Molecular marker of cold resistance in wheat and its application in detecting cold resistance of wheat

By using KASP technology to detect the SNP site at nucleotide 538 in the wheat genome, the efficiency and accuracy problems of wheat cold resistance detection in existing technologies have been solved, enabling efficient breeding selection.

CN120945120BActive Publication Date: 2026-02-27XIANGHU LABORATORY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511483487.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-17
Publication Date
2026-02-27
Estimated Expiration
2045-10-17

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently detecting the cold resistance of wheat, which affects the accuracy and efficiency of wheat breeding.

Method used

The KASP technique based on competitive allele-specific PCR was used to detect the SNP site at nucleotide 538 in the wheat genome using specific primers KASP_CBF-F1, KASP_CBF-F2 and KASP_CBF-R, and the cold resistance of wheat was determined by the fluorescence signal.

Benefits of technology

This method enables efficient and accurate detection of wheat cold resistance, improves the accuracy and efficiency of breeding, and allows for the selection of the CC genotype with strong cold resistance as a parent for breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120945120B_ABST
    Figure CN120945120B_ABST
Patent Text Reader

Abstract

The application discloses a wheat cold resistance molecular marker and application thereof in detecting wheat cold resistance, and belongs to the technical field of biotechnology.The application solves the technical problem of how to detect the cold resistance of wheat.The disclosed wheat cold resistance molecular marker is a nucleotide corresponding to the 538th nucleotide of SEQ ID No.1 in the wheat genome, which is A or C, the cold resistance of a homozygous wheat with the nucleotide corresponding to the 538th nucleotide of SEQ ID No.1 in the genome being C is greater than or candidate greater than that of a homozygous wheat with the nucleotide corresponding to the 538th nucleotide of SEQ ID No.1 in the genome being A, and the nucleotide corresponding to the 538th nucleotide of SEQ ID No.1 in the genome can be used as a reference for selecting a wheat as a parent in the breeding process of wheat cold resistance.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a wheat cold resistance molecular marker and application thereof in detecting wheat cold resistance. BACKGROUND

[0002] Wheat is one of the most widely planted crops in the world, and wheat freeze injury seriously affects the growth and yield of wheat and seriously restricts the wheat production in the region. Therefore, wheat cold resistance has become an important problem faced by wheat production and breeding in winter wheat regions.

[0003] DNA molecular marker refers to a specific DNA fragment reflecting the difference in the genome between individuals or populations, and is a genetic marker based on the nucleotide sequence variation in DNA between individuals. It is stable in individuals and is not affected by environment and developmental period. Molecular marker technology provides a new tool and method for wheat breeding by using genetic variation at the DNA level. With the development of molecular biology in recent years, the application of DNA molecular marker technology in breeding not only accelerates the breeding process, but also improves the accuracy and efficiency of breeding. At present, the molecular marker detection technology has developed to the third generation. Among them, the first generation is a marker technology based on molecular hybridization technology, such as restriction fragment length polymorphism (RFLP); the second generation is a molecular marker technology based on PCR technology, including sequence tagged sites (STS), simple sequence repeat (SSR), amplified fragment length polymorphism (AFLP) and the like; the third generation molecular marker is a molecular detection technology based on single nucleotide polymorphism (SNP). Compared with the first and second generation molecular markers, the third generation molecular marker SNP has the characteristics of high distribution density and good genetic stability, and is more suitable for high-throughput and automated detection. Therefore, SNP is the most suitable for large-scale and low-cost application in the current molecular marker technology.

[0004] Based on SNP-based molecular detection technology, a high-efficiency and low-cost SNP genotype detection technology, KASP technology, has been developed. KASP technology is a high-throughput SNP detection technology based on the principle of competitive allele-specific PCR (Kompetitive allele-specific PCR). KASP technology is widely used in the field of crop trait inheritance and improvement research due to its high throughput, low cost and strong operability. The technology is based on the specific matching of primer end nucleotides to detect SNP sites. Two specific binding primers have different allele recognition sites at the 3' end. In the first round of PCR amplification, allele-specific primers (3' end can be paired) can identify specific allele templates to complete allele recognition. From the second round of PCR amplification, templates carrying universal tag sequences appear in the product, which will introduce universal tag sequences into PCR products corresponding to SNPs. In the subsequent PCR amplification process, fluorescent probes are added to the PCR product by binding to the complementary DNA strand of the universal sequence. After multiple rounds of PCR amplification, more fluorescent probes are annealed to the newly synthesized PCR product, gradually enhancing the fluorescence intensity of the PCR product. Finally, the allele type is determined by detecting the fluorescence signal. Compared with other SNP markers, KASP technology is more flexible, has a wider range of applications, is lower in cost, and is more accurate and reliable. KASP molecular markers provide strong technical support for crop germplasm resource identification and molecular marker-assisted breeding. Therefore, mining SNP sites related to wheat cold resistance and developing KASP molecular markers for identifying SNP site genotypes not only provides an effective detection method for breeding cold-resistant wheat varieties and screening cold-resistant wheat germplasm resources, but also has important significance for improving wheat breeding efficiency. SUMMARY

