Application of ubiquitin specific protease 4 as diagnostic marker or therapeutic target of high-grade serous cancer

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of ubiquitin specific protease 4 as a diagnostic marker or a therapeutic target of high-grade serous cancer. According to the invention, the high expression of ubiquitin specific protease 4 (USP4) in high-grade serous cancer (HGSOC) tissue is found for the first time, and is obviously higher than that of normal fallopian tube tissue (plt; the application has the advantages that the expression level difference of the USP4 is related to the total survival time (OS) of a patient, survival analysis shows that the USP4 expression level difference is related to the total survival time (OS) of the patient, and the USP4 can be used as a diagnosis and prognosis evaluation marker of the high-grade serous cancer; moreover, CCK-8 and plate cloning experiments prove that the knock-down USP4 inhibits the proliferation of HGSOC cells and treats the high-grade serous cancer. USP4 may play a role in promoting cancer in the progress process of HGSOC.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of ubiquitin-specific protease 4 as a diagnostic marker or therapeutic target for high-grade serous carcinoma. Background Technology

[0002] Ovarian cancer (OC) is a common and highly malignant tumor of the female reproductive system, ranking second in incidence and first in mortality among malignant tumors of the female reproductive system. In the histological classification of ovarian epithelial carcinoma, high-grade serous ovarian carcinoma (HGSOC) is the most prevalent pathological subtype. 75% of patients are already at an advanced stage (FIGO III-IV) at initial diagnosis, and 70% of patients relapse within 6-18 months after receiving standard treatment regimens of tumor debulking surgery and platinum-based chemotherapy, with a 5-year survival rate of only 30-40%. Therefore, in-depth analysis of the pathogenesis of HGSOC and the exploration of new therapeutic targets and diagnostic and prognostic biomarkers are of significant scientific and clinical value for achieving personalized precision treatment and promoting clinical translational applications.

[0003] Ubiquitin-specific protease 4 (USP4) consists of a DUSP (USP domain), two UBL (ubiquitin-like domains), and a bipartite catalytic domain (also called the USP domain). The DUSP-UBL domain primarily plays a role in specifically recognizing substrate proteins. Studies have shown that USP4 stabilizes substrate protein expression through its own deubiquitination function, promoting the progression of various solid tumors. For example, in colorectal cancer, USP4 inhibits the polyubiquitination and degradation of β-catenin and PRL-3, stabilizing their expression and promoting colorectal cancer migration and invasion. In hepatocellular carcinoma (HCC), USP4 inhibits the polyubiquitination and degradation of TGF-βRI, stabilizing TGF-βRI protein expression, and continuously activating the TβRI / pSMAD2 signaling pathway, enhancing the migration, invasion, and epithelial-mesenchymal transition (EMT) capabilities of HCC cells. However, its role in HGSOC has not been sufficiently explored and discovered. Summary of the Invention

[0004] The purpose of this invention is to provide a new biomarker for diagnosing high-grade serous carcinoma and a therapeutic target for high-grade serous carcinoma, providing new ideas and strategies for the diagnosis, assessment and clinical treatment of high-grade serous carcinoma.

[0005] This invention provides the use of ubiquitin-specific protease 4 as a marker in the preparation of products for the diagnosis and / or prognostic assessment of high-grade serous carcinoma.

[0006] This invention provides reagents or methods for detecting ubiquitin-specific protease 4 expression levels in the preparation of products for the diagnosis and / or prognostic assessment of high-grade serous carcinoma.

[0007] Preferably, the reagent for detecting the expression level of ubiquitin-specific protease 4 includes an antibody that specifically binds to ubiquitin-specific protease 4;

[0008] The method for detecting ubiquitin-specific protease 4 expression levels includes one or more of immunohistochemical staining, Western blotting, and enzyme-linked immunosorbent assay (ELISA); the prognostic assessment indicator includes overall survival. Preferably, the product is a reagent or kit.

[0009] This invention provides the application of ubiquitin-specific protease 4 as a therapeutic target in the preparation of drugs for treating high-grade serous carcinoma.

[0010] This invention provides the application of a reagent that downregulates the expression level of ubiquitin-specific protease 4 in the preparation of a drug for treating high-grade serous carcinoma.

[0011] Preferably, the reagent that downregulates the expression level of ubiquitin-specific protease 4 includes shRNA;

[0012] The shRNA includes one or more of shRNA1, shRNA2, shRNA3 and shRNA4;

[0013] The shRNA1 targets the nucleotide sequence shown in SEQ ID NO:1.

