Application of combination of USP51 inhibitor and PD-L1 / PD-1 monoclonal antibody drug in preparation of tumor immunotherapy drug

By combining USP51-CD200 axis inhibitors with PD-L1/PD-1 monoclonal antibodies, the problem of unresponsiveness to ICB therapy in cancer patients has been addressed, enhancing the efficacy of tumor immunotherapy. In particular, in cutaneous malignant melanoma, the USP51 inhibitor combined with bleomycin liposome encapsulation significantly improved treatment sensitivity and safety.

CN120960439AActive Publication Date: 2025-11-18XIANGYA HOSPITAL CENT SOUTH UNIV
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202511464127.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-14
Publication Date
2025-11-18
Estimated Expiration
2045-10-14

AI Technical Summary

Technical Problem

Current immune checkpoint blockade therapy (ICB) does not respond to more than 60% of cancer patients, and its resistance mechanism is unclear. Single immune checkpoint blockade therapy has limited efficacy, and it is necessary to explore the regulatory molecular mechanisms of multiple immune checkpoints to improve treatment efficacy. In particular, in cutaneous malignant melanoma, the regulatory mechanism of CD200 is unclear, and the relationship between USP51 and tumor immunotherapy has not been reported.

Method used

Develop USP51-CD200 axis-related inhibitors in combination with PD-L1/PD-1 monoclonal antibodies. By detecting USP51 expression levels and using USP51 inhibitors such as shUSP51 and siUSP51, as well as bleomycin (BLM) in liposome encapsulation form in combination with PD-L1/PD-1 monoclonal antibodies, we can directly inhibit USP51 protein expression, regulate CD200 stability, and promote immune response.

Benefits of technology

It significantly improved the sensitivity to anti-PD-1 therapy, enhanced the activity and infiltration of CD8+ T cells, inhibited tumor growth, improved the efficacy of tumor immunotherapy, and reduced the adverse reactions of bleomycin.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention belongs to the field of PD-L1 / PD-1 monoclonal antibody tumor immunotherapy, and aims to provide a new research and development direction of PD-L1 / PD-1 monoclonal antibody tumor immunodetection or immunotherapy adjuvant drugs and a new drug combination mode. Experimental results of the invention verify that the invention discloses an application of a reagent for detecting the expression quantity of USP51 in preparation of a detection kit for preparing a PD-L1 / PD-1 monoclonal antibody tumor immunotherapy drug, and discloses an application of a combination of a USP51 inhibitor and a PD-L1 / PD-1 monoclonal antibody drug in preparation of a drug for treating melanoma. The invention discloses an application of a combination of a CD200 inhibitor and a PD-L1 / PD-1 monoclonal antibody in preparation of a drug for treating melanoma, and further discloses an application of a combination of liposome-coated bleomycin and a PD-L1 / PD-1 monoclonal antibody in preparation of a drug for treating melanoma, so that the adverse reaction of bleomycin can be reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to the field of PD-L1 / PD-1 monoclonal antibody tumor immunotherapy, and further to the application of USP51-CD200 axis inhibitors combined with PD-L1 / PD-1 monoclonal antibody drugs in the preparation of tumor immunotherapy drugs. Background Technology

[0002] Immune checkpoint blockade (ICB) therapy has significantly improved clinical outcomes and is currently used in various solid tumors, including metastatic melanoma and non-small cell lung cancer. However, more than 60% of cancer patients do not respond to ICB therapy, and there are continuous reports of primary and secondary resistance to ICB treatment, the underlying mechanisms of which remain unclear. It is well known that multiple inhibitory immune checkpoints work together to form an inhibitory tumor microenvironment and promote tumor immune escape. Compared with single immune checkpoint blockade therapy, the combined use of more than one ICB therapy is more effective, suggesting that these immune checkpoints may have multiple immunosuppressive mechanisms that promote tumor growth. Therefore, in addition to the currently used PD-1, PD-L1, and CTLA-4 inhibitors, further investigation into the molecular mechanisms regulating inhibitory immune checkpoints will help improve the efficacy of PD-1 inhibitor combination therapy.

[0003] Skin cutaneous melanoma (SKCM) is a highly malignant skin tumor originating from melanocytes. Invasive melanoma accounts for only 1% of all skin tumors, but its mortality rate is extremely high, and the incidence of melanoma is showing an increasing trend year by year.

[0004] Deubiquitinating enzymes (DUBs) are key components of the ubiquitin-proteasome system (UPS), capable of removing ubiquitin chains from protein substrates. Among them, ubiquitin-specific proteases (USPs) constitute the largest superfamily of DUBs. Increasing evidence suggests that USP dysfunction may lead to various types of solid tumors or other pathological changes. Some studies have found that USP51 is associated with the therapeutic efficacy of some tumors, but no relationship has been reported between USP51 and melanoma immunotherapy.

[0005] CD200, also known as OX-2, is a type I membrane glycoprotein that acts as an immunomodulatory cell surface ligand. It binds to CD200R expressed on immune cells. Increased CD200 expression can contribute to tumorigenesis in solid tumors, including rectal cancer, ovarian cancer, and melanoma. In cutaneous melanoma, CD200 is considered a downstream target of RAS / RAF / MEK / ERK activation. It inhibits primary T cell activation and is associated with tumor progression, and is also considered a potential therapeutic target. However, the regulatory mechanism of CD200 in melanoma remains unclear.

[0006] Bleomycin (BLM) is a cytotoxic antibiotic used to treat cancer. Its iron-containing complexes intercalate into DNA, causing single-strand and double-strand breaks, but not RNA strand breaks. It has been approved by the FDA for the treatment of Hodgkin's lymphoma, non-Hodgkin's lymphoma, testicular cancer, and malignant pleural effusion. It is also used in dermatological conditions such as various malignant skin tumors, hemangiomas, and warts. Bleomycin can be used to treat melanoma, but it has significant adverse reactions. Summary of the Invention

[0007] To address the shortcomings of existing technologies, the purpose of this invention is to investigate the application of USP51-CD200 axis-related inhibitors in combination with PD-L1 / PD-1 monoclonal antibody drugs in the preparation of tumor immunotherapy drugs. Furthermore, the purpose of this invention is to provide a new research and development direction for PD-L1 / PD-1 monoclonal antibody tumor immune detection or adjuvant immunotherapy drugs, and to develop new combination drug regimens.

[0008] In this study, we found that high expression of USP51 is associated with non-responsiveness to anti-PD-1 therapy; we found that USP51 can regulate CD200 at the protein level and promote immune escape of tumor cells; in addition, we found that bleomycin can promote CD200 degradation by inhibiting USP51; we further evaluated the synergistic effect of bleomycin combined with anti-PD-1 therapy, providing a new potential strategy for combination therapy of tumors.

[0009] The technical solution of this invention is: The application of reagents for detecting USP51 expression levels in the preparation of a detection kit for the treatment of PD-L1 / PD-1 monoclonal antibody tumor immunotherapy drugs, wherein the tumor is melanoma.

