Recombinant TKC vector applied to CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated 9) and construction method of mutant plant

By constructing a recombinant TKC vector containing a U6/U3 transcription cassette, the EMF1 gene was efficiently knocked out in rice using CRISPR/Cas9 technology, enabling the construction of early-flowering and transgenic-free plants. This solved the problem of low hybrid seed production efficiency in existing technologies and improved rice breeding efficiency and yield.

CN120944949APending Publication Date: 2025-11-14SHANGHAI AGROBIOLOGICAL GENE CENT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511233507.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-29
Publication Date
2025-11-14

AI Technical Summary

Technical Problem

Existing CRISPR/Cas9 gene editing technology requires multiple screenings and validations in rice, making it difficult to efficiently construct purified target gene-edited mutants. Furthermore, it suffers from problems such as hybrid sterility, long growth period, excessively tall plants, and different flowering habits, which affect the efficiency of hybrid seed production.

Method used

Using a recombinant TKC vector containing a U6 transcription cassette and/or a U3 transcription cassette, an EMF1 knockout mutant was constructed using CRISPR/Cas9 gene editing technology. This suicide transgene eliminated the CRISPR/Cas9 component, achieving efficient mutation and early flowering, and reducing seed production costs.

Benefits of technology

It significantly advances the daily flowering time of rice, solves the problem of flowering sterility in hybrid seed production, increases seed production and breeding efficiency, reduces the screening time for non-GMO plants, and lowers labor demand.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120944949A_ABST
    Figure CN120944949A_ABST
Patent Text Reader

Abstract

The invention provides a recombinant TKC vector applied to CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated 9) and a construction method of a mutant plant, and belongs to the technical field of gene editing. The invention provides a recombinant TKC vector applied to CRISPR-Cas9, the recombinant TKC vector comprises a U6 transcription box and / or a U3 transcription box, a target gene in the transcription box is located between a promoter and a terminator, and transcription expression of the target gene can be effectively guaranteed. By using the recombinant TKC vector and knocking out the EMF1 gene in a japonica rice dry-hui 89 material, the daily flowering time of the japonica rice dry-hui 89 material is obviously earlier, the flowering time of hybrid seed production of indica rice and japonica rice is encountered, the yield of hybrid seed production of indica rice and japonica rice is favorably improved, and the seed production cost is reduced. By utilizing the gene editing method provided by the invention, the daily flowering time of the japonica rice variety, i.e., the Yanhui 89 can be obviously advanced, and the problem of infertility during flowering during indica-japonica hybrid seed production is solved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene editing technology, specifically relating to a method for constructing a recombinant TKC vector and mutant plants for CRISPR-Cas9. Background Technology

[0002] Rice (Oryza sativa L.) is one of the world's most important food crops, with more than half of the global population relying on it as their staple food. Therefore, rice production significantly impacts food security. Hybridization between indica and japonica rice, due to reproductive isolation between subspecies, produces strong heterosis, resulting in a substantial increase in yield. In the hybrid rice industry, hybrid seed production efficiency is crucial for the application of hybrid combinations. However, the utilization of heterosis between indica and japonica rice is severely hampered by hybrid sterility, long growth periods, taller plant heights, and different flowering habits, significantly affecting seed production yields.

[0003] The timing of rice flowering within a day is an important agronomic trait. This characteristic may vary depending on the variety; generally, indica rice flowers earlier than japonica rice, and wild rice flowers earlier than cultivated rice. The daily flowering time of rice refers to the time from the opening of the first floret to the end of the day in a field population, which can be divided into the initial flowering stage, the peak flowering stage, and the end of flowering. The stalk is a crucial organ determining the opening and closing of the rice floret, composed of numerous large thin-walled cells and a small number of radially distributed, evenly distributed vascular bundles. The stalk absorbs water and swells, opening the floret; the stalk closes upon dehydration, which involves numerous enzymatic reactions. Jasmonic acids play a vital role in rice floret opening; jasmonic acid and its derivatives can effectively promote rice flowering. Plant hormones (JAs) are a class of fatty acid derivatives, including jasmonic acid and its various derivatives, which play a crucial role in various plant development and defense mechanisms, and also have an important regulatory role in rice floret development and opening. In addition, rice spikelets are very sensitive to temperature changes when they open. High temperatures during flowering can lead to poor anther dehiscence and reduced pollen viability, which in turn reduces the seed setting rate. Researching the regulation mechanism of spikelet opening can help rice flower earlier and avoid spikelet sterility caused by high temperatures. It can also help the development of hybrid breeding between indica and japonica rice.

