A low-oxygen-tolerant snp molecular marker of megaleseus and detection and application thereof

Abstract

The application belongs to the technical field of biology, and discloses a sarpickle tolerance snp molecular marker, detection and application thereof, and three SNP sites of the SNP molecular marker related to the sarpickle tolerance trait, which are respectively located at nucleotide sites 14321966, 14323457 and 14323789 of a sarpickle reference genome CM032046.1, and the polymorphisms are respectively G / A, T / C and C / A, and are respectively named SNP1, SNP2 and SNP3. Based on the SNP molecular marker, the sarpickle tolerance trait can be identified by detecting the SNP site genotype, the sarpickle with low oxygen tolerance can be screened, and the breeding of the sarpickle with low oxygen tolerance is accelerated, so that the long-term and stable development of the sarpickle breeding industry is promoted.

Description

Technical Field

[0001] This application relates to the field of biotechnology, and in particular to a low-oxygen SNP molecular marker for blunt snout bream and its detection and application. Background Technology

[0002] The bluntnose bream (Megalobrama amblycephala) belongs to the order Cypriniformes, family Cyprinidae, subfamily Culterinae, and genus Megalobrama. It is characterized by its low susceptibility to disease, delicious flavor, and intolerance to low oxygen levels, making it an important aquaculture species.

[0003] Dissolved oxygen is a fundamental condition for fish survival, and suitable dissolved oxygen levels are crucial for their normal growth, development, and reproduction. When dissolved oxygen in the water is insufficient, fish suffer a series of negative effects, including decreased mobility, difficulty breathing, metabolic disorders, restricted growth, weakened immunity, and even potential threats to their survival. Blunt-snout bream are particularly sensitive to low-oxygen environments; fluctuations in dissolved oxygen levels during aquaculture can easily lead to hypoxia, resulting in severe aquaculture losses and limiting their profitability and total yield. Therefore, it is urgent to breed low-oxygen-tolerant blunt-snout bream varieties.

[0004] Molecular marker-assisted breeding utilizes molecular markers closely related to traits to directly select individuals with corresponding alleles or genotypes exhibiting trait advantages, thereby improving the accuracy of selection and shortening the breeding cycle. However, few molecular markers related to hypoxia tolerance in blunt snout bream have been reported to date, and it is necessary to continuously explore molecular markers associated with its resistance to facilitate the breeding of hypoxia-tolerant varieties of blunt snout bream.

[0005] The technical problem to be solved by this application is: how to obtain a molecular marker related to hypoxia tolerance in blunt snout bream from the genome. Summary of the Invention

[0006] The purpose of this application is to provide molecular markers related to hypoxia tolerance in blunt snout bream obtained through screening, and to design primers and detection reagents based on the screened molecular markers, so as to facilitate subsequent detection, breeding and screening of hypoxia tolerance traits in blunt snout bream.

[0007] To achieve the above objectives, this application discloses an SNP molecular marker for the hypoxia tolerance trait of blunt snout bream. The SNP sites of the SNP molecular marker include SNP1, SNP2 and SNP3 sites, and SNP1, SNP2 and SNP3 sites are located at nucleotide positions 14321966, 14323457 and 14323789 of the GAPDH gene, respectively, with polymorphisms of G / A, T / C and C / A, respectively.

[0008] In addition, this application also discloses the application of SNP molecular markers of hypoxia tolerance in the breeding of bream with hypoxia tolerance.

[0009] In addition, this application also discloses a method for detecting SNP molecular markers of the hypoxia tolerance trait in blunt snout bream, which involves designing a set of detection primers with the above-mentioned SNP molecular markers of the hypoxia tolerance trait in blunt snout bream as detection targets and detecting the genotypes of SNP1, SNP2 and SNP3 loci.

[0010] The detection primer set consists of a first primer set, a second primer set, and a third primer set;

[0011] The first primer set was designed based on SNP1 and includes a first upstream primer and a first downstream primer;

[0012] The second primer set was designed based on SNP2 and includes a second upstream primer and a second downstream primer;

[0013] The third primer set was designed based on SNP3 and includes a third upstream primer and a third downstream primer.

[0014] The nucleotide sequence of the first upstream primer is shown in SEQ ID NO.1;

[0015] The nucleotide sequence of the first downstream primer is shown in SEQ ID NO.2;

[0016] The nucleotide sequence of the second upstream primer is shown in SEQ ID NO.3;

[0017] The nucleotide sequence of the second downstream primer is shown in SEQ ID NO.4;

[0018] The nucleotide sequence of the third upstream primer is shown in SEQ ID NO.5;

[0019] The nucleotide sequence of the third downstream primer is shown in SEQ ID NO.6.