[0010] Application of USP51 inhibitors in the preparation of drugs for treating melanoma.

[0011] Application of USP51 inhibitors in combination with PD-L1 / PD-1 monoclonal antibody drugs in the preparation of drugs for treating melanoma, wherein the tumor is melanoma.

[0012] Preferably, the inhibitors of USP51 include shUSP51 and siUSP51.

[0013] In a preferred embodiment of the present invention, the inhibitor of USP51 is as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8.

[0014] Application of CD200 inhibitors in combination with PD-L1 / PD-1 monoclonal antibody drugs in the preparation of drugs for treating melanoma.

[0015] Application of USP51-CD200 axis inhibitors in combination with PD-L1 / PD-1 monoclonal antibody drugs in the preparation of tumor immunotherapy drugs, wherein the tumor is melanoma.

[0016] The application of bleomycin in combination with PD-L1 / PD-1 monoclonal antibodies in the preparation of drugs for treating melanoma, wherein the bleomycin is liposome-encapsulated bleomycin.

[0017] In the above technical solutions: the tumor is preferably a solid tumor. The tumor is further preferably a cutaneous malignant melanoma.

[0018] Preferably, the bleomycin is prepared by a method of liposome-encapsulated bleomycin (liposomes@BLM): Synthesized using a thin-film dispersion method: The lipid components were dissolved in a chloroform:methanol solution of (4-6):1. The lipid components were dipalmitoylphosphatidylcholine (DPPC) and phosphatidylethanolamine-polyethylene glycol 2000-biotin (DSPE-mPEG2000) in a mass ratio of (4-8):1. After complete dissolution, the organic solvent was evaporated in a water bath at 60-70℃ to form a semi-transparent and uniform film. Then, 5-10 mL of bleomycin aqueous solution (1.5 mg / mL-1.8 mg / mL) was added under ultrasonication. After purification by ultrafiltration, the film was stored at 0-4℃. Then, it was hydrated with DPBS containing indocyanine green (ICG) or rhodamine B (RhB). The liposomes were then homogenized by ultrasonication. The resulting liposomes@BLM were stored at 0-4℃ in the dark for later use.

[0019] Preferably, the concentration of liposomes@BLM is 1.3 mg / mL to 1.5 mg / mL, and more preferably, the concentration of liposomes@BLM is 1.31 mg / mL to 1.5 mg / mL.

[0020] To further explain, the lipid components, by mass ratio, are dipalmitoylphosphatidylcholine:phosphatidylethanolamine-polyethylene glycol 2000-biotin = (4~8):1.

[0021] This invention, through multi-omics analysis and validation in a self-tested melanoma anti-PD-1 treatment cohort, revealed that elevated USP51 expression in patients unresponsive to anti-PD-1 therapy is closely associated with poor prognosis. Animal models demonstrated that downregulation of USP51 further enhances anti-tumor effects by increasing cytotoxic T cell infiltration. We clarified that USP51 can regulate CD200 stability and promote an immunosuppressive tumor microenvironment, reducing CD8+ T cell infiltration and activation. We also confirmed that bleomycin can directly bind to and inhibit USP51 protein expression, and that liposome-encapsulated bleomycin can sensitize the efficacy of anti-PD-1 therapy.

[0022] Specifically, in Example 1, such as Figure 1 and Figure 2 As shown, we performed a comprehensive analysis of multiple melanoma patient cohorts receiving anti-PD-1 therapy, including overall survival (OS), response status (non-response, NR; response, R), and cancer-specific expression (cancer, CA; cancer junction, CJ). After appropriate quality control and cell annotation (…),… Figure 1 (A and 1B) We found that the USP family was highly expressed in unresponsive individuals, especially in the post-treatment group ( Figure 1 C and Figure 2 A). We further analyzed the genes contained in the USP family: (1) in the self-tested anti-PD-1 treatment single-cell RNA-seq cohort, unresponsive patients and other groups (logFC>0 and p Differential expression analysis of USP family genes among post-treatment samples with <0.05 ( Figure 2 B); (2) Cox regression and differential expression analysis of USP family genes at various key clinical endpoints (OS: HR>1 and p <0.05, Figure 2 C;NR and R:logFC> and p <0.05, Figure 2 D; CA and CJ:logFC> and p <0.05, Figure 2 E). Within the USP family, USP51 shows significant importance among differentially expressed genes in groups at risk of overall survival, unresponsive to treatment, and highly expressed in tumor tissue. Therefore, USP51 may be the most important gene in melanoma tumor immune escape. Figure 2F). Next, we performed a functional analysis of tumor-specific USP51 expression and found that high expression of USP51 was negatively correlated with anti-tumor immunity (F). Figure 2 (G) The above bioinformatics analysis results show that USP51 is likely to negatively regulate tumor immunity and mediate immune escape processes.

[0023] In Example 2, as Figure 3 and Figure 4 To further explore the therapeutic potential of USP51 in anti-PD-1 therapy, we collected an independent cohort of cutaneous melanoma patients and validated this result. These patients had melanoma grade higher than AJCC IIB, received anti-PD-1 therapy, and were followed up for at least 1.5 years. Figure 3 A- Figure 3 B). We observed significantly high expression of USP51 in unresponsive patients in an independent cohort of cutaneous melanoma patients. Figure 3 C- Figure 3 D), and was associated with poorer overall survival and progression-free survival. Figure 3 E- Figure 3 F); To investigate the role of USP51 in melanoma and anti-tumor immune regulation, we constructed a USP51 knockdown B16F10 melanoma cell line (F). Figure 4 A), and then B16F10 mouse melanoma cells were inoculated into C57BL / 6 mice for further study. We found that knocking down USP51 significantly inhibited the growth of mouse melanoma tumors ( Figure 4 B- Figure 4 D), and prolong survival ( Figure 4 E), Flow cytometry showed that USP51 depletion increased the activity of cytotoxic CD8+ T cells (E), Figure 4 F- Figure 4 G), further inhibiting tumor growth.

[0024] In Example 3, as Figure 5 As shown, we used the public TCGA-SKCM database to screen the correlation between USP51 expression levels and inhibitory immune checkpoints in tumor cells. We found that USP51 was significantly positively correlated with the inhibitory immune checkpoint CD200. Figure 5 A). In vitro, we knocked down USP51 with siRNA in the A375 melanoma cell line and screened for 13 immune checkpoints. We found that knocking down USP51 significantly reduced CD200 ( Figure 5 B). In our independent anti-PD-1 treatment cohort, USP51 was found to be positively correlated with CD200 at the protein level. Figure 5 C and Figure 5D). Knocking down USP51 reduces CD200 protein levels but does not alter CD200 mRNA levels in A375 cells. Figure 5 E- Figure 5 F). However, the proteasome inhibitor MG132 blocked the decrease in CD200 protein levels induced by USP51 knockout (F). Figure 5 F). Overexpression of USP51 significantly increased CD200 protein levels (F). Figure 5 G). The half-life of endogenous CD200 was measured by inhibiting protein biosynthesis in A375 cells with actinomycin (CHX). Knockout of USP51 significantly shortened the half-life of CD200 protein. Figure 5 H), while overexpression of USP51 prolonged its half-life (H). Figure 5 I). The above findings indicate that USP51 regulates and stabilizes CD200 at the protein level.