[0004] Existing research indicates that EMF1, a key factor regulating diurnal flowering dynamics in rice, influences flowering time by regulating the expression of core flowering-related genes through epigenetic mechanisms. It may dynamically regulate the expression of florigen genes such as Hd1, Ehd1, and FT-like genes by integrating photoperiod signals and circadian rhythm pathways, thereby determining the flowering sequence of rice under specific light conditions. However, current gene editing techniques, such as CRISPR / Cas9, require multiple screening and validation processes to obtain purified target gene-edited mutants. Summary of the Invention

[0005] This invention provides a method for constructing a recombinant TKC vector for CRISPR-Cas9 and mutant plants. The knockout effect is significant, the mutation efficiency is high, it is efficient and easy to operate, and it can effectively eliminate the CRISPR / Cas9 transgenic component in all T1 generation plants, greatly reducing the labor and time required to identify non-transgenic plants containing the target mutation generated by CRISPR / Cas9.

[0006] This invention provides a recombinant TKC vector for CRISPR-Cas9, wherein the recombinant TKC vector contains a U6 transcript cassette and / or a U3 transcript cassette;

[0007] The structure of the U6 transcription cassette includes a U6 promoter-target gene-terminator connected in sequence.

[0008] The structure of the U3 transcription cassette includes a U3 promoter, a target gene, and a terminator connected in sequence.

[0009] In a preferred embodiment of the present invention, when the recombinant TKC vector contains a U6 transcription cassette, the target sequence of the target gene is GN. 18~23 GG, the primers for synthesizing CRISPR include the target gene -U6F and the target gene U6R, wherein the sequence of the target gene -U6F is as follows: 18~23 The sequence shown in SEQ ID No. 1 is then joined, and the sequence of the target gene U6R is in M 18~23 C is followed by the sequence shown in SEQ ID No. 2; where N is the forward sequence of the target sequence, M is the reverse complementary sequence of N, and the number of M and N are the same.

[0010] In a preferred embodiment of the present invention, when the recombinant TKC vector contains a U3 transcription cassette, the target sequence of the target gene is AN. 18~23 GG, the primers for synthesizing CRISPR include the target gene -U3F and the target gene U3R, wherein the sequence of the target gene -U3F is as follows: 18~23 The sequence shown in SEQ ID No. 1 is then linked together, and the sequence of the target gene U3R is in M18~23 T is followed by the sequence shown in SEQ ID No. 15; where N is the forward sequence of the target sequence, M is the reverse complementary sequence of N, and the number of M and N are the same.

[0011] The present invention also provides a recombinant TKC vector targeting rice EMF1, wherein the recombinant TKC vector contains a U6 transcription cassette and the target sequence is shown in SEQ ID No. 3.

[0012] In a preferred embodiment of the present invention, the primers for synthesizing CRISPR include nucleotide sequences such as EMF1-U6F as shown in SEQ ID No. 4, EMF1-U6R as shown in SEQ ID No. 5, OsU6P-F as shown in SEQ ID No. 6, and OsU6T-R as shown in SEQ ID No. 7.