[0014] The shRNA2 targets the nucleotide sequence shown in SEQ ID NO:4.

[0015] The shRNA3 targets the nucleotide sequence shown in SEQ ID NO:7;

[0016] The shRNA4 targets the nucleotide sequence shown in SEQ ID NO:10.

[0017] Preferably, the nucleotide sequence of the sense strand of shRNA1 is shown in SEQ ID NO:2, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:3;

[0018] The nucleotide sequence of the sense strand of shRNA2 is shown in SEQ ID NO:5, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:6.

[0019] The nucleotide sequence of the sense strand of shRNA3 is shown in SEQ ID NO:8, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:9;

[0020] The nucleotide sequence of the sense strand of shRNA4 is shown in SEQ ID NO:11, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:12.

[0021] This invention provides an shRNA for treating high-grade serous carcinoma, wherein the shRNA includes one or more of shRNA1, shRNA2, shRNA3 and shRNA4;

[0022] The nucleotide sequence of the sense strand of shRNA1 is shown in SEQ ID NO:2, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:3.

[0023] The nucleotide sequence of the sense strand of shRNA2 is shown in SEQ ID NO:5, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:6.

[0024] The nucleotide sequence of the sense strand of shRNA3 is shown in SEQ ID NO:8, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:9;

[0025] The nucleotide sequence of the sense strand of shRNA4 is shown in SEQ ID NO:11, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:12.

[0026] This invention provides a recombinant vector for treating high-grade serous carcinoma, the recombinant vector comprising a base vector and shRNA inserted into the base vector; the shRNA is the shRNA described in the above technical solution.

[0027] Beneficial effects:

[0028] This invention provides the application of ubiquitin-specific protease 4 (USP4) as a biomarker in the preparation of products for the diagnosis and / or prognostic assessment of high-grade serous carcinoma (HGSOC). This invention is the first to discover that ubiquitin-specific protease 4 (USP4) is highly expressed in HGSOC tissues, significantly higher than in normal fallopian tube tissues (p<0.0001). Survival analysis showed that differences in USP4 expression levels were associated with overall survival (OS), with HGSOC patients exhibiting high USP4 expression having a worse prognosis (p<0.0001). High USP4 expression was positively correlated with higher FIGO stage, chemotherapy resistance, and recurrence in HGSOC patients (p<0.05). High USP4 expression and chemotherapy resistance were independent risk factors affecting the prognosis of HGSOC patients (p<0.01).

[0029] This invention also provides the application of ubiquitin-specific protease 4 (USP4) as a therapeutic target in the preparation of drugs for treating high-grade serous carcinoma. This invention demonstrated through CCK-8 and plate cloning experiments that knocking down USP4 inhibits the proliferation of HGSOC cells and treats high-grade serous carcinoma. Therefore, USP4 may play a pro-cancer role in the progression of HGSOC. Attached Figure Description

[0030] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0031] Figure 1 The results of Western blot analysis of USP4 protein expression in different cells;

[0032] Figure 2 Immunohistochemical staining images of the expression pattern of USP4 protein in HGSOC tissues, pie chart: 40×, square chart: 400×;

[0033] Figure 3 Immunohistochemical staining scores of USP4 in normal fallopian tube tissue and HGSOC tissue;

[0034] Figure 4 ROC curve for USP4 expression used in the diagnosis of HGSOC;

[0035] Figure 5 A map of the eukaryotic expression vector pGPH1 / GFP / Neo;

[0036] Figure 6 USP4 protein expression after USP4 knockdown in HEY-A8 cells;

[0037] Figure 7 To verify the effect of USP4 knockdown on HGSOC cell proliferation in the CCK8 assay;

[0038] Figure 8 To verify the effect of USP4 knockdown on HGSOC cell proliferation in plate cloning experiments; where A is the plate cloning result diagram and B is the result analysis diagram of A. Detailed Implementation

[0039] This invention provides the application of ubiquitin-specific protease 4 as a biomarker in the preparation of products for the diagnosis and / or prognostic assessment of high-grade serous carcinoma.

[0040] This invention provides reagents or methods for detecting ubiquitin-specific protease 4 expression levels in the preparation of products for the diagnosis and / or prognostic assessment of high-grade serous carcinoma.

[0041] As one embodiment, the reagent for detecting the expression level of ubiquitin-specific protease 4 according to the present invention includes an antibody that specifically binds to ubiquitin-specific protease 4. As one embodiment, the antibody that specifically binds to ubiquitin-specific protease 4 according to the present invention includes a USP4 antibody (catalog number: sc-376000).

