Mmr1 protein for regulating ros homeostasis in root tip meristem of plants, gene encoding the same and application
By regulating the MMR1 gene, which regulates ROS homeostasis in plant root tips, the root growth problem caused by mitochondrial dysfunction was solved, resulting in a significant improvement in root growth and breeding potential, filling the gap in mitochondrial protein regulation of root development and ROS homeostasis.
Patent Information
- Application Number
- CN202511495216.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-20
- Publication Date
- 2026-01-06
- Estimated Expiration
- 2045-10-20
AI Technical Summary
In existing technologies, mitochondrial dysfunction leads to an imbalance in ROS homeostasis in the root tip meristem of plants, affecting root growth and development, and there is a lack of effective gene regulation methods.
The MMR1 gene and its homologs are provided. By inserting or deleting nucleotide sequences, the ROS homeostasis of plant root tips can be regulated, affecting the development of the root meristematic zone. This can be applied to overexpression or knockout techniques to regulate root growth.
By regulating root tip ROS homeostasis, it significantly affects root growth, provides new genetic resources, enhances the potential for root improvement and transgenic breeding, and verifies the high conservation and function of MMR1 protein in different plants.
Smart Images

Figure CN120944918B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering, specifically to the MMR1 protein that regulates ROS homeostasis in the root tip meristem of plants, its encoding gene, and its applications. Background Technology
[0002] Plant roots, as the key organs connecting plants and soil, bear the important responsibility of anchoring the plant and absorbing nutrients. Plant roots are mainly divided into the meristematic zone, elongation zone, and maturation zone. Among them, the root tip meristem, which is the core area for the continuous growth and development of plant roots, plays a decisive role in the morphology of the root system by constantly providing new cells to the root system with its active cell division ability.
[0003] Mitochondria, as the "energy factories" of cells, are indispensable for the normal physiological activities of the entire plant. In plant cells, mitochondria produce ATP through aerobic respiration to provide energy for various metabolic activities. At the same time, mitochondria also participate in many important metabolic pathways, such as the tricarboxylic acid cycle and fatty acid metabolism, maintaining the balance of intracellular metabolism. When mitochondrial function is impaired, insufficient energy supply and metabolic disorders directly hinder the cell division process in the root tip meristem, leading to root growth stagnation and affecting the normal formation of root morphology (Yan et al., 2024).
[0004] Reactive oxygen species (ROS), a class of oxygen molecules and their derivatives with high chemical reactivity, exist as a double-edged sword in plant cells. A complex and sophisticated ROS homeostasis system exists within plants, precisely regulating ROS production and scavenging to ensure appropriate ROS levels within cells, thereby achieving precise regulation of plant growth, development, and stress responses (Mittler et al., 2022). In plant roots, mitochondria are the main organelles producing ROS. When plants are subjected to biotic or abiotic stresses, abnormal mitochondrial function disrupts the homeostasis of ROS within cells (Mittler, R., Zandalinas, SI, Fichman, Y. et al. Reactive oxygen species signalling in plant stress responses. Nat Rev MolCell Biol 23, 663–679 (2022). https: / / doi.org / 10.1038 / s41580-022-00499-2). Excessive ROS can cause oxidative damage to intracellular biomolecules such as nucleic acids, proteins and lipids, interfering with normal cellular physiological functions and affecting cell division and root elongation in the root apical meristem (Tsukagoshi, H., Busch, W. & Benfey, PN (2010) Transcriptional regulation of ROS controls transition from proliferation to differentiation in the root. Cell, 143, 606–616.).
[0005] Recent studies have revealed that ROS is a key bridge mediating mitochondrial function and root meristem development. The research by Yan et al. (J. Yan, Z. Feng, Y. Xiao, M. Zhou, X. Zhao, X. Lin, W. Shi, W. Busch, & B. Li, ANAC044 orchestrates mitochondrial stress signaling to trigger iron-induced stem cell death in root meristems, Proc. Natl. Acad. Sci. USA 122 (1)e2411579122, https: / / doi.org / 10.1073 / pnas.2411579122 (2025)) demonstrates that the GSNOR-mediated mitochondrial-ROS signaling pathway can respond to iron toxicity stress by regulating root tip stem cell death, validating the reliability of the mitochondrial-ROS-root tip meristem coordination mechanism. However, the key genes in mitochondria that maintain ROS homeostasis and thus regulate plant root growth and development remain to be discovered. Summary of the Invention
[0006] The purpose of this invention is to provide the application of the MMR1 gene in maintaining root tip ROS homeostasis to regulate plant root length. This invention fills the gap in the field of mitochondrial-localized protein regulation of root development and ROS homeostasis, and provides new genetic resources for root improvement and transgenic breeding.
[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0008] This invention provides the application of the MMR1 gene or its homologous gene in maintaining root tip ROS homeostasis and regulating plant root length. The MMR1 gene is the Arabidopsis MMR1 gene, and the nucleotide sequence of the coding region of the Arabidopsis MMR1 gene is shown in SEQ ID NO.2.