[0013] The present invention also provides a method for constructing the above-mentioned recombinant TKC vector, comprising the following steps: (1) using a vector with a U6 promoter and a terminator as a template, performing a first round of amplification using a first primer pair composed of OsU6P-F and EMF1-U6R, and a second primer pair composed of OsU6T-R and EMF1-U6F respectively;

[0014] (2) The first-round amplification products obtained in step (1) are mixed and used as templates. The third primer pair consisting of OsU6P-F and OsU6T-R is used for amplification to obtain the second-round amplification products.

[0015] (3) The second-round amplification product obtained in step (2) is ligated with the TKC vector linearized by Pme I enzyme to obtain the recombinant TKC vector.

[0016] This invention also provides the application of the above-mentioned recombinant TKC vector or the above-mentioned recombinant TKC vector in constructing gene-editing mutants.

[0017] The present invention also provides a method for constructing an EMF1 knockout mutant based on CRISPR / Cas9 gene editing, including transforming plants using the above-mentioned recombinant TKC vector.

[0018] In a preferred embodiment of the present invention, the method further includes identifying the mutation type using identification primer pairs, wherein the identification primer pairs include nucleotide sequences such as EMF1-F shown in SEQ ID No. 8 and EMF1-R shown in SEQ ID No. 9.

[0019] The present invention also provides a breeding method for early-flowering japonica rice, including transforming japonica rice varieties using the above-mentioned recombinant TKC vector.

[0020] Beneficial Effects: This invention provides a recombinant TKC vector for CRISPR-Cas9, comprising a U6 transcription cassette and / or a U3 transcription cassette, with the target gene located between the promoter and terminator within the cassette, effectively ensuring the transcriptional expression of the target gene. In this embodiment, EMF1 is used as an example, and a recombinant TKC vector is reconstructed by constructing a U6 transcription cassette. Based on this recombinant TKC vector, an EMF1 knockout mutant is constructed using CRISPR / Cas9 gene editing technology. A systematic comparison of the dynamic changes in flowering time between the mutant and wild-type materials confirms that EMF1 has a significant regulatory effect on the daily flowering dynamics of rice.

[0021] This invention significantly advances the daily flowering time of the japonica rice variety Hanhui 89 by knocking out the EMF1 gene, allowing the flowering times of indica and japonica rice hybrids to coincide, thus helping to increase the yield of indica-japonica hybrid seed production and reduce seed production costs. Using the gene editing method provided by this invention, the daily flowering time of the japonica rice variety Hanhui 89 can be significantly advanced, solving the problem of flowering time infertility in indica-japonica hybrid seed production.

[0022] The method described in this invention employs a pair of suicide transgenic structures, effectively killing all CRISPR / Cas9-containing pollen and embryos produced by the T0 plant. When the T0 plant undergoes reproductive growth, the embedded CMS2 and BARNASE expression cassettes produce toxic proteins that kill male gametophytes and embryos containing the CRISPR / Cas9 construct, respectively. Therefore, any seeds obtained from T0 plants transformed with the TKC construct are transgenic-free, eliminating the need for detection and screening. Thus, using this method, homozygous mutant plants without transgenic components can be obtained in two years, exhibiting agronomic traits consistent with the recipient plant, but with a significantly earlier flowering time. The improvement effect is significant and can be used in hybrid rice breeding to promote the convergence of flowering times between indica and japonica rice, increase seed production yield, reduce seed production costs, and improve breeding efficiency. Attached Figure Description

[0023] Figure 1 This is a plasmid map of the TKC vector described in this invention;

[0024] Figure 2 This is a schematic diagram of the target site of the present invention;

[0025] Figure 3 Dynamic images of daytime flowering in mutant and wild-type strains;

[0026] Figure 4 A graph showing the statistical results of mutation types;

[0027] Figure 5 To preserve the statistical results of mutation types. Detailed Implementation

[0028] This invention provides a recombinant TKC vector for CRISPR-Cas9, wherein the recombinant TKC vector contains a U6 transcript cassette and / or a U3 transcript cassette;

[0029] The structure of the U6 transcription cassette includes a U6 promoter-target gene-terminator connected in sequence.