[0005] The technical problem to be solved by the present application is how to detect the cold resistance of wheat.

[0006] To solve the above technical problems, the present application first provides the application of a wheat cold resistance molecular marker detection substance in detecting or assisting in detecting the cold resistance of wheat.

[0007] The wheat cold resistance molecular marker is the nucleotide corresponding to position 538 of SEQ ID No. 1 in the sequence table, which is A or C.

[0008] In the above application, the wheat cold resistance molecular marker detection substance can include (or can be) primers named KASP_CBF-F1, KASP_CBF-F2 and KASP_CBF-R.

[0009] The KASP_CBF-F1 is a single-stranded DNA containing positions 22-39 of SEQ ID No. 2.

[0010] The KASP_CBF-F2 is a single-stranded DNA containing 22-39 of SEQ ID No. 3;

[0011] The KASP_CBF-R is a single-stranded DNA as shown in SEQ ID No. 4.

[0012] In the above application, the KASP_CBF-F1 can be a single-stranded DNA as shown in SEQ ID No. 2;

[0013] The KASP_CBF-F2 can be a single-stranded DNA as shown in SEQ ID No. 3.

[0014] In the above application, the cold resistance of the wheat with C homozygote of the nucleotide corresponding to the 538th nucleotide of SEQ ID No. 1 in the sequence listing in the genome is greater than or candidate greater than the cold resistance of the wheat with A homozygote of the nucleotide corresponding to the 538th nucleotide of SEQ ID No. 1 in the sequence listing in the genome.

[0015] The application also provides a method for detecting or assisting in detecting the cold resistance of wheat, which comprises detecting the wheat cold resistance molecular marker, and determining the cold resistance of wheat according to the following method:

[0016] The cold resistance of the wheat with C homozygote of the nucleotide corresponding to the 538th nucleotide of SEQ ID No. 1 in the sequence listing in the genome is greater than or candidate greater than the cold resistance of the wheat with A homozygote of the nucleotide corresponding to the 538th nucleotide of SEQ ID No. 1 in the sequence listing in the genome.

[0017] In the above method, the detection of the wheat cold resistance molecular marker can be carried out by using the substance for detecting the wheat cold resistance molecular marker.

[0018] The substance for detecting the wheat cold resistance molecular marker also belongs to the protection scope of the application.

[0019] The wheat cold resistance molecular marker also belongs to the protection scope of the application.

[0020] The application also provides any one of the following applications:

[0021] X1) the application of the wheat cold resistance molecular marker in wheat breeding;

[0022] X2) the application of the wheat cold resistance molecular marker in detecting or assisting in detecting the cold resistance of wheat;

[0023] X3) the application of the substance for detecting the wheat cold resistance molecular marker in wheat breeding;

[0024] X4) use of the substance for detecting the cold resistance molecular marker of wheat in the preparation of a wheat breeding product;

[0025] X5) use of the substance for detecting the cold resistance molecular marker of wheat in the preparation of a product for detecting or assisting in detecting the cold resistance of wheat;

[0026] X6) use of the method for detecting or assisting in detecting the cold resistance of wheat in wheat breeding;

[0027] X7) use of a substance for detecting the nucleotide corresponding to the 538th nucleotide of SEQ ID No. 1 in the sequence listing in the genome of wheat in the breeding of cold-resistant wheat;

[0028] X8) use of a substance for detecting the nucleotide corresponding to the 538th nucleotide of SEQ ID No. 1 in the sequence listing in the genome of wheat in the preparation of a product for breeding cold-resistant wheat.