[0020] Furthermore, this application also discloses the application of the detection primer set described above in the preparation of products for identifying the hypoxia tolerance trait of blunt snout bream.

[0021] In addition, this application also discloses the application of the detection primer set described above in the preparation of products for screening hypoxia-resistant bream.

[0022] The beneficial effects of this application are: this application obtains molecular markers related to the hypoxia tolerance of blunt snout bream through screening, and designs primers and detection reagents based on the screened molecular markers, so as to facilitate subsequent detection, breeding and screening of the hypoxia tolerance trait of blunt snout bream. Attached Figure Description

[0023] Figure 1This is a sequencing peak diagram of the SN1P site, a molecular marker for SNPs. The arrows indicate the SNP sites. A single peak indicates a homozygous genotype, and multiple peaks indicate a heterozygous genotype. This genotype is AA.

[0024] Figure 2 This is a sequencing peak diagram of the SNP1 site, a molecular marker for SNPs. The arrows indicate the SNP sites. A single peak indicates a homozygous genotype, and multiple peaks indicate a heterozygous genotype. This genotype is GG.

[0025] Figure 3 This is a sequencing peak diagram of the SNP1 site, a molecular marker for SNPs. The arrows indicate the SNP sites. A single peak indicates a homozygous genotype, and multiple peaks indicate a heterozygous genotype. This genotype is GA.

[0026] Figure 4 This is a sequencing peak diagram of the SNP2 site, a molecular marker for SNPs. The arrows indicate the SNP sites. A single peak indicates a homozygous genotype, and multiple peaks indicate a heterozygous genotype. This genotype is the TT type.

[0027] Figure 5 This is a sequencing peak diagram of the SNP2 site, a molecular marker for SNPs. The arrows indicate the SNP sites. A single peak indicates a homozygous genotype, and multiple peaks indicate a heterozygous genotype. This genotype is the TC type.

[0028] Figure 6 This is a sequencing peak diagram of the SNP2 site, a molecular marker for SNPs. The arrows indicate the SNP sites. A single peak indicates a homozygous genotype, and multiple peaks indicate a heterozygous genotype. This genotype is CC.

[0029] Figure 7 This is a sequencing peak diagram of the SNP3 site, a molecular marker for SNPs. The arrows indicate the SNP sites. A single peak indicates a homozygous genotype, and multiple peaks indicate a heterozygous genotype. This genotype is CC.

[0030] Figure 8 This is a sequencing peak diagram of the SNP3 site, a molecular marker for SNPs. The arrows indicate the SNP sites. A single peak indicates a homozygous genotype, while multiple peaks indicate a heterozygous genotype. This genotype is CA. Detailed Implementation

[0031] The present application will be clearly and completely described below with reference to its embodiments. It should be noted that, unless specific conditions are specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0032] Example 1: Cloning of the GAPDH gene sequence of blunt snout bream and screening and typing of SNP sites.

[0033] 1. Sample processing and collection

[0034] The blunt snout bream samples used in this experiment were collected from an aquaculture farm, with each bream weighing approximately 45 g, totaling 200 bream, and were subjected to acute hypoxia stress. After the experiment began, a sealed environment was created by covering the tanks with plastic film. The dissolved oxygen (DO) level was adjusted by introducing nitrogen gas into the tanks, aiming to reduce the DO level to 0.3 mg / L within 2 hours, at which point it was recorded as 0h. Under these conditions, the first 10% of the blunt snout bream to exhibit surface surfacing and sideways roll were designated as the hypoxia-intolerant group (Intol), and the subsequent 10% to exhibit surface surfacing and belly roll were designated as the oxygen-tolerant group (Tol). Simultaneously, the caudal fins were cut off and preserved in 95% alcohol.

[0035] It should be further noted that water samples were collected from the experimental groups every hour during the experiment. Dissolved oxygen (DO) values ​​were measured using a dissolved oxygen meter and adjusted accordingly. The fish were fasted during the experiment. After the collected blunt snout bream were transferred from the rearing ponds to buckets and kept in a stable environment, they were covered with plastic film to create a sealed environment. Nitrogen gas was introduced into these buckets to regulate the dissolved oxygen concentration, aiming to reduce it to 0.3 mg / L within 2 hours. The water temperature was maintained at 27–29°C. Twenty individuals that first exhibited surfacing and sideways rolling were collected to form the hypoxia-intolerant group (Intol), and twenty individuals that last reached the surfacing and belly-rolling stage were collected to form the oxygen-tolerant group (Tol). Fin samples were taken from both the hypoxia-intolerant (Intol) and oxygen-tolerant (Tol) groups and preserved in anhydrous ethanol.