[0025] In Example 4, as Figure 6 As shown, we performed a structure-based virtual screening of more than 48,000 compounds from 10 compound libraries. Figure 6 A). Molecular docking analysis was performed, and a series of compounds with potential binding interactions with USP51 were screened. Figure 6 B), by detecting the protein levels of USP51 and CD200 in A375 cells after drug treatment at the cellular level, it was found that bleomycin (S1214) significantly reduced the protein levels of USP51 and CD200 in a dose-dependent manner. Figure 6 C). Subsequent protein-drug binding experiments revealed that bleomycin can directly bind to the USP51 protein. Figure 6 D). The above results indicate that bleomycin can directly bind to the USP51 protein, thereby exerting its anti-tumor effect.

[0026] In Example 5, as Figure 7 As shown, we found that bleomycin significantly inhibited the protein levels of USP51 and CD200 in A375 cells compared to the control group. Figure 7 A), bleomycin treatment significantly enhanced the effect of T cells in killing tumor cells ( Figure 7 B); Bleomycin can effectively inhibit tumors in melanoma-bearing mice ( Figure 7 C- Figure 7 E), and can enhance the activity and cytotoxicity of CD8+ T cells in vivo (E), and can also enhance the activity and cytotoxicity of CD8+ T cells in vivo ( Figure 7 F), tumor volume and tumor weight were significantly reduced in the bleomycin and PD-1 monoclonal antibody combination therapy group (F). Figure 7 G- Figure 7 J), CD8+ T cell infiltration was significantly enhanced ( Figure 7These results indicate that the combined use of bleomycin and PD-1 monoclonal antibody can significantly promote the infiltration of CD8+ T cells and inhibit the growth of melanoma tumors.

[0027] In Example 6, as Figure 8 and Figure 9 As shown, to improve drug delivery efficiency, we encapsulated bleomycin in liposomes. Figure 8 A); Transmission electron microscope (TEM) images showed that liposomes@BLM were uniformly spherical, and the particle size of liposomes@BLM was detected to be 125.39 nm by dynamic light scattering (DLS). Figure 8 B), suitable for drug delivery applications. Meanwhile, the potentials of liposomes and liposomes@BLM are approximately -7mV and -6mV, respectively. Figure 8 C), and the particle size is stable ( Figure 8 These characteristics contribute to their stability in the physiological environment and avoid large charge gradients during treatment. We found that the human melanoma cell line A375 can take up liposomes@BLM in a time-dependent manner. Figure 8 E); In mice, ICG-labeled liposomes@BLM remained at the tumor site for a longer period than free BLM. Figure 8 F); liposomes@BLM, when used in combination with PD-1 monoclonal antibodies, exhibits synergistic antitumor effects (F). Figure 8 G- Figure 8 I) did not cause significant changes in mouse body weight. Figure 8 J), and can significantly activate CD8+ T cells (J), and can significantly activate CD8+ T cells (J). Figure 9 A); Liposome encapsulation significantly reduced bleomycin-induced pulmonary fibrosis ( Figure 9 B- Figure 9 C). In summary, compared with conventional formulations, liposome-based bleomycin enhanced therapeutic efficacy, increased bleomycin-mediated CD8+ T cell activation, and significantly improved safety when used in combination with PD-1 monoclonal antibodies.

[0028] Explanation of the name: In PD-L1 / PD-1, " / " means "and" or "or".

[0029] Compared with the prior art, the beneficial effects of the present invention are: 1. Through multi-omics analysis and subsequent validation in a cohort of self-tested melanoma patients receiving anti-PD-1 treatment, this invention elucidates that elevated USP51 expression in patients unresponsive to anti-PD-1 treatment is closely associated with poor prognosis.

[0030] 2. This invention identifies USP51 as a key deubiquitinase of CD200, directly regulating its stability, promoting an immunosuppressive tumor microenvironment, and reducing the infiltration and activation of CD8+ T cells.

[0031] 3. In this invention, bleomycin has been shown to directly bind to and inhibit the expression of USP51 protein. Liposome-encapsulated bleomycin makes tumors more sensitive to anti-PD-1 therapy and significantly improves in vivo treatment outcomes.

[0032] The detailed structure of the present invention will be further described below with reference to the accompanying drawings and specific embodiments; Attached Figure Description

[0033] Figure 1 This is one of a comprehensive target analysis plots from multiple self-tested and public anti-PD-1 treatment cohorts, in which: Figure 1 (A) The t-distributed stochastic neighbor embedding (T-SNE) plot shows cell type annotations in single cells from melanoma patients in the self-test cohort; Figure 1 (B) The heatmap shows the expression of corresponding cellular markers in different cell types; Figure 1 (C) USP signature is expressed in single cells from melanoma patients in the self-test cohort.

[0034] Figure 2 This is the second comprehensive target analysis diagram from multiple self-tested and public anti-PD-1 treatment cohorts, in which: Figure 2 (A) The dot plot shows the expression characteristics of the USP family in samples from different melanoma anti-PD-1 treatment response states and time points; Figure 2 (B) The heatmap shows the expression of the USP gene in samples from different melanoma anti-PD-1 treatment response states and at different time points; Figure 2 (C) The dot plot shows the association between the USP gene and overall survival in the anti-PD-1 cohort; the color represents the log10 hazard ratio, and the size of the dot represents the p-value representing importance; Figure 2 (DE) Volcano plots show the differential expression of the USP gene between non-responders and responders, as well as between cancerous and adjacent normal tissues; genes that are significantly upregulated in non-responders and cancer are marked in red, while genes that are significantly downregulated are marked in blue. Figure 2(F) The Venn diagram shows the overlap of differentially expressed genes identified in different survival periods (at risk to overall survival), response status (high expression in non-responders), and tissue expression patterns (high expression in cancer tissues); Figure 2 (G) Ridge plots show important biological processes associated with USP51 expression.

[0035] Figure 3 This is one of the graphs demonstrating the association between USP51 and anti-PD-1 treatment response, showing that downregulation of USP51 enhances the activity of cytotoxic T lymphocytes (CTLs). Figure 3 (A and B) Clinical characteristics of a self-tested melanoma cohort receiving anti-PD-1 antibody therapy; each column represents one patient; patients with complete remission (CR) and partial remission (PR) are classified as responders (R), while patients with stable disease (SD) and progressive disease (PD) are classified as non-responders (NR); Figure 3 (C) Immunohistochemical staining shows USP51 expression in tumor samples from a self-tested melanoma cohort that received anti-PD-1 therapy; Figure 3 (D) There was a significant difference in USP51 expression between R and NR; significance was determined by the Wilcoxon rank-sum test. Figure 3 (EF) Kaplan-Meier plots show the association between USP51 expression and overall survival (E) or progression-free survival (F).