[0029] The present application also provides a wheat breeding method, which comprises: detecting the nucleotide corresponding to the 538th nucleotide of SEQ ID No. 1 in the sequence listing in the genome of wheat, and selecting a wheat homozygous for the nucleotide corresponding to the 538th nucleotide of SEQ ID No. 1 in the sequence listing in the genome of wheat as a parent for breeding.

[0030] In the present application, the wheat can be any one of the following wheat materials or its offspring:

[0031] Jinong CH04, Shannong 534421, Jinong 17287, Heimei 316, Shannong K31565, Shannong K43057, 1912, Linmai 12, 19CA29, Nongda 8136, Hengmai H175087, Jimai 87, Puxing 21, Zhongyuan Guoke 9, Lin 801, Guanmai 13, Xinshiji 2, Keda 116, Nongxin 216, Hengmai T1932092, JK930981, Jimai 22031, TKM0407, Beida 815, Shi 198056, Jimai 220008, QM852, Nongda 355, Nongda 177, LS04412, Lunxuan 50, Yannong 90, Taikemai 4373, Nongda 185, Jimai 5858, Guanmai 99, Zhongke 19021, Kexing 3302, Jinghua 301, Cunmai 116, Puxing 25, Shangmai 187, Zhengmai 917, Xinke 176, Luomai 109, Xinong 926, Liangke 6, Xinmai 72, Xinong 809, Zhuomai 599, Xuke 13, Huaimai 186, Luomai 69, Fengong 41, Wunong 159, Zhoumai 52, Luojin 49, Luomai 56, Puxing 26, Xinong 2562, Pingan 16, Xinmai 9866, Xinong 1668, Xinong 579, Luomai 117, Annong 1928, Pumai 126, Tianning 138, Xinke 186, Xinong 5811, Zhuomai 548, Zhongmai 255, Anke 1907, Pingan 18, Zhengmai 366, Xinong 612, Ruihua Mai 513, Xumai 17106, Zhengmai 1926, Zhongyuan 26, Xumai 18197, Xinong 819, Zhengda 201, Lunxuan 136, Xinmai 66, Zhongzhi Mai 16, Nongke 1132, Luofeng 7011, 19CA97, Pubing 30538, Yunnong 923, Xinong 1156, Luojin 978, Luofeng 1901.

[0032] In one embodiment of the present application, the cold resistance is the cold resistance of wheat seedling stage (i.e. the cold resistance during wintering period).

[0033] The present application finds that a SNP site is a wheat cold resistance molecular marker, which is located in the coding region of a wheat cold resistance related gene TaCBF , and is physically anchored at 522,083,278bp of wheat chromosome 5A (http: / / wheatomics.sdau.edu.cn / ). The upstream and downstream sequences of the wheat cold resistance molecular marker in the wheat genome are shown in SEQ ID No. 1, and M at position 538 represents A or C. The wheat cold resistance molecular marker of the present application, the wheat with genotype CC has stronger cold resistance than the wheat with genotype AA, which is significantly associated with the wheat cold resistance, and can be selected as the parent with CC genotype in the breeding process for the cold resistance breeding of wheat.

[0034] The present application is further described in detail by the specific embodiments below, the examples given are only for illustrating the present application, and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the present application. BRIEF DESCRIPTION OF DRAWINGS

[0035] Figure 1 Genotyping results of wheat materials. A / A represents AA genotype, and C / C represents CC genotype. DETAILED DESCRIPTION

[0036] The experimental methods in the following examples are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, instruments, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0037] Example 1: SNP site related to wheat cold resistance and KASP primer design

[0038] 1. SNP site related to wheat cold resistance

[0039] The present application screens a SNP site related to wheat cold resistance, which is located in the coding region of the wheat cold resistance related gene TaCBF , and is physically anchored at 522,083,278 bp of wheat chromosome 5A (http: / / wheatomics.sdau.edu.cn / ). The SNP site is recorded as a wheat cold resistance molecular marker. The upstream and downstream sequences of the wheat cold resistance molecular marker in the wheat genome are shown in SEQ ID No. 1, and M at position 538 represents A or C.

