Maize grain size regulation gene ZmABCB4 and molecular identification method and application thereof
By identifying and editing the key gene ZmABCB4 for maize kernel size, and developing functional molecular markers and CRISPR/Cas9 technology, the problem of unclear genetic mechanisms regulating maize kernel size has been solved. This has enabled the rapid identification of small-kernel materials and the creation of large-kernel materials, thereby improving breeding efficiency and resource utilization.
Patent Information
- Application Number
- CN202511489564.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-17
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2045-10-17
AI Technical Summary
Current technologies have not yet identified the key regulatory genes and mechanisms for maize kernel size, which affects the efficiency and accuracy of high-yield and high-quality maize breeding.
The key gene ZmABCB4 for maize kernel size was identified, and its functional molecular marker was developed. Using map-based cloning and genetic transformation platforms, the functional molecular marker ZmABCB4-Indel was designed for rapid screening and molecular identification of small-kernel materials. The ZmABCB4 gene was knocked out using CRISPR/Cas9 gene editing technology to obtain large-kernel maize materials.
The genetic association between the ZmABCB4 gene and kernel size has been clarified, providing a tool for identifying small-kernel and large-kernel maize materials, improving breeding efficiency, and providing genetic resources and technical support for high-yield and high-quality maize breeding.
Smart Images

Figure CN120944958A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to genes that regulate maize kernel size. ZmABCB4 Its molecular identification methods and applications belong to the field of plant genetics and breeding and functional gene research technology. Background Technology
[0002] corn( Zea mays L. is an important global food crop, but its yield is affected by factors such as labor force, arable land, extreme environments, and increasing demand (Burki et al., 2022). Therefore, increasing its yield has become an important way to address food security challenges.
[0003] Grain yield is one of the most important and complex quantitative traits in crop breeding, influenced by genetic and environmental factors (Lin et al., 2021, Yang et al., 2016). Grain size-related traits are key determinants of maize yield (Chen et al., 2016, Zhang et al., 2014, Pang et al., 2019). Four main grain size traits—grain length, grain width, grain thickness, and 100-grain weight—are crucial characteristics determining maize grain yield. In-depth analysis of the genetic regulatory mechanisms of grain size is helpful in identifying key functional genes, developing molecular markers, and improving the efficiency and precision of high-yield and high-quality maize breeding, possessing significant theoretical and practical value.
[0004] Grain formation begins with double fertilization, initiating the developmental process to form a complete structure containing endosperm, embryo, and seed coat. The endosperm further differentiates into cell types such as starch endosperm (SE), basal endosperm transfer layer (BETL), and aleurone layer (AL) (Wu et al., 2022). Grain size is determined by cell division, expansion, and material accumulation, with complex regulatory mechanisms: identified key regulatory genes involve multiple pathways, including the ubiquitin-proteasome pathway and the G protein signaling pathway; downstream regulation by transcription factors and miRNA-mediated gene silencing constitute a multi-level molecular regulatory network; plant hormones such as auxins and gibberellins also form interactive networks through synergistic effects, regulating grain length, width, and weight. While significant progress has been made in the study of grain development regulation in staple crops such as rice and wheat, the molecular mechanisms of many key pathways remain unclear, requiring further exploration of new regulatory factors and analysis of their mechanisms of action.
[0005] In the plant hormone regulatory network, auxin (IAA) has a particularly significant impact on grain development. Previous studies have shown that maize grain size is closely related to IAA synthesis, transport, and signal transduction. For example, ZmEHD1 participates in clathrin-mediated endocytosis through interaction with the σ subunit of the ZmAP2 complex, regulating maize auxin homeostasis and thus affecting maize grain development (Wang et al., 2020). ZmSK2 phosphorylates and stabilizes the ZmIAA28 protein; together, they form the interaction hub of the brassinolide (BR) and IAA signaling pathways, thereby participating in maize grain embryo development (Wang et al., 2022). ZmADT2 Mutations lead to disordered carbon metabolism, increased tryptophan levels, and decreased auxin levels. The impaired auxin signaling pathway subsequently affects the size of maize kernel endosperm cells (Ren et al., 2024). Plant auxin is transported in polar, nonpolar, and lateral modes, with polar transport primarily relying on the ABCB, PIN, and AUX1 / LAX transporter families (Yang et al., 2025, Su et al., 2022, Ma et al., 2016). Maize ZmABCB1 (Brachytic2, BR2) and sorghum SbABCB1 (Dwarf3, DW3) participate in basal transport of auxin, while rice OsABCB14 participates in acrotropic transport (Knöller et al., 2010, Multani et al., 2003, Xu et al., 2014). Transcriptome analysis of monocotyledonous plants has shown that ABCB subfamily proteins may be closely related to plant responses to abiotic stresses (Pang et al., 2013, Shen et al., 2010, Chai et al., 2016). This suggests that the function of ABCB transporters is somewhat conserved in plants. However, no applications of ABCB transporters in the regulation of maize kernel size development have been reported to date.