[0009] This invention provides a gene encoding a mitochondrial-localized protein that regulates the development of the root tip meristem in plants—the MMR1 gene. By inserting or deleting one or more base pairs in its DNA sequence, it can inhibit the development of the root meristem in plants and alter the ROS in the root tip meristem. This fills the gap in the field of mitochondrial-localized protein regulation of root development and ROS homeostasis, providing new genetic resources for root improvement and transgenic breeding.
[0010] The present invention provides the application of Arabidopsis MMR1 gene or its homologous gene in controlling root growth by regulating cell division in the root tip meristem.
[0011] The present invention also provides the application of the protein encoded by the MMR1 gene or the protein encoded by its homologous gene in maintaining ROS homeostasis in the root meristem and regulating plant root length, wherein the MMR1 gene is the Arabidopsis MMR1 gene, and the amino acid sequence of the protein encoded by the Arabidopsis MMR1 gene is shown in SEQ ID NO.3.
[0012] The genomic nucleotide sequence of the Arabidopsis MMR1 gene is shown in SEQ ID NO.1.
[0013] Due to the specific nature of nucleotide sequences, any variant of the genomic nucleotide sequence shown in SEQ ID NO.1 and the coding region nucleotide sequence shown in SEQ ID NO.2, provided that it shares more than 90% homology with the polynucleotide, falls within the scope of protection of this invention. The variant of the polynucleotide refers to mutants, alleles, and derivatives generated by adding, substituting, inserting, or deleting one or more nucleotides from the polynucleotide sequence.
[0014] Due to the specificity of amino acid sequences, any fragment of a polypeptide or its variants containing the amino acid sequence shown in SEQ ID NO. 3, such as its conserved variants, bioactive fragments, or derivatives, are within the scope of protection of this invention, provided that the fragment or polypeptide variant shares more than 95% homology with the aforementioned amino acid sequence. Specifically, the alterations may include the deletion, insertion, or substitution of amino acids in the amino acid sequence; wherein, for conserved alterations of variants, the substituted amino acid has a similar structure or chemical properties to the original amino acid, such as replacing isoleucine with leucine; variants may also have non-conserved alterations, such as replacing glycine with tryptophan.
[0015] The homologous gene is the rice MMR1 gene, and the nucleotide sequence of the coding region of the rice MMR1 gene is shown in SEQ.ID.NO.5.
[0016] Furthermore, the Arabidopsis MMR1 (Meristem, Mitochondria, ROS) gene ID is AT5G42150, and the rice MMR1 gene ID is Os4g0244400.
[0017] Furthermore, the application of overexpression of the MMR1 gene or its encoded protein in promoting root elongation in plants, wherein the MMR1 gene is the Arabidopsis MMR1 gene. The nucleotide sequence of the coding region of the Arabidopsis MMR1 gene is shown in SEQ ID NO 2, and the amino acid sequence of the protein encoded by the Arabidopsis MMR1 gene is shown in SEQ ID NO 3.
[0018] This invention also provides the application of the MMR1 gene or its homologous gene in plant breeding. In application, the MMR1 gene is the Arabidopsis MMR1 gene, and plants that express the Arabidopsis MMR1 gene or its homologous gene are screened. The nucleotide sequence of the coding region of the Arabidopsis MMR1 gene is shown in SEQ.ID.NO.2.
[0019] The present invention also provides the application of the protein encoded by the MMR1 gene or the protein encoded by its homologous gene in plant breeding. When applied, the MMR1 gene is the Arabidopsis MMR1 gene, and plants that express the protein encoded by the Arabidopsis MMR1 gene or the protein encoded by its homologous gene are screened. The amino acid sequence of the Arabidopsis MMR1 gene is shown in SEQ ID NO.3.
[0020] The plant is a monocotyledonous or dicotyledonous plant. Further, the plant may be Arabidopsis thaliana, rice, cucumber, tomato, or soybean.
[0021] Furthermore, the plant is a monocotyledonous plant or a dicotyledonous plant.
[0022] This invention verifies the ability to obtain knockout MMR1 genes using CRISPR / Cas9 technology. mmr1 The mutant showed significantly shorter root length and root tip meristem, reduced cell division capacity, and decreased reactive oxygen species (ROS) content in the root tip meristem. However, the reintroduced lines recovered the normal phenotype, and the gene was located in the mitochondria. Overexpressing lines of Arabidopsis thaliana were constructed, and the roots of these overexpressing lines were longer than those of the wild type. Similarly, knocking out the homologous MMR1 gene in rice also resulted in a shorter root length phenotype, and the homologous reintroduced rice MMR1 protein was restored in Arabidopsis thaliana. atmmr1 The -2 mutant exhibits a longer root phenotype, and the rice MMR1 protein is located in mitochondria, indicating that MMR1 is highly conserved across species. In summary, this invention provides a theoretical basis for developing the function of MMR1 protein in regulating root growth in different species, and has significant potential for molecular breeding applications. It also provides gene resources for developing new crop varieties that regulate plant root development.