[0040] SEQ ID No. 1:

[0041] ATGGACGTCGCCGACATCGCCTCCCCGTCCGGCCAGCAGGAGCAGGGCCACCGGACGGTGTCGTCGGAGCCGCCGAAGCGGCCCGCGGGGCGGACCAAGTTCCACGAGACGCGCCACCCGCTGTACCGCGGCGTGCGGCGCCGTGGCCGCGTCGGGCAGTGGGTGTGCGAGGTGCGCGTGCCCGGGATCAAGGGCTCCAGGCTCTGGCTCGGCACCTTCAACACGGCCGAGATGGCGGCGCGCGCGCACGACGCCGCCGTGCTCGCGCTCTCCGGCCGCGCCGCCTGCCTCAACTTCGCCGACTCCGCATGGCGCATGCTGCCCGTGCTCGCGGCCGGCTCCTTCGGCTTCGGCAGCGCGAGCGAGATCAAGGCCGCCGTCGCTGTCGCCGTCGTCGCGTTCCTGCGGAAGCAGATTGTTCTTCCAGTCGCCGTCGCCGTCGTGGCGCTCCAGCAGCAGCAGATCATTCTTCCAGTCGCGTGCCTGGCGCCCGAGTTTTACATGTCTTCCGGCGACCTGTTGGAGCTGGACGAGGAGCAGTGGTTTGGCGGCATGGAGGCCGGGTCGTACTACGCGAGCTTGGCGCAGGGGATGCTCGTGGCGCCGCCGGACGAAAGAGCCAGGCCGGAGAGCGGCGAGCAGAGCGGCGTCCAGACGCCGCTATGGAGCTGCTTGTTCGACTAA. CTCCAGCAGAAGCAGGTTCC GGTCGCCGTCGCCGTGGTGGCGCTCCAG MAGCTGCCAGTTCCGGTC GCCGTCGCCGTCGTGGCGCTCCAGCAGCAGCAGATCATTCTTCCAGTCGCGTGCCTGGCGCCCGAGTTTTACATGTCTTCCGGCGACCTGTTGGAGCTGGACGAGGAGCAGTGGTTTGGCGGCATGGAGGCCGGGTCGTACTACGCGAGCTTGGCGCAGGGGATGCTCGTGGCGCCGCCGGACGAAAGAGCCAGGCCGGAGAGCGGCGAGCAGAGCGGCGTCCAGACGCCGCTATGGAGCTGCTTGTTCGACTAA.

[0042] The AA genotype below indicates a homozygous type in which the position corresponding to position 538 of SEQ ID No. 1 is A in the wheat genome; the CC genotype indicates a homozygous type in which the position corresponding to position 538 of SEQ ID No. 1 is C in the wheat genome; and the AC genotype indicates a heterozygous type in which the position corresponding to position 538 of SEQ ID No. 1 is A and C in the wheat genome.

[0043] 2. KASP primer design for detecting a cold resistance molecular marker of wheat

[0044] The SNP site genotype detection system based on KASP technology comprises three primers, two allele-specific forward primers and one universal reverse primer. The last nucleotide at the 3' end of the two forward primers respectively identifies different nucleotide types of the SNP site.

[0045] The flanking sequences of 150 bp upstream and downstream of the SNP site are obtained, and three KASP primers are designed by using the polymarker (http: / / www.polymarker.info / ) website. The primers are synthesized by Beijing Qikexin Biotechnology Co., Ltd. The specific primer sequences are as follows:

[0046] KASP_CBF-F1: 5'-gaccggaactggcagctG-3' (SEQ ID No. 2); GAAGGTGACCAAGTTCATGCT

[0047] KASP_CBF-F2: 5'-gaccggaactggcagctT-3' (SEQ ID No. 3); GAAGGTCGGAGTCAACGGATT

[0048] KASP_CBF-R: 5'-ctccagcagaagcaggttcc-3' (SEQ ID No. 4).

[0049] Among them, the underlined part is the universal tag sequence, the bold part is the genotyping site sequence, and the rest is used to identify the wheat genome sequence.

[0050] The KASP technology adds different fluorescent groups at the 5' end of the forward primer, and judges the genotype of the target site based on the reading of the PCR terminal fluorescence signal. The 5' end of the primer KASP_CBF-F1 carries the fluorescent tag sequence of FAM (the underlined part in the primer sequence), and KASP_CBF-F1 and KASP_CBF-R can amplify the DNA fragment of the SNP site C, thereby generating a FAM fluorescence signal. The 5' end of the primer KASP_CBF-F2 carries the fluorescent tag sequence of HEX (the underlined part in the primer sequence), and KASP_CBF-F2 and KASP_CBF-R can amplify the DNA fragment of the SNP site A, thereby generating a HEX fluorescence signal.