[0006] This invention uses maize inbred line Z58 as material and obtains a mutant with stable heritability of kernel size through EMS (ethyl methanesulfonate) mutagenesis. sg2 The mutant was crossed with the maize inbred line B73 to construct an F2 genetic segregating population. Using map-based cloning and fine mapping techniques, the key gene regulating maize kernel size was finally identified. ZmABCB4 This invention is the first to identify a factor significantly correlated with corn kernel size. ZmABCB4This invention demonstrates that gene mutations lead to smaller maize kernels, and gene editing of this gene can create maize materials with smaller kernel length, width, and 100-kernel weight. The invention also develops functional molecular markers that can be used for rapid screening and molecular identification of mutant materials, providing important genetic resources and technical support for high-yield and high-quality molecular breeding of maize. Summary of the Invention
[0007] To address the shortcomings of existing technologies, this invention provides a key regulatory gene for maize kernel size. ZmABCB4 Furthermore, the gene and its functional molecular markers were developed, providing insights into their application in breeding large-grain maize germplasm resources. This research falls under the fields of plant functional gene research and molecular breeding technology. The maize mentioned... ZmABCB4 The gene encodes a member of the ABC transporter B subfamily within the ATP-binding cassette transporter superfamily, and its full-length DNA, cDNA, and amino acid sequences are shown in SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3.
[0008] Specifically, this invention uses a small-grained corn mutant. sg2 Using normal-grained parents as experimental materials, an F2 genetic segregating population was constructed through hybridization. Map-based cloning and other techniques were then used to identify a key gene that significantly regulates maize grain size. ZmABCB4 Further analysis revealed that the first exon of this allele in the small-seed mutant contained a 7-base insertion. This insertion mutation triggered a frameshift effect, causing the premature appearance of a stop codon during gene encoding, ultimately resulting in the loss of function of the encoded protein, manifested as a distinct small-seed phenotype.
[0009] The mutated gene Zmabcb4 The nucleotide sequence is shown in SEQ ID NO.4.
[0010] Furthermore, based on the sequence differences at the DNA level between small-grained materials and wild-type, this invention has developed and designed a functionally specific molecular marker, ZmABCB4-InDel, which can be used for rapid screening and molecular identification of mutant materials. This molecular marker can be widely applied to the precise identification of large and small-grained maize germplasm, providing a simple and effective tool for the efficient utilization of superior germplasm resources related to grains.
[0011] This invention utilizes a genetic transformation platform for gene... ZmABCB4 Gene editing significantly reduced the length and width of kernels in the resulting plants. This invention not only enriches the genetic basis of molecular regulation of kernel size but also provides important genetic resources and technical support for molecular breeding of high-yield and high-quality maize.
[0012] The present invention has the following beneficial technical effects: For the first time, corn was clearly defined. ZmABCB4 The genetic link between genes and seed size.
[0013] Provided ZmABCB4 Small-grained maize materials with allelic variations can be used for research on the mechanism of maize grain size regulation and germplasm innovation.
[0014] Identified Zmabcb4 A key functional mutation site in the gene, which leads to premature termination of translation of the ZmABCB4 protein, reveals its functional basis in regulating maize kernel development.
[0015] based on Zmabcb4 A functional molecular marker, ZmABCB4-Indel, was designed and developed for the mutation site. The primer sequences are ZmABCB4-Indel-F (SEQ ID NO.5) and ZmABCB4-Indel-R (SEQ ID NO.6). It can be used for rapid and accurate identification of small-grain maize materials and improve the efficiency of marker-assisted selection in breeding.
[0016] The applicability of the molecular marker ZmABCB4-Indel in distinguishing between large and small kernels in the F2 segregating population was verified, demonstrating its good discrimination ability and practicality, and providing an effective tool for high-throughput screening of maize kernel size-related resources.
[0017] Using a genetic transformation platform ZmABCB4 Gene knockout genetic transformation successfully obtained ZmABCB4 Gene knockout homozygous material. Phenotypic analysis of this homozygous material showed that the kernels produced by its positive plants were significantly shorter in length and smaller in width, providing important genetic resources and technical support for obtaining large-kernel maize. Attached Figure Description
[0018] Figure 1 : sg2 Mutant seed phenotype; Figure A is sg2 Mature segregating ears obtained after self-pollination of heterozygous mutants, and mature wild-type (WT) kernels on the ears. sg2 A phenotypic comparison of the mutant seeds visually illustrates the difference in seed size between the two; Figure B shows the difference between the wild type (WT) and... sg2 Results of statistical difference analysis of mutants in four key traits: grain length, grain width, grain thickness, and weight per 100 grains.