[0023] Compared with existing technologies, this invention is the first to discover and disclose that the plant mitochondrial protein MMR1 has the function of regulating root meristem development and ROS homeostasis, while MMR1 is highly conserved in evolution. This invention provides valuable gene resources for in-depth research on the function of MMR1 protein in different plants. Since both monocotyledonous rice and dicotyledonous Arabidopsis thaliana exhibit the same mitochondrial localization and short root phenotype, it also has great guiding value and application potential for molecular breeding practices in crops. Attached Figure Description
[0024] Figure 1This is a schematic diagram of the Arabidopsis thaliana AT5G42150 (MMR1) gene structure in Example 1. mmr1-1, mmr1-2 The specific mutation type and location of the mutant;
[0025] Figure 2 Wild-type Col-0 and wild-type Col-0 germinated in 1 / 2 MS medium for 6 days in Example 1 mmr1 Representative photographs of the root length of the mutant and statistical results of root length, scale bar 1 cm;
[0026] Figure 3 Wild-type Col-0 and wild-type Col-0 germinated in 1 / 2 MS medium for 6 days in Example 1 mmr1 Photographs of the root meristem after PI staining of the mutant, including the length and number of cells in the root apical meristem. Figure 3 A and Figure 3 B in Figure 3 (C) and representative images of mature cells and the length of mature cells (in the image). Figure 3 D and Figure 3 E) Statistical results: In Figure A, the white asterisk indicates the quiescent center, and the white arrow indicates the end position of the root tip meristem. In Figure D, the white asterisk indicates mature cells. Scale bar: 100 μm.
[0027] Figure 4 The GUS staining results of the cell division cycle reporter gene CYCB1 wild-type and CYCB1 wild-type were obtained 6 days after germination in 1 / 2 MS medium in Example 1. mmr1 Representative photographs of CYCB1 activity in mutants and statistical results of GUS staining area, scale bar 100 μm;
[0028] Figure 5 Arabidopsis thaliana was observed using a confocal microscope (LSM880) after germination in 1 / 2 MS medium for 6 days, as described in Example 2. MMR1 Gene complementation materials and mitochondrial reporter genes Mito-YFP Co-location results, scale bar 20 μm;
[0029] Figure 6 The wild-type Col-0 and wild-type Col-0 were 6 days after germination on Yamagami medium in Example 1. mmr1 Representative photos and statistical results of root length of mutant and gene-added transgenic plants (#6 / #9 / #11), scale bar 1 cm;
[0030] Figure 7 For example, wild-type Col-0 and wild-type Col-0 were grown on Yamagami medium 6 days after germination in Example 2. MMR1 Overexpression transgenic plants ( UBQ 10 ::MMR1 cds #1 / #7 / #8Representative photos of root length and statistical results of root length, scale bar 1 cm;
[0031] Figure 8 The wild-type Col-0 and wild-type Col-0 were 6 days after germination on Yamagami medium in Example 1. mmr1 Representative images of DAB staining of mutants and statistical results of staining gray values, scale bar 100 μm;
[0032] Figure 9 For different species in Example 3 MMR1 Gene conservation analysis;
[0033] Figure 10 For example, wild-type Col-0 and wild-type Col-0 were germinated on 1 / 2 MS medium 6 days after germination in Example 4. mmr1 Mutants and Homologous Replenishment Rice OsMMR1 Representative photographs and statistical results of root length of transgenic plants (#4, #6, #12) after gene transplantation, scale bar 1 cm ( Figure 10 A and Figure 10 (B) Homologous regeneration rice was observed using a confocal microscope (LSM880) 6 days after 1 / 2 MS germination. OsMMR1 Genes in the roots of Arabidopsis thaliana OsMMR1 Subcellular localization, scale bar 10 μm ( Figure 10 (C in the middle)
[0034] Figure 11 Rice in Example 4 mmr1 A diagram illustrating the specific genetic transformation process used to obtain mutants;
[0035] Figure 12 Rice in Example 4 MMR1 Gene structure diagram and Osmmr1-1, Osmmr1-2 The specific mutation type and location of the mutant;
[0036] Figure 13 In Example 4, after germination for 5 days, wild-type rice ZH11 and Osmmr1 Representative photos of root length of mutant strains and statistical results of root length, scale bar 1 cm. Detailed Implementation
[0037] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:
[0038] Example 1: Arabidopsis thaliana MMR1 homozygous mutants of genes
[0039] (1) Arabidopsis thaliana MMR1 Obtaining homozygous mutants of genes
[0040] Using the target design website: http: / / crispr.hzau.edu.cn / CRISPR2 / , the Arabidopsis gene AT5G42150 was designed. MMR1 The target sequence was homologously recombinated with a linearized vector containing the Cas9 enzyme to construct and sequence a plasmid. The plasmid was then transformed into the Agrobacterium strain GV3101 and further infected into wild-type Col-0 using the Arabidopsis transformation system via flower-dipping, resulting in T0 generation plants. After harvesting T0 generation seeds, positive seedlings were selected through plant resistance-hygromycin resistance screening, resulting in T1 generation plants. Twelve positive T1 generation plants were selected, planted in soil, and harvested by division, resulting in T2 generation. Forty-eight seedlings from each T2 generation line were sown on a 1 / 2 MS plate, and DNA was extracted from each plant for sequencing to verify the existence of homozygous mutations between the two target sites of CRISPR / Cas9 knockout. Based on this, two homozygous mutant lines were harvested and named... mmr1-1, mmr1-2, For specific mutation types and target sequences, see Figure 1 .