[0051] 3. A method for detecting the genotype of the SNP site in wheat KASP_CBF by using KASP primers

[0052] 1) DNA extraction

[0053] ​​The CTAB method was used to extract the genomic DNA of wheat leaves, and the quality and concentration of the DNA were detected by NanoDrop-1000 ultraviolet spectrophotometer. The A260 / 230 of high-quality genomic DNA should be between 1.8-2.2, and the A260 / 280 ratio should be between 1.8-2.0. The DNA concentration was diluted to 50 ng / µL as a template for KASP detection, and stored at -20℃ for standby.

[0054] 2), PCR reaction

[0055] PCR reaction was carried out with wheat genomic DNA as template, and two blank controls (NTC) without DNA template were set.

[0056] Primer dilution: dilute 3 KASP primers to 10 µM with ddH2O respectively, and store at -20℃ for standby.

[0057] The total volume of PCR reaction system was 10 µL: DNA template 1 µL, 2×PARMS Mix (Jingte Biological, item number GA01001-10) 5 µL, KASP_CBF-F1 0.05 µL, KASP_CBF-F2 0.05 µL, KASP_CBF-R 0.15 µL, ddH2O 3.75 µL.

[0058] PCR reaction program:

[0059] First step: pre-denaturation: 94℃ 15min;

[0060] Second step: touchdown PCR: 94℃ 20s, 65→57℃ (-0.8℃ / cycle) 60s, 10 cycles;

[0061] Third step: amplification: 94℃ 20s, 57℃ 1min, 30 cycles.

[0062] 3), fluorescence signal reading

[0063] After the PCR reaction, the plate was read on the fluorescence quantitative PCR instrument (BIO-RAD CFX Master) to obtain the fluorescence information, and the reading plate program was 30℃, 1min. The fluorescence data was displayed in graphical results, the detection results of wheat with CC genotype showed FAM fluorescence, and the fluorescence signal was distributed near the X axis. The detection results of wheat with AA genotype showed HEX fluorescence, and the fluorescence signal was located near the Y axis. The fluorescence signal was distributed in the middle position of the coordinate axis, which indicated that the wheat to be tested was AC genotype. The fluorescence signal distributed near the origin of the coordinate axis was the blank control without DNA template.

[0064] Example 2, Application of Wheat Cold Resistance Molecular Marker in Identifying Wheat Cold Resistance in Assisted Breeding

[0065] 1, the material to be tested

[0066] The names of the wheat materials to be tested are shown in Table 1.

[0067] 2, field investigation of cold resistance of 94 wheat materials

[0068] The 94 wheat materials were wheat varieties or germplasms planted in Gaoyi Original Seed Field of Gaoyi County, Shijiazhuang City, Hebei Province in mid-October 2022, and the field cold resistance investigation was carried out after the wheat returned green in late February 2023 according to the frost damage of the aboveground parts. The cold resistance grade classification standard is as follows:

[0069] 1: no frost damage symptoms;

[0070] 2: leaf tip yellowing;

[0071] 3: half of the leaf died;

[0072] 4: leaf withering;

[0073] 5: plant or most of the tillers died.

[0074] Among them, 1-2 grade has good cold resistance, 3 grade has medium resistance, and 4-5 grade has poor cold resistance.

[0075] According to the field cold resistance investigation, the cold resistance results of the 94 materials are shown in Table 1.

[0076] Table 1, 94 wheat genotypes and cold resistance investigation table

[0077]

[0078]

[0079] Note: " / " indicates no test signal; negative control indicates that the template is ddH2O. "+" indicates heavy frost damage, "-" indicates light frost damage, for example, "2+" indicates that the frost damage is more serious than "2" grade, and is closer to 2 grade between 2 grade and 3 grade; "4-" indicates that the frost damage is lighter than "4" grade, and is closer to 4 grade between 3 grade and 4 grade; "4+" indicates that the frost damage is more serious than "4" grade, and is closer to 4 grade between 4 grade and 5 grade; "5-" indicates that the frost damage is lighter than "5" grade, and is closer to 5 grade between 4 grade and 5 grade.

[0080] 2, KASP primer detection of SNP site genotype in KASP_CBF

[0081] According to the method of step 3 of Example 1, the genomic DNA of the 94 wheat germplasms to be tested was extracted, and the genotype of the SNP site in KASP_CBF of the wheat to be tested was detected by KASP primer.