[0042] As one embodiment, the method for detecting ubiquitin-specific protein 4 expression levels according to the present invention includes one or more of immunohistochemical staining, Western blotting, and enzyme-linked immunosorbent assay (ELISA). As one embodiment, the prognostic assessment indicator according to the present invention includes overall survival. As one embodiment, the product according to the present invention is a reagent or kit.

[0043] This invention provides the application of ubiquitin-specific protease 4 as a therapeutic target in the preparation of drugs for treating high-grade serous carcinoma.

[0044] This invention provides the application of a reagent that downregulates the expression level of ubiquitin-specific protease 4 in the preparation of a drug for treating high-grade serous carcinoma.

[0045] In one embodiment, the drug of the present invention treats high-grade serous carcinoma by inhibiting the proliferation of high-grade serous cancer cells.

[0046] In one embodiment, the reagent for downregulating the expression level of ubiquitin-specific protease 4 according to the present invention includes shRNA; the shRNA includes one or more of shRNA1, shRNA2, shRNA3, and shRNA4; shRNA1 targets the nucleotide sequence shown in SEQ ID NO:1; shRNA2 targets the nucleotide sequence shown in SEQ ID NO:4; shRNA3 targets the nucleotide sequence shown in SEQ ID NO:7; and shRNA4 targets the nucleotide sequence shown in SEQ ID NO:10. In one embodiment, the nucleotide sequence of the sense strand of shRNA1 is shown in SEQ ID NO:2, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:3. In one embodiment, the nucleotide sequence of the sense strand of shRNA2 is shown in SEQ ID NO:5, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:6. In one embodiment, the nucleotide sequence of the sense strand of shRNA3 is shown in SEQ ID NO:8, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:9. As one embodiment, the nucleotide sequence of the sense strand of shRNA4 described in this invention is shown in SEQ ID NO:11, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:12.

[0047] This invention provides an shRNA for treating high-grade serous carcinoma, wherein the shRNA includes one or more of shRNA1, shRNA2, shRNA3, and shRNA4; the nucleotide sequence of the sense strand of shRNA1 is shown in SEQ ID NO:2, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:3; the nucleotide sequence of the sense strand of shRNA2 is shown in SEQ ID NO:5, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:6; the nucleotide sequence of the sense strand of shRNA3 is shown in SEQ ID NO:8, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:9; the nucleotide sequence of the sense strand of shRNA4 is shown in SEQ ID NO:11, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:12.

[0048] This invention provides a recombinant vector for treating high-grade serous carcinoma, the recombinant vector comprising a base vector and shRNA inserted into the base vector; the shRNA is the shRNA described in the above technical solution.

[0049] In one implementation, the basic vector of this invention includes the eukaryotic expression vector pGPH1 / GFP / Neo. This invention does not have strict requirements regarding the insertion site of the shRNA into the eukaryotic expression vector pGPH1 / GFP / Neo, as long as shRNA expression is achieved.

[0050] To further illustrate the present invention, the application of ubiquitin-specific protease 4 provided by the present invention as a diagnostic marker or therapeutic target for high-grade serous carcinoma is described in detail below with reference to the accompanying drawings and embodiments, but these descriptions should not be construed as limiting the scope of protection of the present invention.

[0051] Example 1

[0052] The expression of USP4 protein (NCBI accession number: GeneID:7375) was detected by Western blotting in human embryonic kidney cell line HEK293T, human normal ovarian epithelial cell line IOSE80, and high-grade serous carcinoma (HGSOC) cell lines SKOV3, OVCAR3, OVCAR8, and HEYA8. The results showed that USP4 was highly expressed in HGSOC cell lines. Figure 1 ).

[0053] Example 2

[0054] 1. Samples: 106 HGSOC tissue samples and 52 normal fallopian tube tissue samples.

[0055] 2. Immunohistochemical staining (IHC) of USP4 protein

[0056] (1) Carefully place the slides in the slide rack, incubate at 65°C for 30 minutes, and then dewax them by sequentially passing them through xylene II, xylene I, 100% ethanol, 95% ethanol, 85% ethanol and 75% ethanol for 5 minutes.

[0057] (2) Prepare EDTA antigen retrieval solution, transfer the tissue section to the preheated EDTA antigen retrieval solution (ensure that the liquid surface completely submerges the tissue section), 100℃, 10min, after cooling, transfer the tissue section to 1×PBST solution, 80rpm, 5min, room temperature, wash three times.