[0041] (2) MMR1 Mutant phenotypic analysis
[0042] The two homozygous mutant lines obtained in Example 1 mmr1-1, mmr1-2 Simultaneously sown with wild-type Col-0 plants on 1 / 2 MS medium, seedlings were photographed and statistically analyzed after 6 days. The results showed that the two... mmr1 The root length of the mutant strain is significantly shorter than that of the wild-type Col-0 plant. Figure 2 ), PI staining results showed that, mmr1 The root tip meristem development of the mutant was significantly inhibited, and mmr1 The length of the mature cell region in the mutant was not significantly different from that in the wild type. Figure 3 Constructing mutants mmr1-1 CYCB1, a cell division cycle reporter gene, in the background pCYCB1:GUS / mmr1-1 GUS staining results ( Figure 4 )show, mmr1-1 The mutant exhibits decreased cell division activity.
[0043] Therefore, the present invention discloses MMR1 Genes are used to control root growth by regulating cell division in the root tip meristem.
[0044] (3) mmr1 Analysis of ROS content in the root meristem of mutants
[0045] The two homozygous mutant lines obtained in Example 1 mmr1-1, mmr1-2 Sowed simultaneously with wild-type Col-0 plants on Yamagami medium, seedlings 6 days old mmr1-1, mmr1-2 DAB staining was performed with Col-0 (DAB-3,3'-diaminobenzidine; principle: DAB reacts with hydrogen peroxide produced in plant tissues under the catalysis of peroxidase, producing a brownish-red insoluble substance). For example... Figure 8 The results showed that the mutant mmr1-1, mmr1-2 The ROS content in the root tip meristem was significantly lower than that in the Col-0 root meristem, further demonstrating the innovation of this invention. It is the first time that the application of plant mitochondrial proteins in influencing ROS homeostasis in the root meristem has been discovered.
[0046] In Example 1, the present invention also explored the use of hydrogen peroxide histochemical staining—DAB histochemical staining method. mmr1 Changes in ROS content in the root tip meristem of mutants: Compared with wild type, mutants mmr1-1, mmr1-2 All showed a decrease in ROS content in the root tip meristem.
[0047] Example 2: Arabidopsis MMR1 replacement transgenic plants
[0048] (1) Obtaining Arabidopsis MMR1 complemented transgenic plants
[0049] To more intuitively demonstrate the protein localization of the mitochondrial protein gene MMR1 and its function in regulating root growth disclosed in this invention, this embodiment provides a practical application example of the Arabidopsis thaliana mitochondrial gene MMR1, namely, constructing... MMR1 Self-starter driver MMR1 Genomic vector pMMR1::MMR1-mRFP We also directly observed the gene function of MMR1-replenished root length in plants.
[0050] carrier pMMR1::MMR1-mRFP Sequence Design
[0051] Download from the Arabidopsis thaliana database TAIR. MMR1 The genome sequence of (AT5G42150) SEQ.ID.NO.2 and promoter sequence SEQ.ID.NO.4 (selecting the 1428 bases before the start codon ATG of AT5G42150) were imported into the Takara vector design website (https: / / www.takarabio.com / ). Using pCAMBIA1300 as a vector template, a vector was designed using EcoRI and SalRI double restriction sites. pMMR1::MMR1-mRFP Primer sequences were obtained. The primer sequences were sent to Sangon Biotech Co., Ltd. for synthesis.
