The invention relates to oil tea CoPHO1; application of H3 gene in regulation and control of plant low-phosphorus tolerance

Abstract

The invention provides an oil tea CoPHO1; the invention discloses an application of an H3 gene in regulating and controlling low-phosphorus tolerance of plants, and belongs to the technical field of bioengineering. The oil tea is CoPHO1; the nucleotide sequence of the H3 gene is as shown in SEQ ID NO. 1. The oil tea is CoPHO1; the H3 gene is applied to regulation and control of plant low-phosphorus tolerance. The invention discloses the camellia oleifera CoPHO1 for the first time; according to the application of the H3 gene in regulating and controlling the low-phosphorus tolerance of the plant, an experiment carried out in a poplar poplar shows that CoPHO1 is over-expressed; the low-phosphorus tolerance of a poplar plant of the H3 gene can be remarkably improved.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, specifically to the application of the Camellia oleifera CoPHO1;H3 gene in regulating plant low phosphorus tolerance. Background Technology

[0002] The SPX (Syg1, Pho81, and Xpr1) gene family plays a crucial role in plant tolerance to low phosphorus levels, with mechanisms involving phosphorus uptake, translocation, and homeostasis. The PHO1;H3 gene contains a C-terminal SPX domain and an N-terminal EXS domain. Eleven SPX-EXS subfamily members (AtPHO1, AtPHO1;H1-H10) exist in Arabidopsis, while three members (OsPHO1;H1 / H2 / H3) exist in rice. These members are responsible for regulating phosphorus homeostasis by transferring phosphorus from the root xylem to the stem. In Arabidopsis, overexpression of AtPHO1 leads to a 2-3 fold increase in aboveground expression levels and significantly inhibits shoot development. In rice, OsPHO1;2 regulates phosphorus transport from roots to stems. Transient expression analysis in Nicotiana benthamiana indicates that while the EXS domain itself does not mediate phosphorus export, the EXS domain of PHO1 is essential. This indicates that the PHO1;H3 genes are conserved and are associated with low phosphorus response.

[0003] Camellia oleifera, also known as tea seed tree, tea oil tree, and white-flowered tea, is a high-quality woody oilseed tree species unique to southern my country. It has a long history of cultivation, a wide distribution area, a large planting area, and a wide range of uses. The main suitable habitat for Camellia oleifera is the hilly areas of southern China with acidic red soil, yellow soil, and yellow-brown soil, with a pH of 4.5-6.5. These areas suffer from a severe deficiency of inorganic phosphorus available for plant root absorption. Every year, large amounts of phosphate fertilizer are applied to Camellia oleifera fields to meet its own growth needs, which not only causes environmental and soil pollution but also results in very low levels of available phosphorus that the trees can absorb, thus affecting the quality of tea oil. Currently, research on genes related to low phosphorus response mainly focuses on herbaceous plants such as Arabidopsis thaliana, rice, and maize. For woody plants, especially Camellia oleifera, there is limited research on the function of genes related to low phosphorus tolerance. Existing studies have not explored in depth the key regulatory genes and mechanisms of action for low phosphorus tolerance in Camellia oleifera, and a detailed systematic study on the CoPHO1;H3 gene in low phosphorus tolerance in Camellia oleifera has not been reported.

[0004] Currently, there is a lack of applications for the CoPHO1;H3 gene from Camellia oleifera in regulating plant tolerance to low phosphorus. Summary of the Invention

[0005] In order to overcome the shortcomings of the prior art, the purpose of this invention is to provide an application of the Camellia oleifera CoPHO1;H3 gene in regulating plant low phosphorus tolerance.

[0006] To achieve the above-mentioned technical objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a Camellia oleifera CoPHO1;H3 gene.

[0007] Secondly, the application of the Camellia oleifera CoPHO1;H3 gene in regulating plant tolerance to low phosphorus.

[0008] Thirdly, the application of the Camellia oleifera CoPHO1;H3 gene in increasing plant biomass.

[0009] Fourthly, the present invention provides a method for cultivating low-phosphorus tolerant plants.

[0010] Fifthly, the present invention provides a transgenic plant obtained by transforming a woody model plant.

[0011] The first aspect of this application provides a Camellia oleifera CoPHO1;H3 gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0012] The second aspect of this application provides the application of the Camellia oleifera CoPHO1;H3 gene in regulating plant low phosphorus tolerance.