[0030] The structure of the U3 transcription cassette includes a U3 promoter, a target gene, and a terminator connected in sequence.

[0031] The recombinant TKC vector described in this invention is based on the TKC (Transgene Killer CRISPR) vector. In one embodiment, it is based on... Figure 1 The TKC vector shown is the base vector.

[0032] The recombinant TKC vector of this invention contains a U6 transcript cassette and / or a U3 transcript cassette. When the recombinant TKC vector contains a U6 transcript cassette, the target sequence of the target gene is GN. 18~23 GG, the primers for synthesizing CRISPR include the target gene -U6F and the target gene U6R, wherein the sequence of the target gene -U6F is as follows: 18~23 The sequence shown in SEQ ID No. 1 is then joined, and the sequence of the target gene U6R is in M 18~23 C is followed by the sequence shown in SEQ ID No. 2; where N is the forward sequence of the target sequence, M is the reverse complementary sequence of N, and the number of M and N are the same.

[0033] In this invention, when the recombinant TKC vector contains a U3 transcription cassette, the target sequence of the target gene is AN. 18~23 GG, the primers for synthesizing CRISPR include the target gene -U3F and the target gene U3R, wherein the sequence of the target gene -U3F is as follows: 18~23 The sequence shown in SEQ ID No. 1 is then linked together, and the sequence of the target gene U3R is in M 18~23 T is followed by the sequence shown in SEQ ID No. 15; where N is the forward sequence of the target sequence, M is the reverse complementary sequence of N, and the number of M and N are the same.

[0034] Target gene - U6F: GN 18~23 gttttagagctagaaatagcaagtta(GN 18~23 -SEQ ID No.1), where N is the forward sequence of the target sequence;

[0035] Target gene - U6R:M 18~23Caacctgagcctcagcgcagc(M 18~23 C-SEQ ID No. 2), where M is the reverse complementary sequence of N;

[0036] Target gene - U3F: AN 18~23 gttttagagctagaaatagcaagtta(AN 18~23 -SEQ ID No.1), where N is the forward sequence of the target sequence;

[0037] Target gene - U3R: M 18~23 Tgccacggatcatctgcacaactc(M 18~23 T-SEQ ID No. 15), where M is the reverse complementary sequence of N.

[0038] In this invention, when constructing the recombinant TKC vector, it is also necessary to design boundary primers, that is, primers that partially overlap with the sequences on both sides of the linker site of the TKC plasmid.

[0039] The present invention also provides a recombinant TKC vector targeting rice EMF1, wherein the recombinant TKC vector contains a U6 transcription cassette and the target sequence is shown in SEQ ID No. 3: GTTCAAGGCGAAGATGGACGAGG.

[0040] In one embodiment of the present invention, the nucleotide sequence of the U6 transcription cassette is shown in SEQ ID No. 10.

[0041] The primers for synthesizing CRISPR described in this invention include EMF1-U6F and EMF1-U6R, as well as boundary primers OsU6P-F and OsU6P-R. The sequences of each primer are shown in Table 1.

[0042] Table 1. Designed and synthesized primer sequences

[0043]

[0044] The present invention also provides a method for constructing the above-mentioned recombinant TKC vector, comprising the following steps: (1) using a vector with a U6 promoter and a terminator as a template, performing a first round of amplification using a first primer pair composed of OsU6P-F and EMF1-U6R, and a second primer pair composed of OsU6T-R and EMF1-U6F respectively;

[0045] (2) The first-round amplification products obtained in step (1) are mixed and used as templates. The third primer pair consisting of OsU6P-F and OsU6T-R is used for amplification to obtain the second-round amplification products.

[0046] (3) The second-round amplification product obtained in step (2) is ligated with the TKC vector linearized by Pme I enzyme to obtain the recombinant TKC vector.