[0019] Figure 2 : sg2 Grain phenotypes of mutants at different developmental stages; Using the pollination date as a time reference standard, wild-type (WT) and... sg2The mutant seeds were sampled and photographed, and dynamic observation was used to clarify the onset of phenotypic differences between the two and the morphological changes at different developmental stages.
[0020] Figure 3 : ZmABCB4 Map-based cloning of genes; Figure 4 WT and sg2 In mutants ZmABCB4 Differences in gene nucleotide and amino acid sequences; Figure 5 : Schematic diagram of functional molecular markers designed and developed based on mutation sites (A) and marker validation results (B);
[0021] Figure 6 : Gene editing expression vector pCas9-ZmABCB4; The backbone vector is pBUE411-Cas9, and the target gene is... ZmABCB4 The targets are MT1 and MT2, and the marker genes are Cas9 and bar.
[0022] Figure 7 Two CRISPR / Cas9 knockout systems Zmabcb4-1 and Zmabcb4-2 Gene sequence variation analysis;
[0023] Zmabcb4-1 and Zmabcb4-2 Regions with missing bases in a gene sequence are indicated by dashed lines.
[0024] Figure 8 :corn ZmABCB4 Wild type and Zmabcb4-1 and Zmabcb4-2 Comparison of plant and grain phenotypes; Figure A shows a comparison of grain length phenotypes between wild-type and two mutant plants; Figure B shows a comparison of grain width phenotypes between wild-type and two mutant plants; Figure C shows the statistical analysis results of the comparison of grain length phenotypes between wild-type and mutant plants; Figure D shows the statistical analysis results of the comparison of grain width phenotypes between wild-type and mutant plants. Detailed Implementation
[0025] The following embodiments are used to illustrate the present invention, but do not limit the scope of the invention. Modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are all within the scope of the invention. Unless otherwise specified, the synthesis and sequencing of primers and genes used in the embodiments were performed by Beijing Qingke Biotechnology Co., Ltd. Other biochemical reagents, unless otherwise specified, are conventional commercially available reagents, and the technical means used in the embodiments are conventional means well known to those skilled in the art.
[0026] Example 1: Corn sg2Obtaining and describing the seed size mutant By screening the mutant library obtained by the Institute of Biological Agriculture, Beijing University of Science and Technology (the patent applicant) using ethyl methane sulfonate (EMS) to induce maize inbred line Zheng 58, a maize kernel size mutant was obtained. sg2 Mutant. sg2 After self-pollination, the grain phenotypic segregation of the heterozygous mutant was stable. Wild-type WT and sg2 The mutants showed significant differences in grain length, grain width, grain thickness, and weight per 100 grains. Figure 1 ), Take WT and at different pollination stages. sg2 The mutant was photographed in a stereochemical environment. Twelve days after pollination, it was clearly observed that the mutant seeds were smaller than the wild type, and the mutant embryos developed more slowly than the wild type. Figure 2 ).
[0027] sg2 A genetically segregating population was constructed by crossing the mutant with the maize inbred line B73. Clear segregation of large and small kernels was observed in the F2 generation ears. Statistical analysis revealed that the ratio of large to small kernels in the F2 generation was approximately 3:1 (Table 1), indicating... sg2 The mutant phenotype is controlled by a recessive single gene.
[0028]
[0029] Example 2: Corn ZmABCB4 Analysis of gene location, cloning, and mutation sites A total of 1501 small seeds were used to locate the target gene within a 288 kb region on chromosome 2, including 4 candidate genes. Figure 3 The marker sequences used are shown in Table 2.
[0030] Table 2 is used for ZmABCB4 markers for gene localization
[0031] The results showed that map-based cloning using BSA-seq analysis and specific markers identified candidate genes in a region of approximately 288 kb, ranging from 58.742 Mb to 59.030 Mb on chromosome 2. This region contained four genes: Zm00001eb083800 , Zm00001eb083810 , Zm00001eb083820 , Zm00001eb083830 .