[0013] Furthermore, the nucleotide sequence of the Camellia oleifera CoPHO1;H3 gene is shown in SEQ ID NO.1.

[0014] Furthermore, regulating plant tolerance to low phosphorus is an application of enhancing plant tolerance to low phosphorus.

[0015] Furthermore, the plants are either dicotyledons or monocotyledons.

[0016] Furthermore, the dicotyledonous plants are Arabidopsis thaliana, tobacco, or tomato; the monocotyledonous plants are rice, wheat, or corn.

[0017] The third aspect of this application provides the application of the Camellia oleifera CoPHO1;H3 gene in increasing plant biomass.

[0018] The fourth aspect of this application provides a method for cultivating low-phosphorus tolerant plants, comprising introducing the Camellia oleifera CoPHO1;H3 gene into plant cells, and then cultivating the plant cells into transgenic plants.

[0019] Furthermore, plant cells can be fertilized eggs, callus tissue, or embryos.

[0020] The fifth aspect of this application provides a genetically modified plant obtained through this process.

[0021] Furthermore, the genetically modified plants are Arabidopsis thaliana, tobacco, rice, wheat, corn, tomato, or other crops and horticultural ornamental plants.

[0022] The present invention has the following beneficial effects: This invention discloses for the first time the application of the Camellia oleifera CoPHO1;H3 gene in regulating plant low phosphorus tolerance. Experiments conducted in Populus tomentosa showed that Populus tomentosa plants overexpressing the CoPHO1;H3 gene significantly increased low phosphorus tolerance.

[0023] Compared with the prior art, the present invention has the following advantages: (1) This invention successfully identified and cloned the Camellia oleifera CoPHO1;H3 gene, clarifying that it belongs to the SPX gene family. This gene plays an important role in Camellia oleifera's response to low phosphorus stress. Through gene cloning, expression and phylogenetic analysis, its position in plant evolution was revealed, filling the gap in the research of key genes for low phosphorus tolerance in Camellia oleifera, and providing an important theoretical basis for a deeper understanding of the mechanism of low phosphorus tolerance in Camellia oleifera.

[0024] (2) Studies have found that overexpression of the CoPHO1;H3 gene in Populus tomentosa can lead to an increase in plant biomass and significantly improve the plant's tolerance to low phosphorus. This indicates that the present invention provides a method for regulating plant tolerance to low phosphorus through gene manipulation, which has important application prospects. Plant tolerance to low phosphorus allows plants to complete their growth and development needs under lower phosphorus conditions, reducing resource waste and environmental pollution caused by external application of phosphate fertilizers, and helps to cultivate superior germplasm resources that are more tolerant to low phosphorus, thereby improving crop production efficiency and economic benefits.

[0025] (3) The possibility that the CoPHO1;H3 gene is conserved and has similar functions in a variety of plants indicates that the application scope of this invention is not limited to Populus tomentosa, but can also be extended to other crops and horticultural ornamental plants. By overexpressing or inhibiting this gene in different plants, it is expected to achieve the regulation of plant tolerance to low phosphorus, which has important practical significance for cultivating excellent germplasm resources that are tolerant to low phosphorus, and can provide strong technical support for plant genetic improvement and variety optimization of horticultural ornamental plants.

[0026] (4) This invention, through the study of the Camellia oleifera genome sequence and combined with various molecular biology techniques such as transcriptome sequencing, gene cloning, and phylogenetic analysis, systematically reveals the functions and mechanisms of action of genes related to low phosphorus response in Camellia oleifera. This not only enriches the molecular biology research content on plant tolerance to low phosphorus, but also provides valuable experience and reference for research on other plant genetic engineering, helps to promote technological innovation and development in the field of plant genetic engineering, and provides new ideas and methods for solving key problems in plant growth, development, and genetic improvement. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0028] Figure 1 This is a gel electrophoresis image of the CoPHO1;H3 gene amplification product of the present invention; Figure 2 The diagram shows the phylogenetic tree (A), subcellular localization (B), and expression analysis (C) of the CoPHO1;H3 gene in various tissues (root, stem, leaf, flower, and fruit) of this invention. Figure 3 This is a comparison diagram of the amino acid sequences of CoPHO1;H3 of the present invention with those of PHO1;H3 of other species. Figure 4 The diagram shows the steps of genetic transformation of the transgenic silver poplar (A) and the identification diagrams of the transgenic positive lines (B and C). Figure 5 Phenotypic (A), biomass (B), tolerance index (C), malondialdehyde content (D), and acid phosphatase activity (E) of wild-type Populus spp. and CoPHO1;H3 transgenic Populus spp. are shown. t-tests were performed, with a, b, c, and d indicating significance: P < 0.01. Detailed Implementation