[0047] In this invention, the first round of PCR is performed in two tubes, both using a vector containing the U6 promoter and terminator as a template. One tube uses OsU6P-F+EMF1-U6R for PCR amplification, and the other tube uses OsU6T-R+EMF1-U6F for PCR amplification. In one embodiment of this invention, subsequent operations are based on the sequence shown in SEQ ID No. 13, which is the complete genome nucleotide sequence (including promoter, coding region, UTR region, and introns) of EMF1 derived from the japonica rice variety ZH11.

[0048] In this invention, the amplification products of the first round of PCR are recovered by gel extraction, mixed and used as templates for the second round of PCR, and amplified using OsU6P-F+OsU6T-R as primers to obtain the second round of PCR products, which are then recovered by gel extraction.

[0049] In this invention, the second-round PCR product is ligated to the TKC vector, which has been completely digested with Pme I. Finally, E. coli (DH5α) undergoes positive transformation and is then sequenced using primers HDR105 (SEQ ID No. 11) and HDR106 (SEQ ID No. 12).

[0050] This invention also provides the application of the above-mentioned recombinant TKC vector or the above-mentioned recombinant TKC vector in constructing gene-editing mutants.

[0051] The recombinant TKC vector described in this invention can be used in CRISPR / Cas9 gene editing to achieve targeted gene editing, such as the rice mutant plant with targeted editing of EMF1 constructed in the examples.

[0052] The present invention also provides a method for constructing an EMF1 knockout mutant based on CRISPR / Cas9 gene editing, including transforming plants using the above-mentioned recombinant TKC vector.

[0053] The present invention does not specifically limit the transformation method, and conventional transformation methods in the art can be used. After the transformation, the method further includes identifying the mutation type using identification primer pairs, wherein the identification primer pairs include nucleotide sequences such as EMF1-F shown in SEQ ID No. 8 and EMF1-R shown in SEQ ID No. 9.

[0054] EMF1-F (SEQ ID No. 8): CGCAGCATCACCTCCAACAA;

[0055] EMF1-R (SEQ ID No. 9): AACATGCTCAAGAACGGCGG.

[0056] The present invention also provides a breeding method for early-flowering japonica rice, including transforming japonica rice varieties using the above-mentioned recombinant TKC vector.

[0057] In one embodiment of the present invention, using Hanhui 89 as the recipient, after genetic transformation using the above method, the resulting mutant strain was compared with the wild Hanhui 89 strain. The transformation was terminated under the same conditions. The flowering time of the two mutant types of plants was more than two hours earlier than that of the control material.

[0058] The recombinant TKC vector described in this invention is a type of suicide vector that can actively and automatically eliminate any plant containing the CRISPR / Cas9 construct, while still allowing targeted gene modification of the CRISPR / Cas9 construct before removal. This invention employs a pair of suicide transgenes, effectively killing all CRISPR / Cas9-containing pollen and embryos produced by T0 plants. When the T0 plant undergoes reproductive growth, the embedded CMS2 and BARNASE expression cassettes produce toxic proteins that kill male gametophytes and embryos containing the CRISPR / Cas9 construct, respectively. Therefore, any seeds obtained from T0 plants transformed with the TKC construct are transgenic-free, eliminating the need for detection and screening.

[0059] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, of a method for constructing a recombinant TKC vector and mutant plants for CRISPR-Cas9 provided by the present invention, should not be construed as limiting the scope of protection of the present invention.

[0060] Example 1

[0061] The EMF1 whole genome nucleotide sequence (SEQ ID No. 13) of the japonica rice variety ZH11 was selected for subsequent operations.

[0062] (I) Design and selection of target sequences

[0063] Design as Figure 2 The target sequence of the sgRNA of the U6 promoter shown is SEQ ID No. 3.

[0064] (II) Primers for CRISPR synthesis

[0065] The designed primer sequences are: EMF1-U6F (SEQ ID No. 6) and EMF1-U6R (SEQ ID No. 7).

[0066] Boundary primers: primers OsU6P-F (SEQ ID No. 4) and OsU6T-R (SEQ ID No. 5) that partially overlap with the sequences flanking the Pme I restriction site of the TKC plasmid.