[0036] Figure 4 Figure 2 demonstrates the association between USP51 and anti-PD-1 treatment response, showing that downregulation of USP51 enhances CTL activity. Figure 4 (A) Representative protein blot and quantitative analysis of USP51 protein expression when USP51 is knocked out in B16F10 cells; Figure 4 (B) Measure tumor volume at different specified time points; Figure 4 (CD) Photographs and tumor weights of representative tumors in the B16F10 tumor-bearing mouse model (7 mice per group); Figure 4 (E) Kaplan-Meier survival curves of C57BL / 6 mice with tumors formed from B16F10 cell lines transfected with shNC and shUSP51 (10 mice per group). Figure 4(FG) Quantitative analysis of CD8+ / CD3+ T cells and GZMB+CD8+ T cells in shNC group or shUSP51 B16F10 tumors based on flow cytometry; each column represents the mean ± standard deviation of three independent experiments, **p<0.01, ***p<0.001.

[0037] Figure 5 This is a diagram of USP51 regulating the immune checkpoint CD200; where: Figure 5 (A) The heatmap shows the Spearman correlation between USP51 expression and malignant cell expression of immune checkpoints in the Cancer Genome Atlas Cutaneous Melanoma Cohort (TCGA-SKCM); Figure 5 (B) Western blot and quantitative analysis of immune checkpoint expression when USP51 is knocked down in A375 cells; Figure 5 (C) Immunohistochemical staining showed that USP51 and CD200 were expressed in tumor samples from a self-tested melanoma cohort that received anti-PD-1 therapy. Figure 5 (D) The scatter plot shows the correlation of protein levels between the self-tested cohorts USP51 and CD200; Figure 5 (E) USP51 (left) and CD200 (right) mRNA levels measured by RT-qPCR when USP51 was knocked down in A375 cells. Each bar represents the mean ± standard deviation of three independent experiments. NS p >0.05, * p <0.05,** p <0.01, *** p <0.001; Figure 5 (F) Representative proteoblotting and quantitative analysis of USP51 and CD200 protein expression when USP51 was knocked down in A375 cells and then treated with MG132 (10 μM) for 6 hours. Each bar represents the mean ± standard deviation of three independent experiments. NS p >0.05, * p <0.05,** p <0.01, *** p <0.001; Figure 5 (G) Western blot analysis of USP51 and CD200 protein levels in A375 cells transfected with USP51-MYC for 48 hours. Figure 5(H) A375 cells transfected with control shRNA and USP51 shRNA were treated with CHX (200 ng / mL), and cell pellets were collected at specified time points for Western blotting; CD200 protein level quantification is presented as a line graph, with each line representing the mean ± standard deviation of three independent experiments.* p <0.05; Figure 5 (I) A375 cells transfected with the vector expressing USP51-HA and the empty vector were treated with CHX (200 ng / mL), and cell pellets were collected at specified time points for Western blotting; CD200 protein level quantification was presented as a line graph, with each line representing the mean ± standard deviation of three independent experiments. p <0.01.

[0038] Figure 6 This is a high-throughput screening graph for USP51 inhibitors; where: Figure 6 (A) Flowchart for screening USP51 small molecule inhibitors; Figure 6 (B) Characteristics of the top 15 small molecule inhibitors targeting USP51 identified through virtual screening; Figure 6 (C) A375 cells were treated with 15 representative candidate drugs for 24 hours, and Western blots were performed. The heatmap shows the gray values ​​of USP51 and CD200. Figure 6 (D) shows the curves obtained from the peak values ​​of the optical interference signal measured at different BLM concentrations, used to determine the equilibrium dissociation constant (Kd) of the interaction between USP51 and BLM.

[0039] Figure 7 The graph shows the experimental results of combining bleomycin and anti-PD-1 therapy to improve efficacy; in which: Figure 7 (A) Representative Western blot and quantitative analysis of USP51 and CD200 protein expression after treating A375 cells with increasing concentrations of BLM (0, 2.5, 5 μM) for 24 hours. Each column represents the mean ± standard deviation of three independent experiments. p <0.01, *** p <0.001; Figure 7 (B) A375 cells were co-cultured with activated T cells for 24 hours and stained with crystal violet with or without BLM (2.5-5 μM); the ratio of tumor cells to T cells was 1:0, 1:1, or 1:3; the survival rate of A375 cells in three independent replicate experiments was quantitatively analyzed, and the results are shown as mean ± SD, * p <0.05,** p <0.01; Figure 7 (C) Schematic diagram of the mouse treatment plan; C57BL / 6 mice subcutaneously implanted with 5×10 5B16F10 cells were administered BLM at a dose of 2 mg / kg (low dose, LD) or 5 mg / kg (high dose, HD). Figure 7 (D) Measure tumor volume at different specified time points; Figure 7 (E) In the B16F10 tumor burden mouse model, photographs and tumor weights of representative tumors were measured on day 12 following BLM-LD and BLM-HD treatment; data are presented as mean ± standard deviation, *** p <0.001; Figure 7 (F) Flow cytometry analysis of the number of CD8+ and GZMB+CD8+ T cells in B16F10 tumor tissues from different treatment groups. NS p >0.05, * p <0.05,** p <0.01; Figure 7 (G) Schematic diagram of the mouse treatment plan; C57BL / 6 mice were implanted with 5×10 5 B16F10, BLM (5 mg / kg) and PD-1 mAb (100 µg / animal) were administered alone or together; Figure 7 (H) Measure tumor volume at different specified time points; data are expressed as mean ± standard deviation, * p <0.05, *** p <0.001; Figure 7 (IJ) Photographs of representative tumors (I) and tumor weight (J) measured on day 12 after BLM and PD-1 monoclonal antibody treatment in a B16F10 tumor-bearing mouse model; data are presented as mean ± standard deviation, * p <0.05,** p <0.01, *** p <0.001; Figure 7 (K) Multiplex immunofluorescence assays show the expression levels of USP51, CD200 and CD8 in tumor tissue.

[0040] Figure 8 One of the experimental results shown is to verify that liposome encapsulation of bleomycin reduced adverse reactions associated with combination therapy. Figure 8 (A) Structural diagram and Tyndall effect diagram of Liposomes@BLM; Figure 8 (B) DLS measurement of Liposomes@BLM particle size; Inset: TEM image of Liposomes@BLM morphology, scale bar: 100 nm; Figure 8 (C) Potential of Liposomes @BLM; Figure 8(D) Long-term stability of Liposomes and Liposomes@BLM in PBS and DMEM complete media; Figure 8 (E) Confocal laser scanning microscope (CSLM) was used to observe the uptake of RhB-labeled Liposomes@BLM by A375 cells; scale bar: 10µm; Figure 8 (F) In vivo fluorescence biodistribution of RhB-labeled Liposomes@BLM in the B16F10 tumor-bearing mouse model; Figure 8 (G) Measure tumor volume at different specified time points; Figure 8 (HI) Photographs of representative tumors (H) and tumor weights (I) on day 12 of the B16F10 tumor-bearing mouse model; data are presented as mean ± standard deviation, * p <0.05, *** p <0.001 (n=6 mice per group); Figure 8 (J) Measure mouse body weight at different specified time points.