[0029] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0030] In this application, the term "and / or" describes the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can represent: A existing alone, A and B existing simultaneously, or B existing alone. A and B can be singular or plural. The character " / " generally indicates that the preceding and following related objects have an "or" relationship.

[0031] In this application, "~ one less" means one or more, and "more than" means two or more. "~ one less item (item) below" or similar expressions refer to any combination of these items, including any combination of single items (items) or multiple items (items). For example, "~ one less item (item) in a, b, or c", or "~ one less item (item) in a, b, and c", can all mean: a, b, c, a~b (i.e., a and b), a~c, b~c, or a~b~c, where a, b, and c can be single or multiple.

[0032] It should be understood that in the various embodiments of this application, the order of the above processes does not imply the order of execution. Some or all steps may be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application.

[0033] Example 1 Obtaining the CoPHO1;H3 encoding gene from Camellia oleifera (1) RNA extraction RNA was extracted from a mixture of roots, stems and leaves of *Camellia oleifera* 'Changlin 166'. The total RNA was extracted using the Easy PlantRNA Kit (Zhejiang Easyplant Biotechnology Co., Ltd.) according to the instructions and stored at -80℃ for later use.

[0034] (2) Cloning of the CoPHO1;H3 gene The first strand of cDNA was synthesized using a reverse transcription kit (PrimeScript™ 1st Strand cDNA Synthesis Kit) (Takara Biotech (Beijing) Co., Ltd.). Take 2 μg of RNA sample, calculate the required RNA volume based on the RNA concentration, add 2 μL of 50 μM Oligo dT Primer, 2 μL of 10 mM dNTP Mixture, and add RNase-free ddH2O to a final volume of 20 μL. Mix the reagents thoroughly, incubate at 65°C for 5 min, and then rapidly cool on ice. Prepare 40 μL of reaction solution according to Table 1. The reaction system is as follows (Table 1): Table 1

[0035] Incubate at 42°C for 60 min, then at 95°C for 5 min, and place on ice. Obtain the cDNA template and store at -20°C.

[0036] The CoPHO1;H3 gene sequence was obtained based on the Camellia oleifera genome and transcriptome information. Specific primers for this gene were designed (CoPHO1;H3-F: ATGAAGTTCGGCAAAGAATTCGAG, SEQ ID NO.3; CoPHO1;H3-R: TCAATCATTTTTGTCCTCCTCTTC, SEQ ID NO.4). The CDS sequence was amplified using PrimeSTAR® Max DNA Polymerase (Takara Biotech (Beijing) Co., Ltd.). The PCR reaction system is shown in Table 2. Table 2

[0037] After slowly mixing the above mixture by pipetting, place it in a PCR instrument for amplification reaction. The reaction program is as follows: 98℃ for 5 min; 98℃ for 30 s; set the temperature according to the Tm value of the upstream and downstream primers, 30 s; 72℃, design the extension time according to 1 min / 1 Kb, for a total of 35 cycles; 72℃ for 5 min.

[0038] After the above reaction was completed, the target fragment (approximately 2406 bp) was obtained by agarose gel electrophoresis. Figure 1 After recovery and purification, the samples were sent for sequencing, and the results are shown in SEQ ID NO.1, which encodes 802 amino acids (as shown in SEQ ID NO.2). All primer synthesis and sequencing were performed at Zhejiang Shangya Biotechnology Co., Ltd.

[0039] Example 2 This invention relates to the application of the Camellia oleifera CoPHO1;H3 gene in regulating plant low phosphorus tolerance. The nucleotide sequence of the Camellia oleifera CoPHO1;H3 gene is shown in SEQ ID NO.1. The application involves regulating plant tolerance to low phosphorus. The plant can be a dicotyledonous or monocotyledonous plant. The dicotyledonous plants are Arabidopsis thaliana, tobacco, or tomato; the monocotyledonous plants are rice, wheat, or maize.