[0036] 2. PCR amplification of the GAPDH gene sequence

[0037] (1) Design of PCR amplification primers

[0038] Based on the GAPDH gene sequence of blunt snout bream published in the GenBank database (NCBI Gene ID: 125242875), PCR amplification primers for amplifying its GAPDH gene sequence were designed. The designed PCR amplification primers are shown in Table 1.

[0039] Table 1 PCR amplification primers

[0040]

[0041] (2) PCR amplification of GAPDH gene sequence

[0042] Genomic DNA was extracted from the hypoxia-intolerant (Intol) and oxygen-tolerant (Tol) bream samples, and the concentration was detected by ultraviolet spectrophotometer before being diluted to 100 ng / µL.

[0043] Using diluted genomic DNA as a template, the GAPDH gene sequence was amplified using the PCR amplification primers shown in Table 1. The PCR reaction system used for amplification is shown in Table 2.

[0044] Table 2 PCR reaction system

[0045] reagents Dosage (μL) 2×Taq PCR Master Mix enzyme 15 Genomic DNA 1 Primer-F (concentration 10 pmol / μL) 1 Primer-R (concentration 10 pmol / μL) 1 <![CDATA[ddH2O]]> Add 30μL

[0046] PCR reaction conditions: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ extension for 5 min.

[0047] The purity and integrity of the PCR amplification products were checked by 1% agarose gel electrophoresis. Products with single and bright bands were selected and sent to Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd. for Sanger sequencing.

[0048] 3. Screening and genotyping of SNP loci

[0049] The sequencing results of PCR amplification products from 20 low-oxygen-tolerant (Intol) and 20 high-oxygen-tolerant (Tol) bream were compared with the reference sequence (NCBI Gene ID: 125242875). Sites with a different base ratio greater than 1 / 3 at the same locus were identified as SNP sites.

[0050] Comparative analysis revealed three SNP sites in this application, named SNP1 (SNP1 G>A), SNP2 (SNP2 T>C), and SNP3 (SNP3 C>A). SNP1 is located at position 14321966 of the *Brucea bream* reference genome CM032046.1, within the exon region of the GAPDH gene. It encodes an amino acid and alters the amino acid type, constituting a missense SNP mutation.

[0051] The SNP sites 2 and 3 are located at positions 14323457 and 14323789 of the reference genome CM032046.1 of the blunt snout bream, respectively. Both are located in the exon region of the GAPDH gene and are involved in encoding amino acids. Among them, SNP2 T>C does not change the amino acid type and is a synonymous mutation, while SNP3 C>A changes the amino acid type and is a missense mutation.

[0052] Furthermore, surprisingly, the individuals who mutated SNP1 and SNP2 were the same individuals. However, due to the relatively small sample size, it is still difficult to determine whether there is a real correlation between SNP1 and SNP2 or just a coincidence. Therefore, we will further increase the number of samples tested to further confirm whether there is a correlation between SNP1 and SNP2.

[0053] The relevant information of the SNP sites is summarized in Table 3:

[0054] Table 3. Information on SNP sites in the exon region of the GAPDH gene in blunt snout bream.

[0055] Site name Genome location Ref Alt Mutation type Ref encodes amino acids The mutation site encodes an amino acid locus genotype SNP1 G>A CM032046.1-14321966 G A Exon mutations R H GG GA AA SNP2 T>C CM032046.1-14323457 T C Exon mutations P P TT TC CC SNP3 C>A CM032046.1-14323789 C A Exon mutations P H CC CA AA

[0056] This application also determined the genotype of the SNP locus through sequencing peak analysis. The sequencing peak diagram of the SNP molecular marker at the SNP locus is shown below. Figure 1-8 As shown in the figure; the arrows indicate SNP sites, a single peak indicates a homozygous genotype, and multiple peaks indicate a heterozygous genotype; Figure 1 The corresponding genotype is AA; Figure 2 The corresponding genotype is GG; Figure 3 The corresponding genotype is GA. Figure 4 The corresponding genotype is TT. Figure 5 The corresponding genotype is TC. Figure 6 The corresponding genotype is CC. Figure 7 The corresponding genotype is CC. Figure 8 The corresponding genotype is CA. (From...) Figure 1-3 It can be seen that SNP1 G>A has three genotypes: GG / GA / AA. From... Figure 4-6 It can be seen that SNP2 T>C has three genotypes: TT / TC / CC. From... Figure 7-8 It can be seen that SNP3 C>A has two genotypes, namely CC / CA.

