus disease.
7. The application of the recombinant engineered bacteria according to claim 4 in improving soybean mosaic virus resistance.