[0032] In WT and sg2 Four gene allele sequences were cloned from the mutant and found that... Zm00001eb083810 The mutation involves the insertion of 7 bases into the first exon of the gene sequence, resulting in a frameshift mutation and the creation of a premature stop codon, thus shortening the encoded protein. Figure 4 The remaining three genes are in WT and sg2 The allele coding sequences are indistinguishable in the mutants, therefore... Zm00001eb083810 These were analyzed as key candidate genes. (See attached document.) Zm00001eb083810 Gene functional annotation revealed that it encodes a member of the ABC transporter B subfamily, belonging to the ATP-binding cassette (ABC) transporter superfamily. Based on comparison with homologous genes in Arabidopsis thaliana, this gene was named... ZmABCB4 .
[0033] Example 3: Development of the functional marker ZmABCB4-Indel In this invention, for ZmABCB4 The mutation site (insertion of 7 bases in the first exon) was identified. Primers were designed using Primer-BLAST from NCBI, and a pair of functional molecular markers, ZmABCB4-Indel, was developed. These primers can specifically detect the mutation site. sg2 The mutant gene and the mutant genes of maize small-seed materials bred from it can be distinguished from the wild type. ZmABCB4 Genes and mutants Zmabcb4 Gene. A schematic diagram showing the positions of the amplification primers for the functional marker ZmABCB4-Indel is shown below. Figure 5 As shown.
[0034] Example 4: Practicality Analysis of Functional Marker ZmABCB4-Indel The functional markers developed in Example 3 were verified.
[0035] The method for extracting DNA from corn leaves is as follows: 1) Cut an appropriate amount of leaves and place them into 2.0 ml centrifuge tubes that have been pre-labeled with numbers. Add a 5 mm diameter steel ball. 2) Arrange the centrifuge tubes containing the leaves and steel ball in order on a centrifuge tube rack for a sample grinder, and immerse them in liquid nitrogen for about 2 minutes (Note: the liquid nitrogen should just cover the centrifuge tube rack). 3) Place the frozen centrifuge tube rack into the slot of the sample grinder (Thmorgan Cell Killer CK-1000), making sure it is secure. Run at 1200 rpm / min for 60 seconds. 4) Add 750 μl of CTAB extraction buffer (preheated to 65 ℃), invert to mix, and incubate at 65 ℃ for 30 minutes, gently inverting about 5 times every 10 minutes. 5) Add 750 μl of chloroform:isoamyl alcohol (24:1) extraction buffer, tighten the cap, invert to mix, and be careful not to erase the label (Note: chloroform is a corrosive reagent and must be handled in a fume hood). 6) Centrifuge at 10,000 rpm for 10 min; clear stratification will be visible. Transfer 510 μl of the supernatant to a new 1.5 ml centrifuge tube, add 340 μl of pre-chilled isopropanol, label and verify the tube, and gently invert to mix approximately 50 times. Freeze at -20 ℃ for 30 min. Then centrifuge at 10,000 rpm for 10 min; a precipitate will be visible at the bottom of the tube. Discard the supernatant. 7) Wash the precipitate twice with 600 μl of 75% ethanol, removing as much of the remaining ethanol as possible. Then invert the 1.5 ml centrifuge tube onto a piece of paper towel to air dry. 8) Dissolve the precipitate with 200 μl of ddH2O. 9) Store the sample at -20 ℃ for later use.
[0036] The following method and procedure were used to amplify DNA by PCR using the designed primers: 1) Turn on the ice maker beforehand and freeze the reagents. 2) Thaw the following reagents: DNA, forward and reverse primers, 2×M5 PAGE Taq PCR Mix, and ddH2O (Note: Place the reagents on ice as soon as they are completely thawed. Commonly used ddH2O, primers, DNA, and enzymes can be stored in a 4 ℃ freezer). 3) After thawing, briefly centrifuge at 4000 rpm and return to ice for later use. 4) Prepare the PCR reaction mixture by adding the reagents in the order shown in the table below (reaction volume is 15 μl). Table 3 also lists the mixture formulas for 1 reaction (1R'), 10 reactions (10R'), 50 reactions (50R'), and 100 reactions (100R'). After preparation, return all reagents to a 4 ℃ or -20 ℃ freezer. 5) Mix the PCR reaction mixture thoroughly and briefly centrifuge at 4000 rpm. 6) Aliquot the mixture into 200 μl PCR reaction tubes, add 0.5 μl DNA, and label. 7) Place the PCR reaction plate (tube) in the PCR instrument, close the heat-sensitive cap, set the reaction program (as shown in Table 4), and begin amplification. 8) After amplification, place the PCR reaction tubes in a 4 ℃ refrigerator for later use.
