Method for accurately identifying and screening morchella strain by using molecular marker

Abstract

The invention discloses a method for accurately identifying and screening morchella strains by using molecular markers, and belongs to the technical field of edible mushrooms. The method comprises the following steps: transferring a purified morchella strain to a culture medium for dark light cultivation; adding the cultured morchella hyphae into liquid nitrogen, grinding into powder, then adding a lysis solution, and carrying out lysis; adding modified magnetic beads into the lysate for adsorption, and then filtering, washing and eluting to obtain a DNA extracting solution; carrying out PCR (Polymerase Chain Reaction) amplification on the DNA; then carrying out high-resolution detection on an ISSR product; and then, carrying out functional SNP-KASP typing. According to the method, by fusing ISSR polymorphism analysis and a functional SNP-KASP typing technology, magnetic beads are used for adsorbing DNA to remove polysaccharide interference, and on the basis that the low cost advantage of traditional ISSR is reserved, three functional markers are completed, and accurate screening of yield, heat resistance and flavor is achieved.

Description

Technical Field

[0001] This invention belongs to the field of edible fungi technology, specifically relating to a method for the precise identification and screening of morel species using molecular markers. Background Technology

[0002] Morel mushrooms (scientific name: *Morchella esculenta* (L.) Pers.) are fungi belonging to the family Morchicaceae and the genus *Morchella*. The cap is nearly spherical, oval to elliptical, reaching up to 10 cm in height, with a blunt, rounded apex and pitted surfaces resembling a sheep's stomach. Morels are recognized worldwide as rare and valuable edible and medicinal fungi, prized for their delicious taste, high nutritional value, and health benefits, making them highly popular among consumers.

[0003] Among numerous molecular biological methods for studying genetic diversity, ISSR is a recently developed and practical method characterized by its simplicity, speed, efficiency, wide applicability, high genetic polymorphism, and good reproducibility. Because ISSR is widely distributed in macrofungi and evolves rapidly, the results obtained from ISSR can provide a variety of genetic information. Therefore, the ISSR method is currently widely used in research on fungal genetic diversity and germplasm resource identification.

[0004] Currently, there is a need for a precise method for the identification and screening of morel mushroom species. Summary of the Invention

[0005] In view of this, the purpose of this invention is to provide a method for accurate identification and screening of morel species using molecular markers.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] This invention provides a method for the precise identification and screening of morel mushroom species using molecular markers, comprising the following steps:

[0008] A method for precise identification and screening of morel mushroom species using molecular markers includes the following steps:

[0009] S1. The purified morel strain was transferred to a culture medium and cultured in the dark.

[0010] S2. The cultivated morel mycelia are ground into powder by adding liquid nitrogen, and then lysis buffer is added for lysis.

[0011] S3. Modified magnetic beads are added to the lysis buffer for adsorption, followed by filtration, washing, and elution to obtain DNA extract;

[0012] S4. Amplify the DNA by PCR; then perform high-resolution detection of the ISSR product; and finally perform functional SNP-KASP typing.

[0013] Preferably, the culture medium in S1 is PDA medium, comprising 200g potato, 20g glucose, 18g agar, 1000mL water, and pH 7.0.

[0014] Preferably, the lysis buffer in S2 consists of 1.5 mL CTAB buffer, 30 U / mg chitinase, and 20 U / mg β-glucanase.

[0015] Preferably, the modified magnetic beads in S3 are coated with morel DNA affinity peptides with a particle size of 1 μm.

[0016] Preferably, the PCR amplification system in S4 is a 20 μL system: 10 μL of 2×Rapid Taq Master Mix, 1 μL of 10 μM primers, 3 μL of 50 ng / μL template DNA, and 6 μL of ddH2O.

[0017] Preferably, the method for high-resolution detection of ISSR products in S4 is as follows:

[0018] The electrophoretic colloid was 8% non-denaturing polyacrylamide gel.

[0019] The electrophoresis conditions were: 1×TBE buffer, constant voltage 200V, electrophoresis for 2 hours;

[0020] The staining method is silver staining:

[0021] 1. Fixation: 10% ethanol + 0.5% glacial acetic acid for 10 min;

[0022] 2. Staining: 0.2% AgNO3 for 20 min;

[0023] 3. Development: 3% Na2CO3 + 0.05% formaldehyde.