[0058] (3) Remove the slide, gently remove the moisture from the edge of the slide, use an immunohistochemistry pen to draw the outline around the tissue, carefully drop 3% hydrogen peroxide solution into the circle, place it at room temperature and protect it from light for 10 minutes.

[0059] (4) Transfer the tissue sections to 1×PBST solution, wash three times at 80 rpm for 5 min at room temperature, gently remove water from the edges of the sections, add 150 μL of goat serum, and block at room temperature for 30–60 min.

[0060] (5) Discard the blocking solution, add the pre-diluted primary antibody solution (USP4 antibody), and incubate at 4°C overnight (12-16h);

[0061] (6) The next day, take out the tissue section box, warm it in an incubator at 37°C for 1 hour, then transfer the tissue sections to 1×PBST solution, wash three times at 80 rpm for 5 min at room temperature.

[0062] (7) Carefully wipe away the moisture around the tissue, carefully add the secondary antibody (enzyme-labeled goat anti-mouse / rabbit IgG polymer, catalog number GK600711-B), incubate at 37°C for 30 min, then transfer the tissue section to 1×PBST solution, incubate at 80 rpm for 5 min at room temperature, and wash three times.

[0063] (8) Gently wipe away the moisture from the edge of the slice, then evenly drop the prepared DAB colorimetric solution, observe the colorimetric changes under a microscope, and be ready to terminate the colorimetric reaction at any time.

[0064] (9) Immerse the tissue sections in a hematoxylin staining vat and stain for 2 minutes at room temperature. Rinse the sections three times with tap water, dehydrate them, and let them air dry naturally. Then mount them with neutral resin.

[0065] 3. Immunohistochemical staining was performed to assess staining intensity. Results revealed a differential expression pattern of USP4 protein in HGSOC tissues, specifically as follows: Figure 2 As shown. Among them, Figure 2 A is negative, with no positive staining, and the staining intensity score is recorded as 0. Figure 2 B is weakly positive, pale yellow, and the staining intensity score is recorded as 1 point; Figure 2 C is moderately positive, brownish-yellow, and the staining intensity score is recorded as 2 points; Figure 2 D is strongly positive, brownish-red, and the staining intensity score is recorded as 3 points.

[0066] 4. The proportion of positive cells was assessed based on the immunohistochemical staining results, and the immunohistochemical staining score was calculated according to the following formula: Immunohistochemical staining score = staining intensity (0-3) × proportion of positive cells (0-4); where, a positive cell proportion of 0-25% is scored as 1 point; a positive cell proportion of 26-50% is scored as 2 points; a positive cell proportion of 51-75% is scored as 3 points; and a positive cell proportion of 76-100% is scored as 4 points. The final immunohistochemical staining score ranged from 0 to 12 points, indicating that USP4 expression in HGSOC tissue was significantly higher than that in normal fallopian tube tissue (p<0.0001). Figure 3 ).

[0067] 5. ROC curves were plotted based on the scoring results. The results showed that the area under the curve (AUC) was 0.8458, p < 0.0001, indicating that it could specifically detect HGSOC and had high sensitivity for the detection and diagnosis of HGSOC. Figure 4 ).

[0068] 6. The Youden index was calculated using the area under the curve. The maximum score corresponding to the Youden index was selected as the Cutoff value. HGSOC patients were divided into a high USP4 expression group (>4) and a low USP4 expression group (<4). Clinicopathological factor analysis was performed, and the results are shown in Table 1.

[0069] Table 1. Correlation between USP4 expression and clinicopathological factors in HGSOC patients

[0070]

[0071] As shown in Table 1, USP4 expression was correlated with FIGO stage (p<0.001), and the expression rate in advanced (stage III+IV) HGSOC patients was significantly higher than that in early (stage I+II) HGSOC patients (p<0.005). In addition, regarding treatment response, the expression rate in chemotherapy-resistant and relapsed HGSOC patients was significantly higher than that in chemotherapy-sensitive and non-relapsed HGSOC patients (p<0.05, p<0.05).

[0072] 7. Kaplan-Meier survival analysis was performed based on patient prognosis and immunohistochemical scores. The results indicated a correlation between differences in USP4 expression levels and overall survival (OS).