[0041] Figure 9 Figure 2 shows the experimental results demonstrating that liposome encapsulation of bleomycin reduced adverse reactions associated with combination therapy. Figure 9 (A) Flow cytometry analysis of the number of CD8+ and GZMB+ / CD8+ T cells in B16F10 tumors in different treatment groups,* p <0.05,** p <0.01, *** p <0.001; Figure 9 (B) The expression levels of fibronectin, type I collagen, and α-SMA in lung tissue were detected by H&E staining, immunohistochemistry, and immunofluorescence staining; scale bar: 50µm; Figure 9 (C) ImageJ analysis of the positive area ratios of fibronectin, type I collagen and α-SMA. Detailed Implementation

[0042] The experimental methods used in the embodiments are all existing methods and can be performed with reference to existing technical documents. Example 1

[0043] 1. High expression of USP51 is associated with non-responsiveness to PD-1 monoclonal antibody therapy. 1.1 Experimental Methods Single-cell transcriptome sequencing (10x Genomics, Pleasanton, CA) was performed on eight fresh melanoma tissues from melanoma patients who received anti-PD-1 therapy at Xiangya Hospital. The obtained single-cell RNA-seq profiles were then subjected to T-distribution random neighbor embedding (T-SNE).

[0044] Multiple public data cohorts and mRNA information were obtained from the GEO, SRA, dbGaP, and TCGA databases. Data from these databases were analyzed using R (3.6.0) and R Bioconductor. The infiltration level of immune cell populations was calculated using GSVA (3.2), and pathway analysis was performed using fgsea and clusterProfiler (4.0). Enrichment analysis. Based on expression data of key USP enzyme genes, a USP characteristic model representing the total activity of the USP superfamily was established. Enrichment scoring (ES) of USP genes was performed using single-sample gene set enrichment analysis (ssGSEA).

[0045] Comparisons were analyzed using the Wilcoxon rank-sum test or an unpaired two-tailed t-test. Time-series tests were used in survival analysis to detect differences in Kaplan-Meier curves across multiple groups. In IHC assays, samples with USP51 expression greater than the 0.55 quantile and less than the 0.45 quantile were defined as USP51 high and USP51 low, respectively. The association between immune cell infiltration, immune checkpoint expression, and USP51 expression was calculated using Spearman rank correlation. p <0.05、** p <0.01、*** p <0.001 and NS p >0.05. All analysis and data visualization were performed using GraphPad Prism (8.0) and R studio (4.4).

[0046] 1.2 Experimental Results To identify effective targets for reversing resistance to anti-PD-1 therapy, we focused on a group of ubiquitin-specific peptidases (USPs), the largest deubiquitinating enzyme (DUB) superfamily, which plays a crucial role in regulating the tumor microenvironment and involved in tumor immune escape. We conducted a comprehensive analysis of multiple melanoma patient cohorts receiving anti-PD-1 therapy; appropriate quality control and cell annotation were performed. Figure 1 (A and 1B) We first analyzed USP expression in the self-tested anti-PD-1 treatment cohort. The results showed that USP was highly expressed in treatment-unresponsive patients, especially in the post-treatment group ( Figure 1 C and Figure 2A); Further, we analyzed the expression of different genes in the USP family in the treatment-unresponsive or responsive groups (logFC>0 and p <0.05)( Figure 2 B), and the correlation between the USP family and survival (OS:HR>1 and p <0.05, Figure 2 C), USP51 in the absence of a responder (NR and R:logFC>and p <0.05, Figure 2 D) and cancerous tissue (CA with CJ:logFC>and p <0.05, Figure 2 USP51 was significantly upregulated in E. We also validated the predictive and prognostic effects on several other ICB-treated datasets, demonstrating that USP51 has the potential to differentiate response status and prognosis; within the USP family, USP51 showed the most consistent results in Cox regression and differential expression analysis across different patient cohorts. Figure 2 F).

[0047] We further performed functional analysis on tumor-specific USP51 and found that high expression of USP51 was negatively correlated with anti-tumor immunity, such as immune regulatory factors, chemokines, and interleukin signaling between lymphocytes and non-lymphocytes. Figure 2 G). The above results indicate that high expression of USP51 in tumor cells is associated with non-responsiveness to anti-PD-1 therapy; it is likely to negatively regulate tumor immunity and mediate immune evasion; USP51 may have a unique regulatory mechanism between malignant cells and immune cells that promotes tumor immune escape.

[0048] Example 2 2. Downregulation of USP51 enhances antitumor activity by accumulating cytotoxic T cells. 2.1 Experimental Methods A separate self-testing cohort was collected, including 57 patients with melanoma grade greater than AJCC IIB who received anti-PD-1 therapy and were followed for at least 1.5 years. Figure 3 (AB) The expression of USP51 in patients was detected by immunohistochemistry, and the relationship between USP51 expression and patient survival was analyzed.

[0049] USP51 knockdown mouse melanoma cells B16F10 were constructed. Approximately 6 days before the experiment, 5*10 B16F10 melanoma cells were subcutaneously injected into the right dorsal wing of 6-8 week old C57BL / 6 mice. 5Each group consisted of 17 mice. Mouse weight and tumor volume were measured every two days, calculated using the formula (length × width × width × π) / 6. On day 12, 7 mice were sacrificed, tumors were photographed, and tissue samples were preserved for staining of cell membrane proteins and intracellular markers for further analysis. The remaining 10 mice were observed until death, and survival analysis was performed.

[0050] 2.2 Experimental Results To further explore the therapeutic potential of USP51 in anti-PD-1 therapy, we validated this result in an independent cohort of cutaneous melanoma. Figure 3 A); To validate at the protein level, we collected an independent self-test cohort of 57 melanoma patients with a grade higher than AJCC IIB who received anti-PD-1 therapy and were followed for at least 1.5 years (A). Figure 3 B); We found that USP51 was significantly overexpressed in unresponsive patients ( Figure 3 C and 3D, Wilcoxon rank-sum test p =0.00023, and was associated with poorer overall survival and progression-free survival. Figure 3 E and 3F, OS: log-rank test p =0.0426, PFS: log-rank test, p =0.0495).

[0051] To investigate the role of USP51 in melanoma and anti-tumor immune regulation, we knocked down USP51 in the mouse melanoma cell line B16F10. Figure 4 A), and then the USP51 knockdown cell line was inoculated into C57BL / 6 mice for research; compared with the control (shNC) group, the tumor volume and tumor weight of the USP51 knockdown tumor-bearing mice were significantly reduced ( Figure 4 BD); In addition, compared with the shNC group, the survival time of the shUSP51 group was prolonged ( Figure 4 E); The above results indicate that knocking down USP51 can inhibit tumor growth in melanoma-bearing mice and prolong mouse survival; Next, we performed flow cytometry and relative immune cell composition analysis. Compared with shNC, the number and percentage of CD8+ / CD3+ T cells and GZMB+CD8+ T cells infiltrating tumors in shUSP51 group mice were increased. Figure 4 (FG); In summary, these data indicate that USP51 depletion can increase cytotoxic CD8+ T cell activity and further suppress tumors.