[0040] The present invention relates to the application of the Camellia oleifera CoPHO1;H3 gene in increasing plant biomass.

[0041] Functional analysis of the CoPHO1;H3 gene in Camellia oleifera (1) Sequence comparison analysis To analyze the phylogenetic relationship between *Camellia oleifera* CoPHO1;H3 and other species' CoPHO1;H3, a phylogenetic tree was constructed using MEGA7. The results showed that CoPHO1;H3 contains a typical SPX domain and an EXS domain, and that CoPHO1;H3 shares the highest homology with CsPHO1;H3 in the model plant *Camellia oleifera*. Figure 3 ).

[0042] (2) Carrier construction 1) Construction of the introductory carrier The obtained PCR products were ligated using the TA / Blunt-Zero Cloning Kit (Novizan Biosciences, Nanjing, China). The reaction system is shown in Table 3. Table 3

[0043] After gently mixing the reaction mixture, place it in a PCR instrument and react at 25°C for 5 minutes. After the reaction is complete, place it on ice.

[0044] The above ligation product was transformed into E. coli DH5α competent cells via heat shock, as detailed below: ① After removing the DH5α competent cells from the -80℃ ultra-low temperature freezer, quickly insert them into ice. It takes 2 minutes to thaw. Add the ligation product to the competent cells, gently touch the bottom of the centrifuge tube to mix, and let stand on ice for 20 minutes.

[0045] ② Heat shock for 90 seconds (water bath, 42℃), then quickly return to ice and let stand for 3 minutes. Try not to move the device during this process.

[0046] ③ Add 800 μL of antibiotic-free LB liquid medium to a centrifuge tube, mix by inverting, and incubate at 37°C for 60 min at 180 rpm.

[0047] ④ Centrifuge at 5000 rpm for 2 min at room temperature to collect bacterial cells, discard 700 μL of supernatant, resuspend the bacterial cells using a pipette and spread them on LB solid medium plates with the corresponding antibiotic selection (ampicillin, Amp).

[0048] ⑤ Invert the plate and place it in a 37°C incubator overnight for about 10-12 hours. Pick a single colony from the plate and transfer it to a 2.0 mL centrifuge tube. Add 500 μL of LB liquid medium containing ampicillin and place the tube in a 37°C incubator. Shake the tube at 220 rpm for incubation.

[0049] After the bacterial cells became turbid, they were validated by PCR using Green Taq mix. The reaction system is shown in Table 4. Table 4

[0050] After mixing the above reaction solution, place it in a PCR instrument for amplification. The reaction program is as follows: 94℃ for 5 min; 94℃ for 30 s; set the temperature according to the Tm value of the upstream and downstream primers, 30 s; 72℃, set the time according to 1 min / 1 kb, for a total of 35 cycles; 72℃ for 5 min.

[0051] The bacterial culture with the correct target band was sent to the company for sequencing. The sequencing results were compared using DNAMAN software. The result of a complete match was the constructed recombinant entry vector containing the target gene, named T-CoPHO1;H3, and stored at -20℃ as a template for subsequent amplification of the target gene.

[0052] 2) Construction of expression vector The plant overexpression vector pBI121 and the subcellular localization vector pMDC43 recombinant vector were constructed using homologous recombination. First, suitable restriction enzyme sites were selected for double digestion of the expression vectors. For example, the restriction enzyme sites selected for pBI121 were Sma I and Sac I. Referring to the restriction enzyme digestion temperature, the optimal digestion temperature was set in a constant temperature water bath for 2-3 h. Enzyme I and Enzyme II were added by 1 μL each to ensure complete digestion of the expression vector. The mixture was then incubated for 1-2 h for recovery and purification of the digestion products. The digestion reaction system is shown in Table 5. Table 5

[0053] Amplification primers for CoPHO1;H3 with relevant expression vector restriction sites were designed (Table 6). Using the T-CoPHO1;H3 recombinant plasmid as a template, PrimeSTAR was used for amplification. ® Max DNA Polymerase was used for PCR amplification to obtain the complete CDS sequence of CoPHO1;H3 containing the vector restriction sites. Gel electrophoresis and PCR product recovery and purification experiments were then performed. The CoPHO1;H3 insert was ligated to the relevant expression vector using homologous recombination. The reaction system is shown in Table 7. Table 6

[0054] Table 7

[0055] After thoroughly mixing the above ligation reaction mixture, place it in a PCR instrument for ligation reaction. The reaction program is 37℃, 30 min, 4℃, ∞. After the reaction, place it at 4℃ or on ice, and then transform E. coli DH5α competent cells by heat shock method. Further experiments such as bacterial culture PCR detection and sequencing were performed to obtain the correct recombinant plasmids, which were named pMDC43-CoPHO1;H3 and pBI121-CoPHO1;H3, respectively.