[0037]
[0038]
[0039] Theoretically, in wild-type materials, the amplification size is 196 base pairs. sg2 The insertion of 7 bases in the mutant increased the amplified size to 203 bases. Electrophoresis using an 8% polyacrylamide gel electrophoresis showed that the heterozygous type had two distinct bands, one upper and one lower, while the mutant only had the upper band. The band size was correctly determined based on the marker and met expectations. Figure 5 ).
[0040] Example 5: Creation using CRISPR / Cas9 method Zmabcb4 mutant To clarify ZmABCB4 Regarding its role in maize kernel size, this invention employs CRISPR / Cas9 site-directed gene editing to mutate and knock out the gene's function in maize. This invention selects the maize inbred line X249 as the recipient material for gene editing, and selects... ZmABCB4 The conserved gene regions located in the MT1 sequence (SEQ ID NO. 39) and MT2 sequence (SEQ ID NO. 40) of the first exon and the first intron are the target regions for CRISPR / Cas9 gene editing.
[0041] MT1 (SEQ ID NO.39): AGAACTCGAGATCGCGCTCT MT2 (SEQ ID NO.40): GTTATCAACTGCAAGCTTGT 1. ZmABCB4 Construction of CRISPR / Cas9 gene editing vector The gene editing vector of this invention is pBUE411-MT1T2-Cas9. The base vector of this vector is pBUE411-Cas9, and the intermediate vector is pCBCmT1T2, which provides gRNA. This invention designs target sites on primers, obtains MT-sgRNA by PCR, and then ligates it into the base vector by enzyme digestion. The specific construction process is as follows.
[0042] (1) Design of target gRNA. ZmABCB4 The conserved gene sequence was input into the CRISPR website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR) for target design. The sgRNA backbone sequence of this invention was directly amplified from the intermediate vector pCBCmT1T2.
[0043] (2) MT-sgRNA was obtained by designing target sites on primers and PCR amplification. Primers ZmABCB4-MT1-F (SEQ ID NO.41) and ZmABCB4-MT2-R (SEQ ID NO.42) were used to amplify the intermediate vector pCBCmT1T2 to obtain fragments of sgRNA containing the first and second targets.
[0044] ZmABCB4-MT1-F (SEQ ID NO.41): ATATATGGTCTCTGGCGAAGAACTCGAGATCGCGCTCTGTTTTAGAGCTAGAAATAGCA ZmABCB4-MT2-R (SEQ ID NO.42): ATTATTGGTCTCTAAACACAAGCTTGCAGTTGATAACTGCTTTCTTGGTGCCGC The PCR system and conditions were as follows: template DNA (intermediate vector pCBCmT1T2 ≥30 ng / μl) 1.2 μl; Primer F / R: 1.2 μl each; sterile ddH2O: 11.4 μl; 2×MCLAB enzyme (product number: I5HMb00): 15 μl. The PCR temperature program was as follows: ① 98 ℃ for 2 min; ② 98 ℃ for 10 s; ③ 58 ℃ for 30 s; ④ 72 ℃ for 30 s; ⑤ Cycle 33 times from ② to ④; ⑥ 72 ℃ for 5 min; ⑦ 25 ℃ for 10 min. The PCR products were recovered after agarose gel electrophoresis.
[0045] (3) Construction into the backbone vector via enzyme digestion and ligation. The pBUE411-Cas9 vector and the recovered sgRNA fragment carrying the target were digested with BsaI, and T4 ligase was added to ligate the vector and the sgRNA fragment. The enzyme digestion and ligation system of 15 μl is as follows: sgRNA fragment: 2 μl, pBUE411-Cas9 vector (≥60 ng / μl): 2 μl, 10×NEB Buffer: 1.5 μl, BsaI endonuclease (product number: #R3733S): 1 μl, T4 ligase (product number: #M0202M): 1 μl, sterile ddH2O: 6 μl.
[0046] Figure 6 For the target gene ZmABCB4 The target genes (MT1 and MT2), marker genes Cas9 and bar, were used to construct the expression vector pCas9-ZmABCB4 with the backbone vector pBUE411-Cas9.