[0052] The gene sequences used in the examples are as follows: shUSP51#1-mouse: 5'- TGGATTTGCCTGGGCCTTATA -3' (SEQ ID NO: 1) shUSP51#2-mouse:5'-GTCCTCATATTCCCTATAAAT-3' (SEQ ID NO:2) shcontrol-mouse: 5'-TTCTCCGAACTGTCACGT-3' (SEQ ID NO: 3). Example 3

[0053] USP51 regulates CD200 at the protein level. 3.1 Experimental Methods To further explore the potential function of USP51 in the tumor microenvironment, Spearman correlation analysis was performed on the expression levels of USP51 and inhibitory immune checkpoints in the Cancer Genome Atlas Cutaneous Melanoma Cohort (TCGA-SKCM), and the results were validated in human melanoma cells A375. The expression levels of USP51 and the screened immune checkpoint CD200 were detected in tumor samples from an internal melanoma cohort receiving anti-PD-1 therapy. The correlation between USP51 and CD200 protein levels in the self-tested anti-PD-1 treatment cohort was analyzed.

[0054] 3.2 Experimental Results To further elucidate the mechanisms by which USP51 affects the efficacy of immune checkpoint therapy and inhibits cytotoxic CD8+ T cell activity, we used a public skin melanoma database to screen for the correlation between USP51 expression levels and inhibitory immune checkpoints in tumor cells; the results showed that in the public melanoma cohort, USP51 was significantly positively correlated with CD200. Figure 5 A, Spearman rank correlation, TCGA-SKCM queue: R 2 =0.31, p =0.02;); In vitro, we knocked down USP51 in the A375 melanoma cell line using siRNA and examined 13 immune checkpoints; CD200 in siUSP51 was significantly reduced compared to the siNC group ( Figure 5 B); Furthermore, in our independent cohort of anti-PD-1 treatment, a positive correlation was observed between USP51 and CD200 at the protein level (B). Figure 5 C and 5D, R 2 =0.41, p=0.027); the results indicate that USP51 regulates the inhibitory immune checkpoint CD200 in melanoma; knockdown of USP51 reduces CD200 protein levels but does not alter CD200 mRNA levels in A375 cells ( Figure 5 E- Figure 5 F); the proteasome inhibitor MG132 blocked the decrease in CD200 protein levels caused by USP51 knockout (F); Figure 5 F); USP51 overexpression significantly increased CD200 protein levels (F); Figure 5 G); By measuring the half-life of endogenous CD200 in A375 cells by inhibiting protein synthesis with actinomycin (CHX), we found that knocking out USP51 significantly shortened the half-life of CD200 protein (G); Figure 5 H), while overexpression of USP51 prolonged its half-life (H). Figure 5 I); The above research results indicate that USP51 regulates CD200 at the protein level.

[0055] The sequences of USP51 small interfering RNA and short hairpin RNA are shown below: Control siRNA1: 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID NO:4) USP51-siRNA1: 5'-AUCUGAUAUGGAUCCAUGCTT-3' (SEQ ID NO5) USP51-siRNA2: 5'-UACCAGGAGUCUACUAAACTT-3' (SEQ ID NO: 6) Human shUSP51#1: 5'-GCATCTGATATGGATCCATGC-3' (SEQ ID NO:7) Human shUSP51#2: 5'-GCTACCAGGAGTCTACTAAAC-3' (SEQ ID NO:8).

[0056] The USP51-MYC overexpression plasmid sequence is shown below: The USP51-HA overexpression plasmid sequence is shown below: Example 4

[0057] Structure-based virtual screening identified bleomycin as an effective inhibitor targeting USP51. 4.1 Experimental Methods The USP51 protein structure was predicted using AlphaFold2, and the optimal binding site for USP51 was predicted using Schrödinger software. Molecular docking and analysis were then performed sequentially with a library of 10 diverse compounds, yielding a series of compounds with potential binding interactions with USP51. The top 15 selected compounds were used to treat human melanoma cells A375, and the levels of USP51 and CD200 were measured. Drugs capable of simultaneously reducing both USP51 and CD200 were then analyzed using bio-layer interference (BLI) to detect protein-drug binding interactions.

[0058] 4.2 Experimental Results Previous findings suggest that USP51 is a promising therapeutic target for regulating the inhibitory immune checkpoint CD200 in melanoma, thus necessitating the identification of a compound that can effectively inhibit USP51. We first performed a structure-based virtual screening of over 48,000 compounds from 10 compound libraries. Figure 6 A); Molecular docking analysis was performed, and among the top 15 compounds, tannic acid and bleomycin (BLM) ranked highest (XPG score, tannic acid: -15.616 kcal / mol; bleomycin: -13.769 kcal / mol), and molecular mechanical generalized Born surface area (MMGBSA, tannic acid: -51.58 kcal / mol; bleomycin: -42.41 kcal / mol) ( ). Figure 6 B); We treated A375 cells with the top 15 compounds at low (LD) and high (HD) doses and measured the protein levels of USP51 and CD200 in A375 cells after drug treatment; the results showed that bleomycin (S1214) significantly reduced the protein levels of USP51 and CD200 in a dose-dependent manner compared with the control group. Figure 6 C).

[0059] To further investigate whether bleomycin can bind to and stabilize the USP51 protein, the purified USP51 protein was biotinylated, and the interaction between the protein and bleomycin was measured using real-time BLI. We measured the binding kinetics of bleomycin to the purified USP51 protein by incubating the protein at different concentrations of bleomycin. Analysis yielded a dissociation constant (Kd) of 2.66 μM. Figure 6D); The above results indicate that bleomycin can directly bind to the USP51 protein, thereby exerting its anti-tumor effect.

[0060] Example 5 5. Bleomycin combined with PD-1 monoclonal antibody synergistically inhibits melanoma tumor growth. 5.1 Experimental Methods A375 cells were treated with bleomycin at concentrations of 2.5 μM and 5 μM. After 24 h, proteins were collected, and the levels of USP51 and CD200 proteins were measured. A375 cells were treated with DMSO (solvent control), 2.5 μM bleomycin, and 5 μM bleomycin, respectively. After 24 h, activated T cells were added, and the ability of T cells to kill tumor cells after bleomycin treatment was detected and analyzed.

[0061] Animal experimental group settings ( Figure 7 CF): DPBS (control group) Bleomycin (2 mg / kg) (low concentration group) Bleomycin (5 mg / kg) (high concentration group) Animal experimental group settings ( Figure 7 GK): IgG2a (control group) Bleomycin (5 mg / kg) Anti-PD-1 antibody Bleomycin (5 mg / kg) + anti-PD-1 antibody Animal experimentation procedures Approximately 6 days before the experiment: 6-8 week old C57BL / 6 mice were subcutaneously injected with 5*10 cells of B16F10 melanoma cell line into the right dorsal wing. 5 Each group consisted of 6 mice.