[0052] MMR1 Cloning of gene self-promoters and genome sequences
[0053] Genomic DNA was extracted from Col-0 using the CTAB method. This DNA was then used as a template to select from the Arabidopsis thaliana database Tair. MMR1 Self-starter sequence design MMR1 Promoter amplification primers for amplification MMR1 Self-promoter, using MMR1 Genomic amplification primer amplification MMR1 Genomic sequence. The amplification enzyme used was the high-fidelity enzyme 2*Phanta FlashMaster Mix (catalog number: P510-01) from Novizan Biosciences Inc. The primer sequences, PCR reaction system, and reaction procedure are as follows:
[0054] Amplification MMR1 The self-promoter primer sequence is as follows:
[0055] 1300-F1-pMMR1:tatgaccatgattacgaattcGTTATGATCTTCCAATCATTCATATATAGTCT
[0056] pMMR1-R1-MMR1: actctcctcatAGCTTGTGGCGGAAGATGAG
[0057] The primer sequences for amplifying the MMR1 genome are as follows:
[0058] pMMR1-F2-MMR1: ccacaagctATGAGGAGAGTCACCGGACTTG
[0059] MMR1-R2-mRFP: ctcggaggaggccatgtcgacTTCTTTGATCCTAGAAGGTTCTCCG
[0060] The PCR reaction system is shown in Table 1:
[0061] Table 1 PCR reaction system
[0062]
[0063] PCR reaction program: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 60℃ annealing for 5 s, 72℃ extension for 30 s (15 s / kb), 32 cycles; complete extension for 1 min.
[0064] The above PCR amplification primers were analyzed by 1.5% agarose gel electrophoresis, and the target fragment was recovered by gel excision. MMR1 Gene self-promoter fragments and genome fragments.
[0065] Build pMMR1::MMR1-mRFP plasmid
[0066] The recovered enzyme was processed using a homologous recombinase (purchased from Novizan Biotechnology Co., Ltd., catalog number C115-01). MMR1 The promoter and the target genomic fragment were ligated together into a digestion enzyme digested with EcoRI / SalI. pCAMBIA1300-mRFP The vector linear segment is obtained pMMR1::MMR1-mRFP The vector was then transformed into DH5α competent cells in the large intestine, plated onto LB medium with 50 μg / mL Kan medium, and cultured overnight at 37°C. Single clones were picked and cultured in 1 mL LB medium with 50 μg / mL Kan liquid at 37°C for 8-10 h. The clones were then sent to the sequencing department of Sangon Biotech for sequencing. If the sequencing was correct, the plasmid of the correct single clone was extracted, which is the... pMMR1::MMR1-mRFP Plasmid.
[0067] MMR1 Replenishing the acquisition of genetically modified plants
[0068] (1) The above pMMR1::MMR1-mRFP The plasmid was transformed into Agrobacterium strain (GV3101), and the mutant was introduced via inflorescence dipping method. mmr1-2 In the process, T1 generation seeds were harvested and sown on hygromycin-resistant 1 / 2 MS medium to screen for positive plants. The expression of red fluorescent protein in the positive seedlings was confirmed using a stereomicroscope. Further screening yielded at least three homologous T3 generation transgenic plants, which were then considered... MMR1 Replenish genetically modified plants.
[0069] (2) Localization of Arabidopsis MMR1 protein
[0070] The result obtained in Example 3 MMR1 Replenishment strains pMMR1::MMR1-mRFP / mmr1-2 Purebred strains with green fluorescent mitochondrial marker genes Mito-YFP (ID:CS16264) Plants were hybridized, and F1 seeds were harvested. These seeds were sterilized with 10% sodium hypochlorite, vernalized at 4°C for two days, and then sown onto 1 / 2 MS medium. At 6 days of seedling age, the localization of MMR1 protein in F1 cells was observed using a laser confocal microscopy LSM880. Figure 5 (Scale bar is 20 μm) As shown, mRFP fluorescence (magenta) overlaps with GFP fluorescence (green), indicating that MMR1 protein fluorescence and mitochondrial reporter gene fluorescence are co-localized, and MMR1 protein is located in mitochondria.
[0071] (3) Arabidopsis thaliana MMR1 Phenotypic analysis of genetically modified plants
[0072] The samples screened in Example 2 pMMR1::MMR1-mRFP / mmr1-2 Purebred strains, with Col-0 and mutants mmr1-2 The seeds were sown together on Yamagami medium (Shikanai, Y., Yamagami, M., Shigenobu, S., Yamagami, K., Kamiya, T., & Fujiwara, T. (2015). Arabidopsis thaliana PRL1 is involved in low-calcium tolerance. Soil Science and Plant Nutrition, 61(6), 951–956. https: / / doi.org / 10.1080 / 00380768.2015.1086277) (Shikanai et al., 2015). After 6 days of seedling growth, root length phenotypic images were taken and statistical analysis was performed. The results are as follows: Figure 6 As shown, pMMR1::MMR1-mRFP / mmr1-2 The root lengths of all three homozygous lines were able to recover to the Col-0 root length. This indicates that Arabidopsis thaliana... MMR1 Genes can regulate root growth.