[0047] 2. Agrobacterium-mediated genetic transformation of maize The recipient was maize inbred line X249. The pCas9-ZmABCB4 vector constructed above was transformed into Agrobacterium A4 via heat shock, identified by PCR, and the bacterial culture was stored at -80 °C with glycerol. Freshly peeled immature embryos of inbred line X249, approximately 1.5 mm in size, were used as recipient material. The peeled maize embryos were placed in 2 ml centrifuge tubes containing 1.8 ml of suspension and left for no more than 1 h. Approximately 100 immature embryos were placed in each centrifuge tube. The suspension was aspirated, and the immature embryos were washed twice with fresh suspension, leaving a small amount of suspension at the bottom of the tube to submerge the embryos. Then, the tubes were heat-shocked at 43 °C for 2 min, followed by an ice bath for 1 min. The remaining wash solution at the bottom of the tube was aspirated with a pipette, and 1.0 ml of Agrobacterium infection solution was added. The tubes were gently shaken for 30 s and then incubated in the dark for 8 min. Next, pour the embryos and infection solution from the centrifuge tubes onto the co-culture medium, shake well, and then use a pipette to remove excess infection solution. Ensure all embryos have their scutellaria facing upwards and co-culture at 23 °C in the dark for 3 days. After co-culture, use sterile forceps to transfer the embryos to recovery medium and culture at 28 °C for 14 days. During this process, carefully remove any sprouts that appear on the embryos. After recovery culture, place the embryos on a selection medium containing 1.5 mg / L Bialaphos for 3 rounds of selection, each round lasting 2 weeks. Then transfer them to a selection medium containing 2 mg / L Bialaphos for 2 rounds of selection, each round lasting 2 weeks. Transfer the resistant callus to propagation medium and culture at 28 °C in the dark for 2 weeks. Then transfer the propagated resistant callus to induction medium and culture at 28 °C in the dark for 2 weeks. Finally, transfer it to differentiation medium and culture at 25 °C, 5000 lx under light for 2 weeks. After the culture is completed, the differentiated seedlings are separated into individual seedlings and placed in a rooting medium. They are cultured at 25 ℃, 5000 lx, and under light until they root. The seedlings are then transferred to small nutrient pots for growth. After they have survived, they are transplanted into a greenhouse. The offspring seeds are harvested 3-4 months later.
[0048] 3. Detection of CRISPR / Cas9 mutation results in T0 generation plants To determine the CRISPR / Cas9 mutation results in T0 generation plants, the following steps were taken: This invention uses the CTAB method to extract DNA from maize leaves, as described above. Then, based on... ZmABCB4 PCR primers were designed based on gene sequences. Detection targets: MT1 and MT2; Product size: 1143 bp; Primer sequences are shown in SEQ ID NO.43 and SEQ ID NO.44.
[0049] MT-F (SEQ ID NO.43):ATGTCTTCCCCTACATTACCGC MT-R (SEQ ID NO.44):GAGCATGGCGAGGCTAAGATG Amplify using the following PCR parameters: Reaction system: 15 μl MIX conventional PCR system, 0.5 μl forward primer, 0.5 μl reverse primer, 1 μl DNA, 5.5 μl sterile ddH2O, 7.5 μl 2×taq mix (product number: 10103ES). Reaction procedure: Conventional PCR: annealing at 58 ℃, extension for 30 s, 32 cycles.
[0050] The PCR product was then recovered and ligated into a T vector for sequencing. By sequencing the DNA sequences of the target regions of multiple T0 generation independent positive transformation events, it was determined whether gene editing had occurred in the target regions.
[0051] Two events were observed using X249 as the recipient in the transgenic plant. Homozygous mutant. Zmabcb4-1 The mutation site inserts 3 bases between bases 506 and 507 in exon 1 and deletes 405 bases between bases 89 and 493 in intron 1; Zmabcb4-2 The mutation site is located at base 496 of exon 1 to base 31 of exon 2, encompassing the entire intron 1, involving the insertion of 15 bases and the deletion of 794 bases. Figure 7 ).
[0052] 4. Genotyping of T2 generation plants Because maize T0 generation plants grown in greenhouses often exhibit uncoordinated development of female and male ears, this invention uses wild-type pollen from the maize inbred line X249 to propagate T0 generation plants and ensure the inheritance of the obtained gene-edited type. Zmabcb4-1 and Zmabcb4-2 T0 generation plants are pollinated to obtain F1 generation seeds, and the resulting plants are F1 generation plants. Self-pollination yields mutants with homozygous genetic background.
[0053] The F2 offspring obtained from self-crossing of F1 plants included two segregating types: Cas9-positive plants (transgenic plants) and Cas9-negative plants (non-transgenic plants). To prevent sgRNA and Cas9 from continuously editing the X249 wild-type allele introduced by hybridization, we selected plants from the F2 generation that did not contain the Cas9 gene but contained the T0 generation mutation type through genotyping. Figure 7 These plants can produce homozygous, non-transgenic gene-edited seeds after self-pollination. The genotyping steps for the F2 generation plants are as follows.
[0054] After extracting leaf DNA using the CTAB method described above, PCR amplification was first performed using specific primers for the Cas9 gene (SEQ ID NO.45; SEQ ID NO.46).