[0057] Based on the results shown in the genotype statistics table, the association between the genotypes of the SNP loci and the hypoxia tolerance trait of blunt snout bream was analyzed using the General Linear Model (GLM) program and t-test of the analysis software. The results showed significant differences after analysis of variance, and multiple comparisons were performed using Duncan's method.

[0058] The alleles and genotypes of the SNP loci described in this application in the hypoxia-sensitive and hypoxia-tolerant populations of blunt snout bream are shown in Table 4. Table 4 shows that blunt snout bream with SNP1 allele A exhibited significantly higher resistance than those with SNP2 allele G (p < 0.01), those with SNP2 allele C exhibited significantly higher resistance than those with SNP2 allele T (p < 0.01), and those with SNP3 allele A exhibited significantly higher resistance than those with SNP3 allele C (p < 0.05). This indicates a correlation between the SNP molecular markers described in this application and the hypoxia tolerance and intolerance traits of blunt snout bream.

[0059] Table 4. Alleles and genotypes of SNP sites in hypoxia-tolerant and hypoxia-intolerant populations of blunt snout bream.

[0060]

[0061] Example 2: Genotyping of SNP loci and verification of their association with hypoxia tolerance.

[0062] 1. Genotyping of SNP loci

[0063] This application uses the same method as in Example 1, and collects 155 hypoxia-tolerant blunt snout bream samples and 149 hypoxia-sensitive blunt snout bream samples. The SNaPshot genotyping method is used to detect the genotype of the SNP loci in the samples.

[0064] Based on the sequence information of the SNP sites described in Example 1, this application designed corresponding SNaPshot genotyping primers, including amplification primers and extension primers for the three SNP1, SNP2, and SNP3 sites. The primer sequences and their annealing temperatures are shown in Table 5.

[0065] Table 5 SNaPshot typing primers

[0066] Primer name Primer nucleotide sequence (5'-3') SEQ ID NO Annealing temperature SNP1 amplification primer SNP1-P1F TGAGTGGTGGGATTGAACGT 1 60℃ SNP1 extension primer SNP1-E gactgactgactgactgactCCGGTAGACTCCACAACATA 2 52℃ SNP2 amplification primer SNP1-P1F ACCCAACATCCACTTCCACA 3 60℃ SNP2 extension primer SNP1-E ctgactgactgactgactgactgactGTATTGGCCTTCCGTGTCCCCAC 4 52℃ SNP3 amplification primer SNP1-P1F GGCATTCTGGGCTACACAGA 5 60℃ SNP3 extension primer SNP1-E ctgactgactgactgactgactgactgactCAGCACCAGCATCAAAGATAGA 6 52℃

[0067] Genomic DNA was extracted from the 344 blunt snout bream samples. Using the extracted genomic DNA as a template, PCR amplification was performed using the SNaPshot typing primers shown in Table 5. The PCR reaction system is shown in Table 6.

[0068] Table 6. PCR reaction system for SNaPshot typing detection

[0069] reagents Dosage (μL) 2×Taq PCR Master Mix enzyme 5 Genomic DNA 1 SNP1-P1F (concentration 10 pmol / μL) 1 <![CDATA[ddH2O]]> Make up to 10μL

[0070] PCR reaction conditions: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 20 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; final extension at 72℃ for 3 min. After the PCR reaction, the PCR amplification products were treated with SAP (shrimp alkaline phosphatase) to remove free dNTPs from the system. Single-base extension was performed after the shrimp alkaline phosphatase treatment, and the reaction system is shown in Table 7.

[0071] Table 7 Reaction system for monobasic extension reaction

[0072] reagents Dosage (μL) SNaPshot Mix 0.5 PCR products 3 SNP1-E (concentration 10 pmol / μL) 1 <![CDATA[ddH2O]]> Add 5μL

[0073] Single-base extension reaction conditions: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 5 s, 52℃ annealing for 5 s, 60℃ extension for 5 s, for a total of 35 cycles; final extension at 72℃ for 3 min. The reaction products were sequenced and analyzed using a 96-channel fully automated ABI 3730xL genetic analyzer.