[0073] (4) Arabidopsis thaliana MMR1 Overexpression vector pGreen-UBQ 10 ::MMR1 cds Obtaining transgenic plants and analyzing root length phenotype
[0074] Using the built pGreen-UBQ10::MMR1 cds carrier ( Figure 8 The bacteria were transferred into Agrobacterium and the Col-0 plants were infected using the Arabidopsis thaliana flower-dipping method. T1 generation seeds were harvested and... pGreen The 0229 binary vector carries an mCherry red fluorescent tag fusion protein expression element containing the aquaporin PIP2A (AT3G53420). Therefore, seeds emitting red fluorescence can be selected using a stereomicroscope via the red fluorescence channel, indicating positive T1 generation seeds. T1 seeds are sown in soil, and T2 generation seeds are harvested. The T2 lines with a 3:1 ratio of red-glowing to non-glowing seed coats are then selected using a stereomicroscope via the red fluorescence channel (chi-square test). p <0.05). Sow again in the soil and harvest T3 seeds. Under a stereomicroscope, T3 seeds with a completely reddish seed coat are considered purebred lines and can be used for subsequent experiments.
[0075] The three selected homozygotes UBQ10::MMR1 cds The strain was sown simultaneously with Col-0 in Yamagami medium, such as Figure 7 As shown, at 6 days of seedling age, MMR1 The root lengths of all three gene-overexpressing lines were significantly longer than those of Col-0. This indicates the potential for significantly improving root growth in Arabidopsis thaliana through gene overexpression.
[0076] In Example 2, the Uniprot protein prediction website revealed that MMR1 is located in mitochondria. By constructing a gene-reinforced line, the reinforced line restored the mutant's phenotype of shorter root length, and the MMR1 protein was located in Arabidopsis thaliana mitochondria.
[0077] In Examples 1 and 2, the present invention utilizes CRISPR / Cas9 technology for... MMR1 Gene knockout was performed to obtain stable transgenic Arabidopsis lines. mmr1-1, mmr1-2 Transgenic lines were constructed and overexpression lines were identified. Phenotypic traits of the transgenic lines were determined, including changes in root length, root tip meristem length, and root tip division ability in different materials. Compared to the wild type, the mutants... mmr1-1, mmr1-2 This manifests as shorter root length, a shorter root apical meristem, and weakened root apical division ability; the roots of overexpressing lines are longer than those of wild types, indicating... MMR1 Genes play important roles in root elongation, root apical meristem development, and root apical meristem cell activity in Arabidopsis thaliana.
[0078] Example 3: MMR1 Analysis of gene conservation in plant populations
[0079] To further understand MMR1 To assess evolutionary conservation in plant populations, amino acid sequences of target genes from multiple species were downloaded from the PLAZA database (https: / / bioinformatics.psb.ugent.be / plaza / versions / plaza_v5_dicots / ), and multiple sequence alignment (MSA) was performed on the selected genes using MAGE software. Subsequently, a phylogenetic tree was constructed using the maximum likelihood method, and missing data in the sequences were completely deleted. To evaluate the stability of the phylogenetic tree, a bootstrap method was used, with 1000 repetitions. Finally, all results were visualized in MAGE and iTOL. Figure 9 Discovered in plant evolution MMR1 All of these species exhibit high levels of conservation, and the main plant species include gymnosperms, algae, and angiosperms; among them, angiosperms include major food crops such as rice and soybeans, and cash crops such as cucumbers and tomatoes. It is evident that... MMR1 Genes are highly conserved in evolution.
[0080] In this embodiment, the present invention verifies MMR1 Genes exhibit high conservation during evolution, sharing homologous genes in plant-derived species. These genes are relatively conserved throughout evolution, exhibiting high amino acid similarity. Plant-derived species primarily include rice, cucumber, tomato, and soybean.
[0081] Example 4: Rice MMR1 Functional conservation analysis of gene regulation of root development
[0082] Since Examples 1-3 primarily focus on the regulatory role of the MMR1 gene on the root system in the dicotyledonous model plant Arabidopsis thaliana, in order to demonstrate... MMR1 The high evolutionary conservation of genes across species is exemplified in this embodiment using rice as a monocotyledonous model plant. MMR1 Research on the conservation of genes in root regulation.
[0083] 1. Homologous reintroduction of rice MMR1 protein into Arabidopsis thaliana mmr1-2 Mutant analysis of root length phenotype and localization of rice MMR1 protein.