[0062] Day 0 of the experiment: Record mouse body weight and tumor volume. When the tumor volume grows to 50-100 mm... 3 Initially, the tumor-forming mice were treated with drugs, as follows: Figure 5 C and Figure 5 G. Bleomycin was administered via tail vein every other day for a total of 5 doses; anti-PD-1 antibody was administered via intraperitoneal injection every 2 days for a total of 3 doses. A solvent control group was also included. There were a total of 3 groups, with 6 mice in each group.

[0063] On days 3, 6, 9, and 12 of the experiment: the weight of the mice and the volume of the tumor were measured every two days. The volume was calculated using the formula (length × width × width × π) / 6.

[0064] Day 12 of the experiment: Mice were sacrificed, tumors were photographed and tissue samples were preserved, and cell membrane proteins and intracellular markers were stained and analyzed.

[0065] 5.2 Experimental Results To verify the antitumor effect of bleomycin by inhibiting USP51 and CD200, we selected 2.5 and 5.0 μmol / L as the low-dose (LD) and high-dose (HD) concentrations of bleomycin for subsequent experiments. We found that compared with the control group, bleomycin significantly inhibited the protein levels of USP51 and CD200 in A375 cells. Figure 7 A); To further elucidate the mechanism by which bleomycin enhances T cell activity, we conducted a T cell killing assay; the results showed that bleomycin treatment significantly enhanced T cell activity and cytotoxicity, exhibiting a clear dose-dependent effect (A). Figure 7 B); Subsequently, we inoculated B16F10 mouse melanoma cells into C57BL / 6 mice and treated them every two days with bleomycin at 2 mg / kg (LD) and 5 mg / kg (HD) via tail vein injection. Figure 7 C); Tumors were harvested and analyzed on day 12; compared with the control group, the tumor volume and tumor weight of the LD and HD groups treated with bleomycin were significantly reduced ( Figure 7 D- Figure 7 E); Flow cytometry revealed significant T cell activation in the high-dose bleomycin treatment group; relative immune cell composition analysis revealed an increase in the percentage of CD8+ T cells and GZMB+CD8+ T cells, indicating that bleomycin enhanced the activity and cytotoxicity of CD8+ T cells in vivo. Figure 7 F); In summary, bleomycin can effectively target USP51 and further inhibit the inhibitory immune checkpoint CD200, reversing the inhibitory state of CD8+ T cells in the tumor microenvironment; Recently, combination therapy with PD-1 monoclonal antibodies and other drugs has been shown to enhance anti-tumor responses and significantly improve the efficacy of immune checkpoint blockade. Given our previous observation that bleomycin can promote CD8+ T cell activation by inhibiting USP51 and CD200, we selected PD-1 monoclonal antibodies and bleomycin for combination therapy in a C57BL / 6 mouse model with B16F10 tumor formation. We selected tumors similar in size to those in the IgG2a-treated group (control group) for PD-1 monoclonal antibody and / or bleomycin treatment, and administered bleomycin (5 mg / kg) every 2 days and / or PD-1 monoclonal antibody every 3 days. Figure 7G); Tumors were collected and analyzed on day 12; Compared with the single treatment group and the control group, the tumor volume and tumor weight of the bleomycin and PD-1 monoclonal antibody combination therapy group were significantly reduced (G); Figure 7 H- Figure 7 J); In immunofluorescence staining of tumor tissues, the combination of bleomycin and PD-1 monoclonal antibody showed lower protein levels of USP51 and CD200 and significantly enhanced CD8+ T cell infiltration compared to other groups. Figure 7 In summary, these results indicate that the combined use of bleomycin and PD-1 monoclonal antibody can significantly promote CD8+ T cell infiltration and inhibit melanoma tumor growth.

[0066] Example 6 6. Liposome encapsulation of bleomycin reduces adverse reactions associated with combination therapy. 6.1 Experimental Methods Bleomycin liposomes were synthesized using a thin-film dispersion method, and their particle size, potential, and stability under simulated physiological conditions were examined.

[0067] Bleomycin liposomes were labeled with RhB, and the uptake of liposomes by A375 cells was detected by immunofluorescence. Bleomycin liposomes were labeled with ICG, and the uptake and release of liposomes in mice were detected by in vivo imaging in mice.

[0068] Animal experimental group settings: IgG2a (control group) Bleomycin (5 mg / kg) + IgG2a Bleomycin (5 mg / kg) + anti-PD-1 antibody Bleomycin liposomes (5 mg / kg) + IgG2a Bleomycin liposomes (5 mg / kg) + anti-PD-1 antibody Animal experimentation procedures Approximately 6 days before the experiment: 6-8 week old C57BL / 6 mice were subcutaneously injected with 5*10 cells of B16F10 melanoma cell line into the right dorsal wing. 5 Each group consisted of 6 mice.

[0069] Day 0 of the experiment: Record mouse body weight and tumor volume. When the tumor volume grows to 50-100 mm... 3Initially, the tumor-forming mice were treated with drugs: bleomycin liposomes were administered via tail vein every other day for a total of 5 doses; anti-PD-1 antibody was administered via intraperitoneal injection every 2 days for a total of 3 doses. A solvent control group was also included. There were three groups in total, with 6 mice in each group.

[0070] On days 3, 6, 9, and 12 of the experiment: the weight of the mice and the volume of the tumor were measured every two days. The volume was calculated using the formula (length × width × width × π) / 6.

[0071] Day 12 of the experiment: Venous blood was collected from mice for further analysis. Mice were sacrificed, and tumor tissue samples were obtained. Cell membrane proteins and intracellular markers were stained and further analyzed. Liver, lung, and kidney tissue samples from mice were obtained and subjected to HE staining, immunohistochemistry, and immunofluorescence staining and analysis.

[0072] 6.2 Experimental Results Preparation of liposomes: Liposomes@BLM (liposome-encapsulated bleomycin) was synthesized using a thin-film dispersion method: Lipid components, including dipalmitoylphosphatidylcholine (DPPC) and phosphatidylethanolamine-polyethylene glycol 2000-biotin (DSPE-mPEG2000) in a mass ratio of 4–8:1, were dissolved in a chloroform:methanol 5:1 solution. After complete dissolution, the organic solvent was evaporated by rotary evaporation in a 60°C water bath, forming a semi-transparent, uniform film. Then, under ultrasonication, an appropriate amount of ice water (or a 1.5 mg / mL solution of bleomycin, indocyanine green (ICG), or rhodamine B (RhB) solution) was added for hydration, and the nanoliposomes were collected. After purification by ultrafiltration centrifugation, they were stored at 4°C. The preparation method for bleomycin-loaded liposomes@BLM differed slightly from that for blank liposomes. After forming a semi-permeable membrane, 5 mL of a 1.5 mg / mL bleomycin aqueous solution was added under ultrasonication. After purification by ultrafiltration, the liposomes were stored at 4°C. They were then hydrated with DPBS containing indocyanine green (ICG) or rhodamine B (RhB). After liposome preparation, the liposomes were homogenized by sonication. The prepared liposomes@BLM were stored at 4°C protected from light for later use.