[0073] Example 3

[0074] 1. Shanghai Gemma Pharmaceutical Technology Co., Ltd. was commissioned to construct and synthesize the following plasmids for knocking down USP4 and control plasmids:

[0075] (1) pGPH1-USP4-Homo-273(sh-USP4-1): shRNA1 was designed using the nucleotide sequence shown in SEQ ID NO:1 (5'-ACCTTGAAAGAACACTTAATT-3') as the target site and inserted into the eukaryotic expression vector pGPH1 / GFP / Neo; the map information of the eukaryotic expression vector pGPH1 / GFP / Neo is as follows: Figure 5As shown; the nucleotide sequence of the sense strand (S) of shRNA1 is shown in SEQ ID NO:2 (5'-CACC GACCTTGAAAGAACACTTAATTTCAAGAGAATTAAGTGTTCTTTCAAGGTT TTTTTG-3'), and the nucleotide sequence of the antisense strand (A) is shown in SEQ ID NO:3 (5'-GATCCAA AAAAACCTTGAAAGAACACTTAATTCTCTTGAAATTAAGTGTTCTTTCAAG GTC-3');

[0076] (2) pGPH1-USP4-Homo-731(sh-USP4-2): Using the nucleotide sequence shown in SEQ ID NO:4 (5'-CACTGCGCCTAGCAGAAATTT-3') as the target, shRNA2 was designed and inserted into the eukaryotic expression vector pGPH1 / GFP / Neo; wherein, the nucleotide sequence of the sense strand (S) of shRNA2 is shown in SEQ ID NO:5 (5'-CACCGCACTGCGCCTAGCAGAAATTTCAAGAGAATTTCTG CTAGGCGCAGTGTTTTTTG-3'), and the nucleotide sequence of the antisense strand (A) is shown in SEQ ID NO:6 (5'-GATCCAAAAAACACTGCGCCTAGCAGAAATTCTCTTGAAATTTCT GCTAGGCGCAGTGC-3');

[0077] (3) pGPH1-USP4-Homo-80(sh-USP4-3): Using the nucleotide sequence shown in SEQ ID NO:7 (5'-GTCCGAGCTTGGACCCTTAAT-3') as the target, shRNA3 was designed and inserted into the eukaryotic expression vector pGPH1 / GFP / Neo; wherein, the nucleotide sequence of the sense strand (S) of shRNA3 is shown in SEQ ID NO:8 (5'-CACCGTCCGAGCTTGGACCCTTAATTTCAAGAGAATTAAGG GTCCAAGCTCGGACTTTTTTG-3'), and the nucleotide sequence of the antisense strand (A) is shown in SEQ ID NO:9 (5'-GATCCAAAAAAGTCCGAGCTTGGACCCTTAATTCTCTTGAAATTAAGGGTCCAAGCTCGGAC-3');

[0078] (4) pGPH1-USP4-Homo-2172(sh-USP4-4): Using the nucleotide sequence shown in SEQ ID NO:10 (5'-TATGGAACAGCTGACATAAAT-3') as the target, shRNA1 was designed and inserted into the eukaryotic expression vector pGPH1 / GFP / Neo; wherein, the nucleotide sequence of the sense strand (S) of shRNA4 is shown in SEQ ID NO:11 (5'-CACCGTATGGAACAGCTGACATAAATTTCAAGAGAATTTATTGTCAGCTGTTCCATATTTTTTG-3'), and the nucleotide sequence of the antisense strand (A) is shown in SEQ ID NO:12 (5'-GATCCAAAAAATATGGAACAGCTGACATAAATTCTCTTGAAATTTATGTCAGCTGTTCCATAC-3').

[0079] (5) Control plasmid (NC): shRNA5 was designed using the nucleotide sequence shown in SEQ ID NO:13 (5'-TATGGAACAGCTGACATA AAT-3') as the target site and inserted into the eukaryotic expression vector pGPH1 / GFP / Neo; wherein, the nucleotide sequence of the sense strand (S) of shRNA5 is shown in SEQ ID NO:14 (5'-CACCGTATGGAACAGCTGACATAAATTTCAAGAGAATTTATGTCAGCTGTT CCATATTTTTTG-3'), and the nucleotide sequence of the antisense strand (A) is shown in SEQ ID NO:15 (5'-GATCCAAAAAATATGGAACAGCTGACATAAATTCTCTTGAAATTTATGTCA GCTGTTCCATAC-3').

[0080] 2. Plasmid transfection

[0081] (1) Take two 1.5 ml enzyme-free EP tubes and label them A and B respectively. Add 400 μL of serum-free culture medium to each tube. Add 2 μL of Lipofectamine 2000 to the EP tube labeled A and 2 μL of plasmid to the EP tube labeled B. Mix gently and incubate at room temperature for 5 min. Then, gently mix the liquids in tubes A and B and incubate at room temperature for 20 min.