[0024] Preferably, the functional SNP-KASP classification step in S4 is as follows:

[0025] 1. Develop SNP loci;

[0026] 2. KASP detection;

[0027] The SNP-related traits include yield, heat resistance, and n-octanol content;

[0028] The KASP detection reaction system is as follows:

[0029] 5μL system:

[0030] KASP Master Mix 2.5μL

[0031] SNP primer mixture 12nM 0.07μL

[0032] DNA template 20 ng / μL 1.0 μL

[0033] ddH2O 1.43μL.

[0034] Preferably, the amplification cycle is: 94℃ for 15 min, 10 cycles at 4℃ for 20 s; 61℃, 55℃-0.6℃ / cycle for 60 s, 26 cycles at 94℃ for 20 s; 55℃ for 60 s.

[0035] It contains at least the following beneficial technical effects:

[0036] This invention integrates ISSR polymorphism analysis and functional SNP-KASP typing technology. While retaining the low-cost advantages of traditional ISSR, it innovatively uses 8% PAGE silver staining instead of agarose gel electrophoresis to improve resolution, and introduces three functional markers, MhSSNP1 / 2 / 3, to achieve precise screening of yield, heat resistance, and flavor. Detailed Implementation

[0037] Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without inventive effort are within the scope of protection of this invention. The invention will now be described with reference to specific embodiments. It should be noted that these embodiments are merely descriptive and do not limit the invention in any way.

[0038] Example 1

[0039] 1. Materials and Methods

[0040] 1.1 Test strains

[0041] Germplasm sources: Gansu (YDJ-0175, YDJ-0180), Shandong (YDJ-0182, YDJ-0188), Zhejiang (YDJ-0167, YDJ-0168, YDJ-0169, YDJ-0171)

[0042] 1.2 Determination of colony morphology characteristics

[0043] The purified morel mushroom strain was transferred to the center of potato dextrose agar (PDA medium, consisting of 200 g potato, 20 g glucose, 18 g agar, 1000 mL water, pH 7.0) plates, with five replicates, and incubated in the dark at 25°C. The growth rate of the strain was determined using the cross-cross method, the time of sclerotia emergence was recorded, and the colony growth status of the morel mushrooms was observed.

[0044] 1.3 DNA Extraction

[0045] The prepared morel mycelia were ground using liquid nitrogen, and then lysis buffer was added. The lysis buffer consisted of 1.5 mL CTAB buffer, chitinase 30 U / mg, and β-glucanase 20 U / mg. Magnetic beads coated with morel DNA affinity peptides were added for adsorption, followed by filtration, washing, and elution to obtain DNA extract. The DNA was then diluted to a concentration of c = 20 ng / μL. -1 After mixing well, divide into portions and store in a -20℃ refrigerator for later use.

[0046] 1.4 Amplification of DNA by PCR

[0047] Primer 1: TCCGTAGGTGAACCTGCGG

[0048] Primer 2: TCCTCCGCTTATTGATATGC

[0049] Primer 3: AACCGGTATATCACGTYGGTAT

[0050] Primer 4: GCCTCRAATTCGTTGACRACGT;

[0051] The amplification system used was a 20 μL system: 2×Rapid Taq Master Mix 10 μL, primer 10 μM 1 μL, template DNA 50 ng / μL 3 μL, ddH2O 6 μL.

[0052] 1.5 ISSR product high-resolution detection

[0053] The electrophoretic colloid was 8% non-denaturing polyacrylamide gel.

[0054] The electrophoresis conditions were: 1×TBE buffer, constant voltage 200V, electrophoresis for 2 hours;

[0055] The staining method is silver staining:

[0056] 1. Fixation: 10% ethanol + 0.5% glacial acetic acid for 10 min;

[0057] 2. Staining: 0.2% AgNO3 for 20 min;

[0058] 3. Development: 3% Na2CO3 + 0.05% formaldehyde.