[0084] Total RNA was extracted from rice Zhonghua 11 (ZH11) using a total RNA extraction kit (Tiangen Biotech, catalog number: DP432), and rice cDNA was further reverse-introduced using a reverse-introduction kit (Novozymes Biotechnology Co., Ltd., catalog number: R212-02). The coding sequence (SEQ ID NO.5) of the rice MMR1 gene (ID: Os4g0244400) was downloaded from the database website (https: / / phytozome-next.jgi.doe.gov / ), and a design was created using the TAKARA website. pGreen-pAtMMR1:: OsMMR1 cds -GFP The circular vector has the following amplification primer sequences:
[0085] Primers for amplifying the Arabidopsis thaliana MMR1 self-promoter sequence:
[0086] pMMR1-F1: gataagcttgatatcgaattgttatgatcttccaatcattcat
[0087] pMMR1-R2-OsMMR1cds: ttgacctcatagcttgtggcggaagatgaga
[0088] Primers for amplifying the rice MMR1 coding sequence:
[0089] pMMR1-F2-OsMMR1cds: gccacaagctatgaggtcaatccgagcggc
[0090] GFP-R2-OsMMR1cds: tgctcaccatctcctggattcttgatggttctcc
[0091] Primers for amplifying the GFP fluorescent tag sequence:
[0092] GFP-F3-OsMMR1cds: agaatccaggagatggtgagcaagggcgagga
[0093] pGreen-R3-GFP: agtggatcccccgggctgcaggaattttacttgtacagctcgtccatgccgag
[0094] Similar to Example 1, the above fragments were amplified using Novizan high-fidelity enzyme, and each fragment was ligated into the EcoRI-digested linear vector pGreen0229 using homologous recombinase. After successful ligation, the correctly sequenced fragments were... pGreen- pAtMMR1::OsMMR1 cds -GFP Plasmids were transferred into Agrobacterium and Arabidopsis thaliana flowers were used for infection. mmr1-2 Mutants. Following the same method used in Example 2 for screening homozygous and positive plants, three homozygous lines were selected and compared with wild-type Col-0. mmr1-2 The mutants were seeded together in 1 / 2 MS medium. Figure 10 A and (scale bar is 10 μm) Figure 10 In section B, at 6 days seedling age, rice MMR1 The root lengths of all three homologous Arabidopsis thaliana lines restored to the wild-type Col-0 level. Simultaneously, rice was observed... MMR1 Homologous replacement of Arabidopsis thaliana with localization of rice MMR1 protein, such as Figure 10 As shown in Figure C, the rice MMR1 protein was located in the mitochondria when observing the roots of Arabidopsis thaliana. These results indicate that the rice MMR1 protein and the Arabidopsis thaliana MMR1 protein are highly conserved and exhibit consistent functions in regulating root growth.
[0095] 2. Rice mmr1 Root length phenotype of mutants
[0096] 1) Rice MMR1 Obtaining gene knockout plants
[0097] Using the target design website: http: / / crispr.hzau.edu.cn / CRISPR2 / , rice was designed. MMR1The target sequence of the gene (ID: Os4g0244400) was homologously recombinated with a linearized vector containing the Cas9 enzyme to construct a plasmid that was successfully sequenced. The successfully sequenced plasmid was transformed into Agrobacterium (EHA105-MW) strain and validated. The validated Agrobacterium was then used for the next step of genetic transformation.
[0098] The specific genetic transformation process is as follows:
[0099] Callus induction: Select plump ZH11 seeds harvested that year, disinfect with 75% ethanol for 1 min, discard the ethanol, and rinse 3-4 times with sterile water. Disinfect with 30% sodium hypochlorite for 20 min (can be placed in a shaker), discard the ethanol, rinse 5-6 times with sterile water, discard the sterile water, and blot dry the seed surface with sterile filter paper. Gently transfer the seeds to the induction medium using flat-tipped forceps. After callus growth, transformation can be performed using proembryos.
[0100] Agrobacterium culture and infection: Agrobacterium carrying the target gene was streaked onto LB agar containing the corresponding antibiotic resistance and incubated upside down at 28°C for 2 days until single colonies appeared. Using a sterile spatula, the colonies were scraped from the plate into the infection solution and shaken well; this is the Agrobacterium suspension required for co-culturing and transforming rice. A sufficient quantity of well-grown callus tissue (bright yellow color, firm and round texture, approximately 3 mm in diameter is ideal) was selected and placed in a 150 ml sterile Erlenmeyer flask. The Agrobacterium suspension was poured in, and the flask was shaken every 5 minutes for 20 minutes. The suspension was discarded, and excess bacterial solution was blotted dry with sterile filter paper. The callus tissue was then transferred to a solid culture medium lined with sterile filter paper and incubated in the dark at 25°C for 3 days.
[0101] Screening culture: Take out the callus tissue cultured for 3 days, rinse twice with sterile water, and then use a solution containing 500 mg·L⁻¹. -1 Soak the callus tissue in sterile water with carbenicillin for 30 minutes. Transfer it to sterile filter paper and drain for 2 hours. Transfer the callus tissue to a selection medium containing carbenicillin and hygromycin for selection culture. The entire process is carried out in a clean bench. Incubate in the dark at 28°C for 3-4 weeks.
[0102] Differentiation and regeneration: Select bright yellow positive callus from the screening medium and transfer them to the differentiation medium for differentiation and regeneration. Place 10-15 positive callus in each round dish and culture them in a light incubator at 28℃ with a photoperiod of 16h / 8h for 4 weeks. When the seedlings differentiate to about 5 cm, they can be transferred to the rooting medium.