[0082] (2) Take out the 6-well plate or 6cm culture dish (containing HGSOC cell line HEYA8) from the 37℃ cell culture incubator, gently and slowly aspirate the original culture medium, slowly add 2-3 ml of 1×PBS along the side wall, and gently wash the cells using the cross method.

[0083] (3) Slowly add the mixture along the side wall into a 6-well plate or a 6cm culture dish, gently shake it to evenly cover the entire well or the entire culture dish, and place it in a 37℃ cell culture incubator.

[0084] (4) After 4 to 6 hours, aspirate the mixture from the 6-well plate or 6cm culture dish, add 2 to 4 ml of complete culture medium, and place it in a 37℃ cell culture incubator to continue culturing.

[0085] 3. Western blotting assay was used to verify the efficiency of USP4 knockdown.

[0086] 3.1 Protein Extraction

[0087] (1) Set the centrifuge temperature to 4°C in advance, take out the cell culture dish from the cell culture incubator, observe the cell density under the microscope to be about 90%, place the culture dish on the ice box, gently and carefully aspirate the old culture medium in the culture dish, carefully add 1-2 ml of pre-cooled 1×PBS along the side wall, and gently wash 2-3 times with the cross method.

[0088] (2) Prepare RIPA cell lysis buffer, RIPA:PMSF = 100:1 (prepare fresh for use), gently aspirate 1×PBS from the culture dish, add 600 μL of pre-cooled RIPA cell lysis buffer, 4℃, time for 20 min;

[0089] (3) After the timing is over, take out the culture dish and place it on an ice box. Use a cell scraper to scrape the cells in the cell culture dish, trying to avoid the generation of air bubbles. Take a 1.5 ml ep tube, label it, transfer the scraped cell lysis solution to the 1.5 ml ep tube, centrifuge at 12000 rpm for 20 min at 4℃.

[0090] (4) After centrifugation, carefully transfer the supernatant to a new 1.5 mL EP tube, label the sample name on the tube wall, measure the concentration using a nanodop instrument, measure each sample three times and take the average value, and mark the date and concentration on the side wall of the EP tube;

[0091] (5) Pipette 400 μL of cell lysis buffer into a new 1.5 mL ep tube, label the sample as IP protein sample, add 50 μL of 5X Loading Buffer to the remaining 200 μL of cell lysis buffer, mix gently, dry bath at 100°C for 7 min, and then store at -20°C.

[0092] 3.2 Gel Preparation

[0093] (1) Clean the gel plate with double distilled water to remove residual gel, remove the gel preparation frame, fix the gel plate, add double distilled water, time for 10 minutes, observe whether the liquid level drops, and check the air tightness.

[0094] (2) Prepare the separating gel solution and mix A and B gel thoroughly according to the formula ratio;

[0095] (3) After the timing is over, pour out the double distilled water, carefully absorb the residual double distilled water from the edge of the glass plate, add the prepared separating gel solution (2cm from the top edge), gently add the double distilled water from one side to press the separating gel into place, and time for 40 minutes.

[0096] (4) Prepare the concentrated adhesive solution and mix A and B adhesives thoroughly according to the formula ratio;

[0097] (5) After the timing is over, discard the double-distilled water on the top layer, carefully absorb the residual double-distilled water from the edge of the glass plate, add the newly prepared concentrated gel solution, slowly insert the comb, avoid generating air bubbles, and time for 40 minutes.

[0098] (6) After the timer expires, observe that the concentrated gel has solidified. Remove the gel from the gel rack, carefully rinse it clean, wrap it in plastic wrap and store it at 4°C.

[0099] 3.3 Sample loading and SDS-PAGE gel electrophoresis

[0100] (1) Prepare 1× electrophoresis buffer according to the ratio, and take out the protein sample and let it thaw;

[0101] (2) Connect the gel plate and the electrophoresis apparatus, pour in 1× electrophoresis solution, ensure that the liquid surface completely covers the gel plate, and pull out the comb vertically with a steady and slow motion.

[0102] (3) Add protein marker and protein sample to the comb well in sequence (to avoid sample drift);

[0103] (4) Fill the electrophoresis tank with 1× electrophoresis solution, connect the electrophoresis device correctly, and set the initial voltage to 60V;

[0104] (5) After the sample passes through the stacking gel (60 min), increase the voltage to 110V and continue electrophoresis until the bromophenol blue band is observed to run to the bottom of the separating gel (120 min), then stop electrophoresis;

[0105] 3.4 Transfer of film

[0106] (1) Prepare 1× electroporation buffer (prepare fresh before use);

[0107] (2) Cut the required PVDF membrane according to the protein sample loading well, activate it with anhydrous ethanol solution for 5 min, and then place it in 1× electroporation buffer for equilibration.