[0067] (III) PCR Amplification

[0068] 20μL PCR system: 1μL template, 0.5μL each of forward and reverse primers, 10μL 1KOD One™ PCR Master Mix and 8μL ddH2O.

[0069] PCR reaction procedure: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 50 s, 32 cycles; 72℃ extension for 7 min, store at 10℃.

[0070] Once the necessary primers and vectors are prepared, PCR amplification of the sgRNA transcription elements is performed.

[0071] The first round of PCR was performed in two tubes, both using the constructed vector with the U6 promoter and terminator as templates. In this embodiment, the sequence shown in SEQ ID No. 14 was used as a template: PCR1: OsU6P-F+EMF1-U6R, PCR2: OsU6T-R+EMF1-U6F.

[0072] Then, a second round of PCR was performed. The products from PCR1 and PCR2 were recovered from the gel, and 0.5 μL of each was used as template, amplified using OsU6P-F + OsU6T-R primers. The second round of PCR products were then recovered from the gel. 2×Basic Mix was used. The Basic Seamless Cloning and Assembly Kit (Beijing TransGen Biotechnology Co., Ltd.) ligates the recovered PCR products with the TKC vector that has been completely digested with Pme I.

[0073] (iv) Transformation

[0074] Transformation was performed using *E. coli* (DH5α), and the positive transformation product was then sequenced.

[0075] 1. Place competent cells in an ice bath. The recommended volume for a single transformation of competent cells is 50–100 μL, which can be aliquoted as needed.

[0076] 2. After the competent cells have thawed, add the target DNA to the competent cell suspension (add an appropriate amount of DNA according to the actual situation; usually 100 μl of competent cells can be saturated with 1 ng of supercoiled plasmid DNA), gently mix with a pipette, and incubate on ice for 30 minutes.

[0077] Heat shock at 3.42℃ for 90 seconds, then quickly transfer the centrifuge tubes to an ice bath and let them stand on ice for 2-3 minutes.

[0078] 4. Add 800 μL of sterile SOC or LB medium (without antibiotics) to each centrifuge tube, mix well, and place in a 37°C shaker at 200 rpm (less than 225 rpm) for 45 minutes to allow the cells to recover.

[0079] 5. According to experimental requirements, take an appropriate amount of transformed competent cells and add them to SOC or LB solid agar medium containing the corresponding antibiotics. Spread the cells evenly with a sterile spreader. Place the plate at 37°C until the liquid is absorbed. Invert the plate and incubate at 37°C for 12-16 hours.

[0080] The sequencing primers flanking TKC are HDR105 and HDR106.

[0081] (V) Plant Transformation

[0082] The sequencing results were correct, and the transgenic plants were sent to the company for transformation. The specific transformation method is referenced in the literature (Guo Tao, Shen Renjia, Wang Jiafeng. Research progress on genetic transformation methods of rice[J]. Journal of South China Agricultural University, 2023, 44(6):843-853.). Hanhui 89 was selected as the recipient parent.

[0083] (vi) Mutation type identification

[0084] A total of 33 T0 generation transgenic plants were received. Primers were designed to identify their mutation types. The designed detection primers were EMF1-F and EMF1-R. The identification results showed that 6 plants were wild-type, and 27 plants had mutations, with a mutation rate of 81.8%. There were a total of 8 mutation types, such as... Figure 4 As shown, there are 2 homozygous mutations.

[0085] Due to the influence of a pair of suicidal transgenic genes or the influence of growth conditions, only those such as Figure 5 The two mutation types shown are a homozygous mutation with two missing bases and a heterozygous mutation with one missing base and two missing bases.