[0103] Seedling rooting: Once the seedlings have developed a distinct root system in the differentiation medium, they can be transferred to a rooting medium. For rice, taller culture tubes should be selected and cultured in a 28℃ incubator with a 16 h / 8 h photoperiod until the leaves reach the top of the tube. Then, the tubes can be opened, the agar washed off, and the seedlings transferred to hydroponics or soil culture for further growth or to detect the knockout site.
[0104] In addition, the specific genetic transformation process in this embodiment is as follows: Figure 11 As shown.
[0105] 2) Testing of transgenic seedlings yielded Osmmr1 mutant plants
[0106] DNA was extracted from soil-cultured transgenic rice seedlings using CTAB, and target primer sequences were designed to detect the mutation types of target sites in positive seedlings. The target sequences are as follows:
[0107] OsMMR1_F: AGCAGCCTCCCAACCAAAATA
[0108] OsMMR1_R: AGATTGGGCGTCCAGCC
[0109] Two T0-positive homozygous knockout seedlings were obtained by PCR amplification and sequencing. They were named as follows: Osmmr1-1、Osmmr1-1 Target location and two Osmmr1 The location of mutant knockout is as follows Figure 12 As shown. The obtained T0 positive knockout seedlings and ZH11 seedlings were simultaneously propagated for two generations, and the T2 generation was harvested. Osmmr1 Seeds of the mutant homologous line and ZH11 were collected. Seeds were sterilized with 5% sodium hypochlorite for 20 minutes and then vernalized for 3 days in a 28℃ incubator with a 16 / 8h photoperiod. After removal, they were placed in a 96-well rice culture box and cultured for 5 days in a 28℃ incubator with a 16 / 8h photoperiod. Root length was measured using ImageJ, and the results are shown below. Figure 13 , Osmmr1-1, Osmmr1-2 The roots of the seed plants were significantly shorter than those of ZH11. Therefore, the MMR1 gene also plays a regulatory role in root growth in rice, indicating that the MMR1 protein is conserved in rice.
[0110] In this embodiment, the present invention constructs rice for the first time. MMR1 The root length changes were observed after the gene mutant and the rice MMR1 protein were homologously added back into Arabidopsis thaliana. (Compared with Arabidopsis thaliana) MMR1 The mutant phenotype was consistent with that of the wild type (ZH11) rice. MMR1 The mutant lines had shorter roots. After homologous reintroduction of the rice MMR1 protein into Arabidopsis thaliana, the root length returned to the wild-type level, and the rice MMR1 protein in the homologously reintroduced Arabidopsis transgenic plants was also located in the mitochondria. This indicates that the MMR1 gene is highly conserved in evolution.
[0111] In summary, this invention is the first to verify... MMR1 The species conservation of genes in monocots and dicots provides a theoretical basis for developing the root growth regulation function of MMR1 protein in different species, and has great potential for molecular breeding applications, providing gene resources for developing new crop varieties that regulate plant root development.
[0112] The foregoing illustrative description illustrates the invention and its embodiments. Obviously, the invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of this invention should be considered within the scope of protection of this invention.
Claims
1. Application of MMR1 gene in regulating plant root length, wherein the MMR1 gene is Arabidopsis thaliana MMR1 gene, the coding region nucleotide sequence of the Arabidopsis thaliana MMR1 gene is shown as SEQ ID NO. 2; the plant root length is regulated by overexpressing the Arabidopsis thaliana MMR1 gene or the protein encoded by the Arabidopsis thaliana MMR1 gene to promote the elongation of the plant root system, and the plant is Arabidopsis thaliana.
2. Application of MMR1 gene in regulating plant root length, wherein the MMR1 gene is rice MMR1 gene, the coding region nucleotide sequence of the rice MMR1 gene is shown as SEQ ID NO. 5; the plant root length is regulated by overexpressing the rice MMR1 gene or the protein encoded by the rice MMR1 gene to promote the elongation of the plant root system, and the plant is rice.
3. Application of the protein encoded by MMR1 gene in regulating plant root length, wherein the MMR1 gene is Arabidopsis thaliana MMR1 gene, the amino acid sequence of the protein encoded by the Arabidopsis thaliana MMR1 gene is shown as SEQ ID NO. 3; the plant root length is regulated by overexpressing the Arabidopsis thaliana MMR1 gene or the protein encoded by the Arabidopsis thaliana MMR1 gene to promote the elongation of the plant root system, and the plant is Arabidopsis thaliana.
4. Application of the protein encoded by MMR1 gene in regulating plant root length, wherein the MMR1 gene is rice MMR1 gene, the coding region nucleotide sequence of the rice MMR1 gene is shown as SEQ ID NO. 5; the plant root length is regulated by overexpressing the rice MMR1 gene or the protein encoded by the rice MMR1 gene to promote the elongation of the plant root system, and the plant is rice.
Citation Information
Patent Citations
Poplar GSTF12 gene and application of poplar GSTF12 gene in plant salt resistance
CN118048339A
Acid stress-resistant transgenic plant
JP2008187926A