[0059] 1.6 Functional SNP Tagging Development

[0060] The KASP detection reaction system is as follows:

[0061] 5μL system:

[0062] KASP Master Mix 2.5μL

[0063] SNP primer mixture 12nM 0.07μL

[0064] DNA template 20 ng / μL 1.0 μL

[0065] ddH2O 1.43μL.

[0066] Preferably, the amplification cycle is: 94℃ for 15 min, 10 cycles at 4℃ for 20 s; 61℃, 55℃-0.6℃ / cycle for 60 s, 26 cycles at 94℃ for 20 s; 55℃ for 60 s.

[0067] 1. Phenotypic determination: The yield (g / bag) and heat resistance (survival rate at 35℃) of the strain were determined;

[0068] 2. GWAS analysis: GEMMA software was used to screen for significantly associated loci (P < 1 × 10⁻⁶). -5 );

[0069] 3. Obtain functional SNPs: including parameters such as yield, heat resistance, and n-octanol content. The results of screening existing strains are shown in Table 1.

[0070] Table 1

[0071] SNP ID: Allele effect of chromosome location-related traits MhSSNP1 chr3:1,782,654 Average yield increase of 18.3g / bag MhSSNP2 chr5:9,430,221 exhibits high heat resistance with a 47% survival rate at 35℃.

[0072] MhSSNP3 chr8:3,562,098 has 2.1 times higher n-octanol content and flavor compound content.

[0073] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for precise identification and screening of morel mushroom species using molecular markers, characterized in that, Includes the following steps: S1. The purified morel strain was transferred to a culture medium and cultured in the dark. S2. The cultivated morel mycelia are ground into powder by adding liquid nitrogen, and then lysis buffer is added for lysis. S3. Modified magnetic beads are added to the lysis buffer for adsorption, followed by filtration, washing, and elution to obtain DNA extract; S4. Amplify the DNA by PCR; then perform high-resolution detection of the ISSR product; and finally perform functional SNP-KASP typing.

2. The precise identification and screening method according to claim 1, characterized in that, The culture medium in S1 is PDA medium, which includes 200g of potato, 20g of glucose, 18g of agar, 1000mL of water, and pH 7.

0.

3. The precise identification and screening method according to claim 1, characterized in that, The lysis buffer in S2 consists of 1.5 mL CTAB buffer, chitinase 30 U / mg, and β-glucanase 20 U / mg.

4. The precise identification and screening method according to claim 1, characterized in that, The modified magnetic beads in S3 are coated with morel DNA affinity peptides with a particle size of 1 μm.

5. The precise identification and screening method according to claim 1, characterized in that, The S4 amplification PCR system is a 20μL system: 2×Rapid Taq Master Mix, 10μL; primers, 10μM, 1μL; template DNA, 50ng / μL, 3μL; ddH2O, 6μL.

6. The precise identification and screening method according to claim 1, characterized in that, The method for high-resolution detection of ISSR products in S4 is as follows: The electrophoretic colloid was 8% non-denaturing polyacrylamide gel. The electrophoresis conditions were: 1×TBE buffer, constant voltage 200V, electrophoresis for 2 hours; The staining method is silver staining:

1. Fixation: 10% ethanol + 0.5% glacial acetic acid for 10 min; 2. Staining: 0.2% AgNO3 for 20 min; 3. Development: 3% Na2CO3 + 0.05% formaldehyde.

7. The precise identification and screening method according to claim 1, characterized in that, The functional SNP-KASP classification steps in S4 are as follows:

1. Develop SNP loci; 2. KASP detection; The SNP-related traits include yield, heat resistance, and n-octanol content; The KASP detection reaction system is as follows: 5μL system: KASP Master Mix 2.5μL SNP primer mixture 12nM 0.07μL DNA template 20 ng / μL 1.0 μL ddH2O 1.43μL.

8. The precise identification and screening method according to claim 7, characterized in that, The amplification process is as follows: 94℃ for 15 min, 10 cycles at 4℃ for 20 s; 61℃, 55℃-0.6℃ / cycle for 60 s, 26 cycles at 94℃ for 20 s; 55℃ for 60 s.