[0086] (vii) Phenotypic identification

[0087] After planting T1 generation seeds of the two mutant types, their flowering dynamics throughout the day were investigated using the pruning method during the flowering period. Wild-type *Hanhui 89* was used as a control material, and both were planted under the same conditions. During the flowering period, daily flowering dynamics were investigated, starting at 7:30 AM and continuing every half hour until 5:00 PM, using the pruning method. The investigation was conducted continuously for one week. Results are as follows: Figure 3 As shown, the flowering time of both mutant plant types was more than two hours earlier than that of the control material. This indicates that the target sequence of the designed gene has a significant effect on the flowering time of this material.

[0088] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A recombinant TKC vector for CRISPR-Cas9, characterized in that, The recombinant TKC vector contains a U6 transcript cassette and / or a U3 transcript cassette. The structure of the U6 transcription cassette includes a U6 promoter-target gene-terminator connected in sequence. The structure of the U3 transcription cassette includes a U3 promoter, a target gene, and a terminator connected in sequence.

2. The recombinant TKC vector according to claim 1, characterized in that, When the recombinant TKC vector contains a U6 transcription cassette, the target sequence of the target gene is GN. 18~23 GG, the primers for synthesizing CRISPR include target gene-U6F and target gene-U6R, wherein the sequence of target gene-U6F is as shown in GG. 18~23 The sequence shown in SEQ ID No. 1 is then linked together, and the sequence of the target gene -U6R is in M 18~23 C is followed by the sequence shown in SEQ ID No. 2; where N is the forward sequence of the target sequence, M is the reverse complementary sequence of N, and the number of M and N are the same.

3. The recombinant TKC vector according to claim 1, characterized in that, When the recombinant TKC vector contains a U3 transcription cassette, the target sequence of the target gene is AN. 18~23 GG, the primers for synthesizing CRISPR include the target gene -U3F and the target gene U3R, wherein the sequence of the target gene -U3F is as follows: 18~23 The sequence shown in SEQ ID No. 1 is then linked together, and the sequence of the target gene U3R is in M 18~23 T is followed by the sequence shown in SEQ ID No. 15; where N is the forward sequence of the target sequence, M is the reverse complementary sequence of N, and the number of M and N are the same.

4. A recombinant TKC vector targeting rice EMF1, characterized in that, The recombinant TKC vector contains a U6 transcription cassette, and the target sequence is shown in SEQ ID No.

3.

5. The recombinant TKC vector according to claim 4, characterized in that, Primers for synthesizing CRISPR include nucleotide sequences such as EMF1-U6F (SEQ ID No. 4), EMF1-U6R (SEQ ID No. 5), OsU6P-F (SEQ ID No. 6), and OsU6T-R (SEQ ID No. 7).

6. The method for constructing the recombinant TKC vector according to claim 4 or 5, characterized in that, Includes the following steps: (1) Using a vector with a U6 promoter and terminator as a template, the first round of amplification was carried out using the first primer pair composed of OsU6P-F and EMF1-U6R, and the second primer pair composed of OsU6T-R and EMF1-U6F, respectively. (2) The first-round amplification products obtained in step (1) are mixed and used as templates. The third primer pair consisting of OsU6P-F and OsU6T-R is used for amplification to obtain the second-round amplification products. (3) The second-round amplification product obtained in step (2) is ligated with the TKC vector linearized by Pme I enzyme to obtain the recombinant TKC vector.

7. The use of the recombinant TKC vector according to any one of claims 1 to 3 or the recombinant TKC vector according to claim 4 or 5 in constructing gene-editing mutants.

8. A method for constructing EMF1 knockout mutants based on CRISPR / Cas9 gene editing, characterized in that, This includes transforming plants using the recombinant TKC vector as described in claim 4 or 5.

9. The method according to claim 8, characterized in that, It also includes the use of identification primer pairs for mutation type identification, the identification primer pairs including nucleotide sequences such as EMF1-F shown in SEQ ID No. 8 and EMF1-R shown in SEQ ID No.

9.

10. A breeding method for early-flowering japonica rice, characterized in that, This includes the transformation of japonica rice varieties using the recombinant TKC vector as described in claim 4 or 5.