[0074] Raw data were exported from the 3730xL instrument, categorized and archived according to detection reactions, and then imported into the analysis software. The primer ratios for each site were adjusted based on signal values ​​and peak patterns to ensure consistency between signal values ​​and peak patterns. Statistical analysis was performed according to sample and locus characteristics to obtain genotyping results for each site, and a genotyping table was exported.

[0075] 2. Association Validation

[0076] Based on the results shown in the genotype statistics table, the association between the genotypes of the SNP loci and the hypoxia tolerance trait of blunt snout bream was verified using the General Linear Model (GLM) program and t-test of the analysis software. The results showed significant differences after analysis of variance, and multiple comparisons were performed using Duncan's method.

[0077] The alleles and genotypes of the SNP loci described in this application in the hypoxia-sensitive and hypoxia-tolerant populations of blunt snout bream are shown in Table 8. Table 8 shows that blunt snout bream with SNP1 genotypes GA and AA exhibited significantly higher hypoxia tolerance than those with genotype GG (p < 0.05); blunt snout bream with SNP2 genotypes CC and CT exhibited significantly higher hypoxia tolerance than those with genotype TT (p < 0.05); and blunt snout bream with SNP3 genotype CA exhibited significantly higher hypoxia tolerance than those with genotype CC (p < 0.05). This indicates that the SNP molecular markers described in this application are indeed associated with the hypoxia tolerance and intolerance traits of blunt snout bream.

[0078] Furthermore, during the experiment, we found that when the sample size was expanded and SNP1 mutated from G to A, SNP2 still mutated accordingly, and the individuals who mutated SNP1 and SNP2 were the same individuals; it can be seen that there is indeed a correlation between SNP1 and SNP2, and the two show consistency in mutation.

[0079] Table 8. Alleles and genotypes of SNP sites in hypoxia-tolerant and hypoxia-intolerant populations of blunt snout bream.

[0080]

[0081] In summary, the SNP loci discovered in this application are of great significance in breeding, mainly in two aspects:

[0082] 1. It is significant for continuous optimization through generations. For example, when SNP1 is of the GA genotype, there are 24 low-oxygen tolerant blunt snout bream and 10 low-oxygen intolerant blunt snout bream. That is to say, 70.58% of the individuals of the GA genotype blunt snout bream are low-oxygen tolerant. In the breeding process, this difference can be continuously reduced through multiple generations and screening, thereby significantly optimizing the low-oxygen tolerance of the blunt snout bream population.

[0083] 2. In genetic breeding, identifying alleles is an important method. The combination of multiple alleles can further improve the accuracy of screening. The significance of this case lies in the fact that if the alleles selected in this case combine with existing or future alleles at different positions, the screening accuracy will be significantly improved. In other words, this case provides an important source of information for more precise screening.

[0084] On the other hand, the SNP1 and SNP2 sites discovered in this application show obvious mutational consistency, which further improves the convenience of the breeding and screening process of low-oxygen-tolerant blunt snout bream, and the two SNP sites showing mutational consistency also improve the stability of the low-oxygen-tolerant trait of blunt snout bream.

[0085] Example 3: Genetic analysis of SNP loci

[0086] The genetic analysis results of the SNP loci described in this application are shown in Table 9. This indicates that SNP1 G>A, SNP2 T>C, and SNP3 C>A, as genetic markers, can provide relatively reasonable genetic information.

[0087] Table 9. Genetic information of SNP loci

[0088] site Na He Ne PIC SNP1 G>A 2 0.219 1.28 0.195 SNP2 T>C 2 0.219 1.28 0.195 SNP3 C>A 2 0.18 1.22 0.164

[0089] Note: Na is the number of alleles; He is the observed heterozygosity; Ne is the expected heterozygosity; PIC is the polymorphism information content.

Claims

1. The application of a reagent for detecting SNP sites related to hypoxia tolerance in blunt snout bream in the breeding of blunt snout bream with hypoxia tolerance, characterized in that, The SNP sites are SNP1, SNP2 and SNP3, and SNP1, SNP2 and SNP3 are located at nucleotide positions 14321966, 14323457 and 14323789 of the reference genome CM032046.1 of the blunt snout bream, respectively, with polymorphisms of G / A, T / C and C / A, respectively.

2. The use of the reagent as described in claim 1 for detecting SNP sites related to the hypoxia tolerance trait of blunt snout bream in the preparation of products for identifying the hypoxia tolerance trait of blunt snout bream.

3. The use of the reagent as described in claim 1 for detecting SNP sites related to the hypoxia tolerance trait of blunt snout bream in the preparation of products for screening hypoxia-tolerant blunt snout bream.

Images