[0073] The concentration of BLM in liposomes was quantified by high performance liquid chromatography (UPLC), and the specific method is as follows; (1) The liposomes@BLM solution to be tested was prepared with chromatographic grade methanol in a 1:2 ratio, sonicated for 20 min to demulsify and release free BLM, filtered with a 0.22 μm nylon membrane filter and placed in an ampoule.

[0074] (2) Prepare BLM single drug diluent with pure water and chromatographic grade methanol in a ratio of 4:1. Dilute the BLM stock solution to prepare working solutions with different gradients such as 0, 0.0125, 0.025, 0.05, 0.1, and 0.2 mg / mL for plotting standard curves. Filter the solution with a 0.22 μm nylon membrane filter and place it in an HPLC measurement bottle.

[0075] (3) Prepare 1000 mL bottles of 0.1% TFA ultrapure water and chromatographic grade methanol. Loosen the caps of each bottle and place them in an ultrasonic machine for 30 min to remove air bubbles.

[0076] (4) After sonication, connect the solvent to the UPLC instrument, connect pump A to the aqueous phase and pump B to the organic phase. After reducing the pressure of the UPLC machine to 0, adjust the solvent flow rate to 1 mL / min to flush the pipeline in the UPLC instrument and further remove the gas in the pipeline. This process lasts for 30 min.

[0077] (5) After the baseline is leveled, adjust the flow rate to 0.1 mL / min and restore the normal pressure value. The ratio of organic phase (methanol) to water phase is 1:4, the ultraviolet wavelength is 280 nm, the temperature is 25℃, and the process generally takes 5 min. Measure the BLM content in BLM single drug solution and liposome solution according to the above procedure.

[0078] In clinical practice, bleomycin cannot be widely used due to its numerous adverse reactions, especially in the lungs. Therefore, we encapsulate bleomycin in liposomes to improve its drug delivery efficiency and safety. Figure 8 A); Transmission electron microscopy (TEM) images showed that the bleomycin liposomes were uniformly spherical (liposomes@BLM), and the particle size of liposomes@BLM was detected as 125.39 nm by dynamic light scattering (DLS). Figure 8 B), suitable for drug delivery applications; meanwhile, the potentials of liposomes and liposomes@BLM are approximately -7mV and -6mV, respectively, which contributes to their stability in the physiological environment and avoids large charge gradients during treatment. Figure 8 C); Particle size was assessed at different specified time points, and the results showed that the liposomes were relatively stable ( Figure 8 D); The fluorescence signal of RhB was observed to increase over time in A375 cells, indicating that A375 cells can take up liposomes@BLM in a time-dependent manner. Figure 8 E); ICG-labeled liposomes@BLM was administered to B16F10 tumor-bearing mice via tail vein. The fluorescence intensity at the tumor site gradually increased over time, and compared with free ICG, liposomes@BLM remained at a high level 48 hours after injection. Figure 8 F) indicates that liposomes@BLM has a sustained-release effect.

[0079] Subsequently, we verified the efficacy of the combination therapy; the results showed that, compared with other control groups, the tumor volume and tumor weight were significantly reduced in the liposomes@BLM combined with PD-1 monoclonal antibody group, indicating that liposomes@BLM and PD-1 monoclonal antibody have a synergistic effect. Figure 8 GI had no significant effect on mouse body weight. Figure 8 J); Flow cytometry revealed that the combined use of liposomes@BLM and PD-1 monoclonal antibody significantly activated CD8+ T cells, and relative immune cell composition analysis showed an increase in the percentage of CD8+ T cells and GZMB+CD8+ T cells in the combination therapy group (J); Figure 9 A); H&E staining, histochemistry, and fluorescence staining (fibronectin, type I collagen, and α-SMA) showed that liposome encapsulation helped reduce bleomycin-induced pulmonary fibrosis. Figure 9 In summary, compared with conventional formulations, liposome-based bleomycin enhanced therapeutic efficacy, increased bleomycin-mediated CD8+ T cell activation, and significantly improved safety when used in combination with PD-1 monoclonal antibodies.

[0080] The above description is a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and concept of the present invention, should be covered within the scope of protection of the claims of the present invention.

Claims

1. Application of reagents for detecting USP51 expression levels in the preparation of a detection kit for PD-L1 / PD-1 monoclonal antibody tumor immunotherapy drugs, wherein the tumor is melanoma.

2. Application of USP51 inhibitors in the preparation of drugs for treating melanoma, wherein the tumor is melanoma.

3. The application of USP51 inhibitors in combination with PD-L1 / PD-1 monoclonal antibody drugs in the preparation of drugs for treating melanoma, wherein the tumor is melanoma.

4. The application according to claim 2 or 3, characterized in that, The inhibitors of USP51 include shUSP51 and siUSP51.

5. The application according to claim 2 or 3, characterized in that, The inhibitors of USP51 are shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:

8.

6. Application of CD200 inhibitors in combination with PD-L1 / PD-1 monoclonal antibody drugs in the preparation of drugs for treating melanoma.

7. The application of USP51-CD200 axis inhibitors in combination with PD-L1 / PD-1 monoclonal antibody drugs in the preparation of tumor immunotherapy drugs, wherein the tumor is melanoma.

8. The application of bleomycin in combination with PD-L1 / PD-1 monoclonal antibody in the preparation of a drug for treating melanoma, wherein the bleomycin is liposome-encapsulated bleomycin.

9. The application according to claim 7, characterized in that, The method for preparing bleomycin encapsulated in liposomes includes the following steps: Synthesized using a thin-film dispersion method: The lipid components were dissolved in a chloroform:methanol solution of (4-6):

1. The lipid components were dipalmitoylphosphatidylcholine, phosphatidylethanolamine-polyethylene glycol 2000-biotin in a mass ratio of (4-8):

1. After complete dissolution, the organic solvent was evaporated in a water bath at 60-70℃ to form a semi-transparent and uniform film. Then, 5-10 mL of bleomycin aqueous solution (1.5 mg / mL-1.8 mg / mL) was added under ultrasonication. After purification by ultrafiltration, the film was stored at 0-4℃. Then, it was hydrated with DPBS containing indocyanine green or rhodamine B. The liposomes were then homogenized by ultrasonication. The resulting liposomes@BLM were stored at 0-4℃ in the dark for later use.

10. The application according to claim 8, characterized in that, The concentration of liposomes@BLM is 1.3 mg / mL-1.5 mg / mL.

Citation Information

Patent Citations

  • Bispecific antibody targeting CD47 and PD-L1 and application thereof

    CN116496404A

  • Application of bleomycin as immunopotentiator

    CN121003685A

  • Identification and elimination of damaged and / or senescent cells

    US20200123607A1

  • Protein degraders and uses thereof

    WO2024092009A1

  • Compositions for treating immune checkpoint blockade therapy resistant cancers

    WO2024123175A1