[0082] The KASP detection results are as shown in Table 1 and Table 2. Figure 1 As shown in Table 1 and Table 2, among the 94 wheat materials, 56 wheat materials are of AA genotype, and basically exhibit non-cold resistance phenotype; 37 wheat materials are of CC genotype, and basically exhibit cold resistance phenotype. The cold resistance phenotype in Table 1 is assigned, “2+” is assigned as 2.25, “4-” is assigned as 3.75, “4+” is assigned as 4.25, and “5-” is assigned as 4.75. The average value of cold resistance of different genotypes is calculated, and the cold resistance value of AA genotype is 4.134, and the cold resistance value of CC genotype is 2.397. The cold resistance value of CC genotype wheat is significantly lower than that of AA genotype, that is, the cold resistance of CC genotype wheat is significantly higher than that of AA genotype.

[0083] The above results show that for the wheat cold resistance molecular marker of the present application, the cold resistance of wheat with CC genotype is stronger than that of wheat with AA genotype, which is significantly related to the cold resistance of wheat, and the CC genotype can be selected as a parent in the breeding process for cold resistance breeding of wheat.

[0084] The present application has been described in detail above. For those skilled in the art, the present application can be implemented in a wider range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present application, and without unnecessary experiments. Although the present application gives a special embodiment, it should be understood that the present application can be further improved. In summary, according to the principle of the present application, the present application intends to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which deviates from the scope disclosed in the present application. Some basic features can be applied according to the scope of the following attached claims.

Claims

1. Use of a primer for detecting a wheat cold resistance molecular marker in detecting or assisting in detecting wheat cold resistance; The wheat cold resistance molecular marker is a nucleotide corresponding to position 538 of SEQ ID No. 1 in the sequence listing in the wheat genome, which is A or C.

2. Use according to claim 1, characterized in that: The primer for detecting the wheat cold resistance molecular marker is a primer with the name KASP_CBF-F1, KASP_CBF-F2 and KASP_CBF-R; The KASP_CBF-F1 is a single-stranded DNA as shown in SEQ ID No. 2; The KASP_CBF-F2 is a single-stranded DNA as shown in SEQ ID No. 3; The KASP_CBF-R is a single-stranded DNA as shown in SEQ ID No.

4.

3. The use according to claim 1 or 2, wherein: The cold resistance of the wheat whose nucleotide corresponding to position 538 of SEQ ID No. 1 in the sequence listing in the genome is C is greater than or is expected to be greater than the cold resistance of the wheat whose nucleotide corresponding to position 538 of SEQ ID No. 1 in the sequence listing in the genome is A.

4. A method for detecting or assisting in the detection of cold tolerance in wheat, characterized in that: The method comprises detecting the wheat cold resistance molecular marker as described in claim 1, and determining the cold resistance of the wheat according to the following method: The cold resistance of the wheat whose nucleotide corresponding to position 538 of SEQ ID No. 1 in the sequence listing in the genome is C is greater than or is expected to be greater than the cold resistance of the wheat whose nucleotide corresponding to position 538 of SEQ ID No. 1 in the sequence listing in the genome is A.

5. The method of claim 4, wherein: The detection of the wheat cold resistance molecular marker as described in claim 1 is performed using the primer for detecting the wheat cold resistance molecular marker as described in claim 1 or 2.

6. Any one of the following uses: X1) Use of the primer for detecting the wheat cold resistance molecular marker as described in claim 1 or 2 in wheat cold resistance breeding; X2) Use of the primer for detecting the wheat cold resistance molecular marker as described in claim 1 or 2 in the preparation of a wheat cold resistance breeding product; X3) Use of the primer for detecting the wheat cold resistance molecular marker as described in claim 1 or 2 in the preparation of a product for detecting or assisting in detecting the cold resistance of wheat; X4) Use of the method as described in claim 4 or 5 in wheat cold resistance breeding; X5) Use of a primer for detecting a nucleotide corresponding to position 538 of SEQ ID No. 1 in the sequence listing in the wheat genome in breeding cold-resistant wheat; X6) Use of a primer for detecting a nucleotide corresponding to position 538 of SEQ ID No. 1 in the sequence listing in the wheat genome in the preparation of a product for breeding cold-resistant wheat.

7. A method of breeding wheat comprising: A nucleotide corresponding to position 538 of SEQ ID No. 1 in the sequence listing in the wheat genome is detected, and a wheat whose nucleotide corresponding to position 538 of SEQ ID No. 1 in the sequence listing in the wheat genome is C is selected as a parent for breeding.