[0108] (3) Carefully cut the gel from the gel plate and use the sandwich wet transfer method. The order from bottom to top is: thick filter paper, gel, PVDF membrane, thick filter paper (note that air bubbles must not be generated between the gel and the PVDF membrane to avoid cavitation of the strip after exposure).

[0109] (4) 400mA, 25min, ice bath.

[0110] 3.5 Immune response

[0111] (1) After the transfer is complete, carefully clamp the PVDF membrane and place it in the BSA solution. Shake for 40 rpm for 2 hours and then seal at room temperature.

[0112] (2) After the blocking is completed, carefully clamp the PVDF membrane and place it in the primary antibody (USP4 antibody) incubation box and incubate at 4°C overnight (12-16 hours);

[0113] (3) The next day, carefully pick up the PVDF membrane and place it in 1×TBST solution, wash 6 times at 130 rpm for 5 min.

[0114] (4) After washing the membrane, carefully pick up the PVDF membrane and place it in the secondary antibody (enzyme-labeled goat anti-mouse / rabbit IgG polymer, catalog number GK600711-B) incubation box, shake at 40 rpm for 2 hours, and incubate at room temperature.

[0115] (5) After the secondary antibody incubation is completed, carefully pick up the PVDF membrane and place it in 1×TBST solution, wash 6 times at 130 rpm for 5 min.

[0116] (6) Exposure. The results showed that after transfecting the HGSOC cell line HEYA8 with the USP4 knockdown plasmid constructed above, the expression of USP4 protein in HEY-A8 cells was downregulated, indicating that the knockdown transfection was successful. Among the four USP4 knockdown plasmids constructed, sh-USP4-1 had the best knockdown effect. Figure 6 Subsequent experiments were conducted using sh-USP4-1 (hereinafter referred to as sh-USP4).

[0117] Example 4

[0118] CCK8 experiments verified the effect of USP4 knockdown on HGSOC proliferation.

[0119] (1) HEYA8 cells that have undergone pretreatment such as transfection are observed under a microscope. When the density is 90%, they can be digested and centrifuged.

[0120] (2) Add 1×PBS to the six-well plate to wash the cells three times, then add 300 μL of trypsin to digest the cells, and centrifuge at 1000 rpm for 5 min.

[0121] (3) Carefully aspirate the supernatant from the centrifuge tube, retain the cell pellet at the bottom of the tube, add 1 ml of complete culture medium to resuspend and count the cells;

[0122] (4) Mix the complete culture medium and cell suspension in the correct proportion to ensure a concentration of 2 × 10⁻⁶ cells per well. 3 For each cell, the final volume is 100 μL. 1×PBS can be added to the peripheral wells of a 96-well plate to reduce evaporation of the culture medium in the central wells. During inoculation, the cell suspension should be gently mixed with a pipette. Resuspension can be performed during inoculation to ensure uniform cell distribution and reduce differences between wells. After inoculation, continue culturing in a 37°C incubator.

[0123] (5) After culturing in a 37°C cell culture incubator for 6 hours, the original culture medium was discarded, and 50 μL of 1×PBS was added to gently and slowly wash the cells. The culture medium and CCK8 working solution were prepared at a ratio of 100:1 (wrapped in aluminum foil and protected from light). 100 μL was added to each well, and the 96-well plate was placed in a 37°C cell culture incubator for continued culture.

[0124] (6) After culturing the cells at 37℃ for 2 hours, the 96-well culture plate was removed from the incubator, and the OD value of each well was measured at a wavelength of 450nm using a microplate reader. This detection time point was recorded as day 0. CCK8 working solution was added at the same time each day thereafter for detection and recording, and the OD values ​​on days 0, 1, 2, 3, 4, and 5 were recorded. The results showed that knockdown of USP4 inhibited the proliferation of HGSOC cells ( Figure 7 , *p<0.05, **p<0.01, ***p<0.001).

[0125] Example 5

[0126] Plate cloning experiments validated the effect of USP4 knockdown on HGSOC proliferation.