[0055] Cas9-F (SEQ ID NO.45):CCCGGACAATAGCGATGT Cas9-R (SEQ ID NO.46): GAGTGGGCCGACGTAGTA PCR reaction procedure: annealing at 58 ℃, extension for 30 s, 32 cycles.
[0056] After performing agarose gel electrophoresis on the PCR products, Cas9-positive and Cas9-negative plants were distinguished based on the results.
[0057] Further testing was conducted on Cas9-positive plants. ZmABCB4 The target genes MT1 and MT2 were identified using the primer sequences SEQ ID NO.43 and SEQ ID NO.44 mentioned above. After purification of the PCR product, it was ligated into a T vector and sequenced. The genetic information of the T0 generation mutation type was determined based on the sequencing results.
[0058] Plants that do not contain the Cas9 gene but contain the T0 generation mutation type were selected for the next step of seed size phenotypic verification.
[0059] Example 6 Corn ZmABCB4 Mutant seed size phenotypic verification Grain size was verified using gene-edited maize mutant materials, with wild-type X249 as a control; wild-type and... Zmabcb4-1 and Zmabcb4-2 A phenotypic survey was conducted on the female ears of the mutant plants after harvest, and the results showed that... Zmabcb4-1 and Zmabcb4-2 The mutant has smaller grain length and grain width compared to the wild type. Figure 8 ),show ZmABCB4 It can positively regulate the development process of corn kernels.
[0060] This invention confirms ZmABCB4 It plays an important role in regulating maize kernel size and has developed small kernel-specific functional markers, providing important genetic resources and technical support for improving maize kernel traits and molecular breeding for high-yield and high-quality maize.
[0061] References Burki T. Food security and nutrition in the world. The lancetDiabetes&endocrinology, 2022, 10(9): 622. Lin TS, Song Y, Lawrence P, et al. Worldwide maize and soybean yieldresponse to environmental and management factors over the 20th and 21stcenturies. Journal of Geophysical Research: Biogeosciences, 2021, 126(11):e2021JG006304. Yang C, Zhang L, Jia A, et al. Identification of QTL for maize grainyield and kernel-related traits. J Genet, 2016, 95(2): 239-47. Chen J, Zhang L, Liu S, et al. The genetic basis of natural variationin kernel size and related traits using a four-way cross population in maize.PLoS One, 2016, 11(4): e0153428. Zhang Z, Liu Z, Hu Y, et al. QTL analysis of kernel-related traits inmaize using an immortalized F2 population. PLoS One, 2014, 9(2): e89645. Pang J, Fu J, Zong N, et al. Kernel size-related genes revealed by anintegrated eQTL analysis during early maize kernel development. Plant J,2019, 98(1): 19-32. Wu H, Becraft PW, Dannenhoffer JM. Maize Endosperm Development:Tissues, Cells, Molecular Regulation and Grain Quality Improvement. FrontPlant Sci. 2022 Mar 7;13:852082. Wang Y, Liu W, Wang H, Du Q, Fu Z, Li WX, Tang J. ZmEHD1 Is Requiredfor Kernel Development and Vegetative Growth through Regulating AuxinHomeostasis. Plant Physiol. 2020 Mar;182(3):1467-1480. Wang Y, Xu J, Yu J, Zhu D, Zhao Q. Maize GSK3-like kinase ZmSK2 isinvolved in embryonic development. Plant Sci. 2022 May;318:111221. Ren RC, Kong LG, Zheng GM, Zhao YJ, Jiang X, Wu JW, Liu C, Chu J,Ding XH, Zhang XS, Wang GF, Zhao XY. Maize requires arogenate dehydratase 2for resistance to Ustilago maydis and plant development. Plant Physiol. 2024May 31;195(2):1642-1659. Yang Z, Wei H, Gan Y, Liu H, Cao Y, An H, Que X, Gao Y, Zhu L, Tan S,Liu X, Sun L. Structural insights into auxin influx mediated by theArabidopsis AUX1. Cell. 2025 Jul 24;188(15):3960-3973. Su N, Zhu A, Tao X, Ding ZJ, Chang S, Ye F, Zhang Y, Zhao C, Chen Q, Wang J, Zhou CY, Guo Y, Jiao S, Zhang S, Wen H, Ma L, Ye S, Zheng SJ, Yang F, Wu S, Guo J. Structures and mechanisms of the Arabidopsis auxin transporterPIN3. Nature. 2022 Sep;609(7927):616–621. Ma JJ, Han M. Genomewide analysis of ABCBs with a focus on ABCB1 and ABCB19 in Malus domestica. J Genet. 