[0056] 3) Agrobacterium-mediated transformation First, the constructed recombinant expression vectors (pMDC43-CoPHO1;H3 and pBI121-CoPHO1;H3 plasmids) were transformed into Agrobacterium EHA105 using electroporation, as detailed below: ① Prepare multiple electroporation cups. First, clean them three times with ddH2O, then clean them three times with 75% anhydrous ethanol. Place them in a sterile workbench and sterilize them under UV light for 30 minutes, then blow off any residual anhydrous ethanol. Place the electroporation cups on ice to pre-cool them. At the same time, adjust the voltage of the Bio-Rad electroporator to 2.0 kV according to the instructions. Adjusting the voltage in advance helps stabilize the instrument's voltage and reduces the probability of Agrobacterium transformation failure due to the breakdown of the electroporation cups.

[0057] ② After removing the EHA105 competent cells from the -80℃ ultra-low temperature freezer, quickly insert them into the prepared ice. After they melt for about 2-3 minutes, add 2-3 μL of recombinant plasmid and mix gently with a pipette.

[0058] ③ Quickly transfer the mixture to a pre-cooled electric rotary cup, wipe the surface water dry with a paper towel, especially the water remaining at the bottom, perform the electric shock, and immediately place it on ice after completion.

[0059] ④ Add 850 μL of antibiotic-free LB liquid medium to the electroporation cup, gently mix by pipetting, and then transfer to a sterile centrifuge tube. Place the tube in a shaker at 28°C and 180 rpm for 2-4 h.

[0060] ⑤ Take 70 μL of bacterial suspension and spread it evenly on an LB solid medium plate containing Kan and rif (50 mg / L). Invert the plate and place it in a constant temperature incubator at 28℃. Remove it after 2-3 days.

[0061] ⑥ Pick a single colony and gently shake it in LB liquid medium containing the corresponding antibiotic. Perform bacterial PCR detection. Agrobacterium strains whose target band size matches the expected size are considered successfully transformed positive strains and can be used for subsequent experiments.

[0062] 4) Subcellular localization The successfully transformed Agrobacterium strain (pMDC43-CoPHO1;H3) was injected into Nicotiana benthamiana to observe the subcellular localization of the target gene. The specific steps are as follows: ① Add the positive strain and LB liquid medium containing the corresponding antibiotic at a ratio of 1:500 to a large conical flask, with a total volume of 8-10 mL. Incubate at 28℃ with a shaker at 180 rpm until OD (dose retardation). 600 At a concentration of 0.8-1.0, Agrobacterium activity is relatively good.

[0063] ② Centrifuge at 5000 rpm at room temperature for 5 min, add the prepared suspension to the collected bacterial cells, gently pipette to resuspend the bacterial cells, and OD 600 Adjust to 0.6-1.0. If there is a marker plasmid that needs to be co-transferred, follow the above method for shaking, collecting, and resuspending the bacteria, and adjust the OD value accordingly. 600 After adjusting to the same consistency, mix in equal proportions and let stand at room temperature for 2.5 hours.

[0064] ③ Select healthy tobacco seedlings that are about 4 weeks old and have not yet flowered. About 12 hours before injection, water them to ensure the leaves are fully open. Mix equal volumes of two bacterial cultures containing different plasmids. Make a small incision on the back of the leaf with a needle. After the bacterial solution has settled, use a 1mL syringe (without the needle) to draw up the solution. Select a vigorous, flat leaf, hold the front of the leaf with your left hand, and slowly push the syringe to allow the bacterial solution to penetrate from the back of the leaf. Mark the corresponding area on the front of the leaf with a marker.

[0065] ④ After the tobacco was injected, it was placed in the dark for 12 hours and then placed in a light incubator for 2 days.