[0127] (1) The preliminary cell treatment steps are the same as steps (1) to (3) in Example 4;

[0128] (2) Inoculate 1×10⁶ cells per well of a six-well plate. 3 Each well contains 2 ml of complete culture medium and cell suspension. Gently shake the six-well plate and check under a microscope to ensure the cells are evenly distributed in the plate. Label the cell line name, experimental group, and plate date, and place the plate in a 37°C cell culture incubator for further culture.

[0129] (3) Replace the complete culture medium regularly, and terminate the culture when cell colonies are observed (10-15 days);

[0130] (4) Discard the old culture medium and gently add 2 ml of 1×PBS along the side wall of the six-well plate to wash the cells three times.

[0131] (5) Gently add 2 ml of 4% paraformaldehyde fixative along the sidewall of the six-well plate and fix at 4°C for 20 minutes;

[0132] (6) Remove 4% paraformaldehyde fixative, gently add 2 ml of 1×PBS along the sidewall of the six-well plate, and wash the cells three times.

[0133] (7) Gently add 2 ml of crystal violet staining solution along the sidewall of the six-well plate, and time for 20 minutes at room temperature.

[0134] (8) Remove the crystal violet staining solution, gently add 2 ml of 1×PBS along the side wall of the six-well plate, wash the cells three times, invert and air dry at room temperature, then take pictures and count the cells.

[0135] (9) Clones containing more than 50 cells were counted, and the colony formation rate was calculated as follows: Colony formation rate = (number of clones / initial number of inoculated cells) × 100%. The results showed that knockdown of USP4 inhibited the proliferation of HGSOC cells. Figure 8 (p<0.05).

[0136] As can be seen from the above, USP4 can be a target for the diagnosis, evaluation, and clinical treatment of high-grade serous carcinoma.

[0137] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of ubiquitin-specific protease 4 as a biomarker in the preparation of products for the diagnosis and / or prognostic assessment of high-grade serous carcinoma.

2. Application of reagents or methods for detecting ubiquitin-specific protease 4 expression levels in the preparation of products for the diagnosis and / or prognostic assessment of high-grade serous carcinoma.

3. The application according to claim 2, characterized in that, The reagent for detecting ubiquitin-specific protease 4 expression level includes an antibody that specifically binds to ubiquitin-specific protease 4. The methods for detecting ubiquitin-specific protein 4 expression levels include one or more of immunohistochemical staining, Western blotting, and enzyme-linked immunosorbent assay. The prognostic assessment metrics include overall survival.

4. The application according to any one of claims 1 to 3, characterized in that, The product is a reagent or kit.

5. Application of ubiquitin-specific protease 4 as a therapeutic target in the preparation of drugs for treating high-grade serous carcinoma.

6. Application of reagents that downregulate ubiquitin-specific protease 4 expression levels in the preparation of drugs for treating high-grade serous carcinoma.

7. The application according to claim 6, characterized in that, The reagents used to downregulate the expression level of ubiquitin-specific protease 4 include shRNA; The shRNA includes one or more of shRNA1, shRNA2, shRNA3 and shRNA4; The shRNA1 targets the nucleotide sequence shown in SEQ ID NO:

1. The shRNA2 targets the nucleotide sequence shown in SEQ ID NO:

4. The shRNA3 targets the nucleotide sequence shown in SEQ ID NO:7; The shRNA4 targets the nucleotide sequence shown in SEQ ID NO:

10.

8. The application according to claim 7, characterized in that, The nucleotide sequence of the sense strand of shRNA1 is shown in SEQ ID NO:2, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:

3. The nucleotide sequence of the sense strand of shRNA2 is shown in SEQ ID NO:5, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:

6. The nucleotide sequence of the sense strand of the shRNA3 is shown in SEQ ID NO:8, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:

9. The nucleotide sequence of the sense strand of shRNA4 is shown in SEQ ID NO:11, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:

12.

9. A shRNA for treating high-grade serous carcinoma, characterized in that, The shRNA includes one or more of shRNA1, shRNA2, shRNA3 and shRNA4; The nucleotide sequence of the sense strand of shRNA1 is shown in SEQ ID NO:2, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:

3. The nucleotide sequence of the sense strand of shRNA2 is shown in SEQ ID NO:5, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:

6. The nucleotide sequence of the sense strand of the shRNA3 is shown in SEQ ID NO:8, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:

9. The nucleotide sequence of the sense strand of shRNA4 is shown in SEQ ID NO:11, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:

12.

10. A recombinant vector for treating high-grade serous carcinoma, characterized in that, The recombinant vector includes a base vector and shRNA inserted into the base vector; the shRNA is the shRNA as described in claim 9.

Images