2016 Mar;95(1):141-9. Kamimoto Y, Terasaka K, Hamamoto M, Takanashi K, Fukuda S, Shitan N,Sugiyama A, Suzuki H, Shibata D, Wang B, Pollmann S, Geisler M, Yazaki K.Arabidopsis ABCB21 is a facultative auxin importer / exporter regulated bycytoplasmic auxin concentration. Plant Cell Physiol. 2012 Dec;53(12):2090-100. Knöller AS, Blakeslee JJ, Richards EL, Peer WA, Murphy AS.Brachytic2 / ZmABCB1 functions in IAA export from intercalary meristems. J ExpBot. 2010 Aug;61(13):3689-96. Multani DS, Briggs SP, Chamberlin MA, Blakeslee JJ, Murphy AS, JohalGS. Loss of an MDR transporter in compact stalks of maize br2 and sorghum dw3mutants. Science. 2003 Oct 3;302(5642):81-4. Xu Y, Zhang S, Guo H, Wang S, Xu L, Li C, Qian Q, Chen F, Geisler M,Qi Y, Jiang de A. OsABCB14 functions in auxin transport and iron homeostasisin rice (Oryza sativa L.). Plant J. 2014 Jul;79(1):106-17. Pang K, Li Y, Liu M, Meng Z, Yu Y. Inventory and general analysis ofthe ATP-binding cassette (ABC) gene superfamily in maize (Zea mays L.). Gene.2013 Sep 10;526(2):411-28. Shen C, Bai Y, Wang S, Zhang S, Wu Y, Chen M, Jiang D, Qi Y.Expression profile of PIN, AUX / LAX and PGP auxin transporter gene families inSorghum bicolor under phytohormone and abiotic stress. FEBS J. 2010 Jul;277(14):2954-69. Chai C, Subudhi PK. Comprehensive Analysis and Expression Profilingof the OsLAX and OsABCB Auxin Transporter Gene Families in Rice (Oryzasativa) under Phytohormone Stimuli and Abiotic Stresses. Front Plant Sci.2016 May 3;7:593。
Claims
1. Corn ZmABCB4 The application of genes in regulating maize kernel size; characterized by, Superexpression in maize ZmABCB4 Causes corn kernels to enlarge; knocks out or reduces the size of corn kernels. ZmABCB4 Genes can be used to obtain small-grained maize material; the maize ZmABCB4 The full-length DNA, cDNA, and amino acid sequences of the gene are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.
3.
2. A gene for small corn kernels Zmabcb4 Its characteristics are, This gene is as described in claim 1. ZmABCB4 The small seed gene is obtained by inserting 7 bases at position 4 of the first exon. Zmabcb4 The DNA sequence is shown in SEQ ID NO.
4.
3. A method for creating large-kernel corn material, characterized in that, Improve the quality of the maize described in claim 1 by means of transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction. ZmABCB4 Gene expression was used to obtain maize materials with increased kernel length, kernel width, and 100-kernel weight.
4. A method for creating small-kernel corn material, characterized in that, The gene editing of claim 1 is achieved using CRISPR / Cas9 gene editing technology, RNA interference technology, or other technologies. ZmABCB4 Gene knockout or knockdown produces corn material with smaller kernels.
5. The method according to claim 4, using CRISPR / Cas9 technology to process the material described in claim 1. ZmABCB4 Mutant genes created through gene editing Zmabcb4-1 and Zmabcb4-2 Its characteristics are, Zmabcb4-1 mutation site at ZmABCB4 Three bases are inserted between the 506th and 507th bases of the first exon, while 405 bases are deleted between the 89th and 493rd bases of the first intron. Zmabcb4-2 mutation site at ZmABCB4 A 15-base insertion and a 794-base deletion occur from the 496th base of exon 1 to the 31st base of exon 2.
6. Regarding the small-seed maize gene described in claim 2 Zmabcb4 The developed functional marker ZmABCB4-Indel is characterized by, The functional markers include the first primer ZmABCB4-Indel-F and the second primer ZmABCB4-Indel-R, whose sequences are SEQ ID NO.5 and SEQ ID NO.6, respectively.
7. The application of the functional marker ZmABCB4-Indel as described in claim 6 in maize breeding; characterized in that, This functional marker can simultaneously distinguish the Z described in claim 1. mABCB4 Gene and as described in claim 2 Zmabcb4 Gene.
Citation Information
Patent Citations
Application of corn zma-miR164e and target gene thereof in regulation and control of grain size
CN111518810A
Corn ZmMYBR37 gene and application thereof in regulation and control of corn kernel size
CN120796310A