[0066] ⑤ Use a laser confocal microscope to observe the location of fluorescent protein expression in the injected tobacco leaves.

[0067] 5) Obtaining genetically modified silver poplar Transgenic silver poplar was obtained by using the successfully transformed Agrobacterium strain (pBI121-CoPHO1;H3) via Agrobacterium-mediated leaf infection. The operation steps are as follows: ① Agrobacterium preparation: The constructed Agrobacterium strain was activated on YM solid medium containing Kan and Rif, cultured at 28℃ for 3 days, and the bacterial cells were resuspended in the infection solution for infection. ② Infecting poplar leaves: Select the third or fourth healthy leaf with a growth cycle of about 4 weeks, cut off the leaf tip and petiole with a sterilized scalpel, make 3-4 cuts with the scalpel in the direction perpendicular to the main vein, place the leaf in a heavy suspension liquid, shake gently, infect for 15 minutes, shake several times during the period, and then place the leaf on sterile filter paper for adsorption. ③ Poplar dark culture: The infected silver-gray poplar leaves were placed face down on a solid culture medium containing As and cultured at 28℃ for 3 days. ④ Poplar selection and differentiation culture: Transfer the leaves to a selection and differentiation medium containing the corresponding antibiotics, and change the medium every three days; ⑤ Poplar seedling cultivation: After about one month of cultivation on the differentiation medium, the differentiated seedlings can be transferred to a seedling cultivation medium containing the corresponding antibiotics; ⑥ Poplar rooting culture: Once the seedlings have grown slightly, cut them off individually and place them in a rooting medium containing the appropriate antibiotics. After about two weeks, the seedlings will have developed roots. Transfer the seedlings to sterile culture soil to harden them off, and wait for their growth to stabilize before using them for the next experiment.

[0068] The culture medium formulas for the entire transformation process of poplar trees are shown in Table 8: Table 8

[0069] ⑦ Genomic DNA was extracted from wild-type and transgenic Populus simonii using the CTAB method. Specific detection primers were designed to verify the transgenic Populus simonii. The plasmid was used as a positive control, and the DNA of wild-type Populus simonii was used as a negative control. Finally, transgenic Populus simonii plants with positive PCR identification results were obtained through screening.

[0070] 6) Low phosphorus treatment of transgenic poplar lines ① Low phosphorus treatment: Genetically modified silver-gray poplar positive lines were aseptically propagated in large numbers. Aseptic seedlings with consistent growth after approximately one month of rooting were used for hydroponic experiments. In the early stages of hydroponics, the plants were slightly pruned and covered with a transparent plastic cover to prevent drying out. After the seedlings had adapted for one week, the cover was removed, and the solution was replaced with a modified Hogland nutrient solution containing normal phosphorus (NP, 1 mM) and low phosphorus (LP, 5 μM). An air pump was added to the water to prevent root rot. Each line was replicated in triplicate.

[0071] ② Samples were taken four weeks after low-phosphorus treatment, and the corresponding indicators were measured: root length was measured with a ruler and the total number of roots was counted using a root scanner; the fresh weight and dry weight of the plants were weighed separately, with each plant as a replicate, and at least three replicates were performed. The dry weight was measured after drying. Determination of malondialdehyde (MDA) content: 0.1 g of sample was taken, 1 ml of extraction solution was added and mixed well, centrifuged at 4℃ × 12,000 rpm for 10 min, the supernatant was collected and placed on ice for testing, and the corresponding reagents were added according to the kit instructions and measured at wavelengths of 532 nm and 600 nm.

[0072] Determination of acid phosphatase content: According to the Suzhou Greens reagent kit, take 0.1g of sample, add 1ml of extraction solution and mix well. Centrifuge at 4℃×12000 rpm for 10 minutes, and put the supernatant on ice for testing. Add the appropriate amount of reagent according to the instructions and measure at a wavelength of 405 nm.

[0073] 3. Experimental Results 3.1 Subcellular localization analysis of CoPHO1;H3 To determine the expression location of the CoPHO1;H3 protein, homologous recombination was used to construct the expression vector pMDC43 with the CaMV 35S promoter, which was then fused with the GFP protein. The successfully sequenced recombinant plasmid was transduced into tobacco leaves for transient expression, and the location of the green fluorescence signal was observed under a laser confocal microscope. The results showed that the GFP signal of the empty vector was distributed intracellularly, while CoPHO1;H3 was distributed on the cell membrane. Figure 2 B).

[0074] 3.2 Analysis of the expression patterns of CoPHO1;H3 in different tissues of Camellia oleifera The expression patterns of the CoPHO1;H3 gene in different tissues (roots, stems, leaves, flowers, and fruits) of Camellia oleifera were analyzed by qRT-PCR. Figure 2 (C) The results showed that CoPHO1;H3 exhibited significant tissue specificity, with higher expression levels in roots and leaves and the lowest expression level in fruit. Therefore, it is speculated that the CoPHO1;H3 gene may be crucial in the low phosphorus tolerance of Camellia oleifera roots.

[0075] 3.3 Phenotypic analysis of CoPHO1;H3 transgenic plants After obtaining the CoPHO1;H3 transgenic poplar plants, we obtained a total of 8 positive seedlings through a series of genetic differentiation and PCR identification of genomic DNA. Subsequently, we selected two high-expressing transgenic poplar lines for further experiments using qRT-PCR analysis. Figure 4 Using wild-type Populus spp. as a control, these transgenic lines were treated together with Hogland nutrient solution modified with normal phosphorus (NP, 1 mM) and low phosphorus (LP, 5 μM) for low phosphorus treatment. Figure 5 Studies have found that under low phosphorus conditions, transgenic plants suffer less damage from low phosphorus levels. Figure 5 A), the biomass of transgenic plants is greater than that of wild-type (PC-WT) ( Figure 5 B), the root and leaf tolerance indices are also higher than PC-WT ( Figure 5 C), MDA content decreased ( Figure 5 D), Root acid phosphatase activity increased ( Figure 5E). These results indicate that overexpression of CoPHO1;H3 improves the tolerance of transgenic poplar to low phosphorus.

[0076] Example 3 This invention discloses a method for cultivating low-phosphorus-tolerant plants, comprising introducing the Camellia oleifera CoPHO1;H3 gene into plant cells, and then cultivating the plant cells into transgenic plants. The plant cells are fertilized eggs, callus tissue, or embryos.

[0077] Example 4 This invention relates to a transgenic plant obtained through genetic modification. The transgenic plant is *Populus simonii*.

[0078] Example 5 The difference between Example 5 and Example 4 is that the transgenic plant is tobacco.

[0079] Example 6 The difference between Example 6 and Example 4 is that the transgenic plant is rice.

[0080] Example 7 The difference between Example 7 and Example 4 is that the transgenic plant is wheat.

[0081] Example 8 The difference between Example 8 and Example 4 is that the transgenic plant is corn.

[0082] Example 9 The difference between Example 9 and Example 4 is that the genetically modified plant is a tomato.

[0083] Example 10 The difference between Example 10 and Example 4 is that the transgenic plant is a horticultural ornamental plant.

[0084] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A Camellia oleifera CoPHO1;H3 gene, characterized in that, The nucleotide sequence of the Camellia oleifera CoPHO1;H3 gene is shown in SEQ ID NO.

1.

2. The application of the Camellia oleifera CoPHO1;H3 gene as described in claim 1 in regulating plant low phosphorus tolerance.

3. The application according to claim 1, characterized in that: The regulation of plant low phosphorus tolerance is an application to improve plant tolerance to low phosphorus.

4. The application according to claim 1, characterized in that: The plant is a dicotyledonous plant or a monocotyledonous plant.

5. The application according to claim 4, characterized in that: The dicotyledonous plants are Arabidopsis thaliana, tobacco, or tomato; the monocotyledonous plants are rice, wheat, or corn.

6. The application of the Camellia oleifera CoPHO1;H3 gene as described in claim 1 in increasing plant biomass.

7. A method for cultivating low-phosphorus tolerant plants, comprising introducing the Camellia oleifera CoPHO1;H3 gene of claim 1 into plant cells, and then cultivating the plant cells into transgenic plants.

8. The method according to claim 7, characterized in that: The plant cells are fertilized eggs, callus tissue, or embryos.

9. A transgenic plant obtained by the method of claim 7 or 8.

10. The transgenic plant according to claim 9, characterized in that: The genetically modified plants are Arabidopsis thaliana, tobacco, poplar, rice, wheat, corn, tomato, or other crops and horticultural ornamental plants.

Images