Monascus purpureus as well as fungicide and application thereof
By screening and applying Monascus purpureus LQ-Q1 in baijiu brewing, the problem of the single function of existing strains has been solved, and the yield and quality of base liquor have been improved. In particular, inoculating Monascus purpureus in the medium-temperature daqu mixing process produces a variety of flavor substances, which improves the yield and flavor of baijiu.
Patent Information
- Application Number
- CN202511146577.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-15
- Publication Date
- 2025-11-18
AI Technical Summary
Existing Monascus strains have limited functions in baijiu brewing, making it difficult to simultaneously improve the yield and quality of base liquor and thus failing to meet comprehensive requirements.
A strain of Monascus purpureus LQ-Q1 was screened and isolated, with the preservation number CCTCC NO: M 2024666. By applying its fermentation liquid or cells during the brewing process of Baijiu, especially in the inoculation stage of medium-temperature Daqu mixing, a variety of flavor substances were produced and the quality of the base liquor was improved.
It increases the variety and content of flavor compounds in the base liquor, thereby enhancing the yield and overall quality of baijiu, specifically manifested in increased alcohol yield and increased flavor compounds.
Smart Images

Figure CN120966646A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bio-fermentation technology, specifically relating to a strain of Monascus purpureus, its inoculant, and its applications. Background Technology
[0002] As one of the world's four major distilled spirits, Chinese Baijiu is beloved by consumers for its unique craftsmanship and style. Baijiu contains various trace aroma components, primarily derived from the catalytic reactions of microorganisms and enzymes during fermentation, chemical changes during storage, and chemical reactions of the special components of the raw materials. A wide variety of microorganisms participate in Baijiu brewing, mainly including molds, yeasts, and bacteria. Different microorganisms produce different enzymes through metabolic pathways, catalyzing the production of alcohol, or esters, alcohols, and other aroma components from raw materials and related substances. Research indicates that substances produced by microbial metabolism are one of the main sources of aroma components in Baijiu.
[0003] Among numerous microorganisms, *Monascus purpureus* produces a variety of enzyme systems, including amylase, protease, and esterase, which play a crucial role in baijiu (Chinese liquor) brewing. Currently, most research focuses on identifying *Monascus purpureus* strains with specific enzyme system advantages. For example, CN110317734A discloses a *Monascus purpureus* strain that produces high levels of saccharifying enzymes, esterases, and proteases, along with its isolation, cultivation methods, and applications. This strain can improve the yield of baijiu. CN110903983A discloses a *Monascus purpureus* strain that produces high levels of saccharifying and esterifying enzymes and its applications; the resulting koji (red yeast rice) exhibits high saccharifying and esterifying enzyme activity. CN119530022A discloses a new *Monascus purpureus* strain and its uses. This strain, used in the preparation of bran koji, daqu (large koji), and fortified daqu, can produce high levels of various brewing hydrolytic enzymes; moreover, under simulated fermentation conditions, it can produce various flavor compounds such as phenylethanol, isoamyl alcohol, and phenylacetaldehyde.
[0004] However, existing Monascus purpureus strains often exhibit advantages only in one or a few aspects, such as increasing alcohol yield, enhancing specific enzyme functions, or improving flavor. Existing strains with single or limited functional advantages are insufficient to fully meet the comprehensive needs for improving the yield and quality of base liquor. Therefore, addressing the issue of relatively singular functions in existing Monascus purpureus strains, this study utilizes modern microbiological techniques to screen for strains with more comprehensive brewing functions. After pure culture, these strains can be applied to baijiu (Chinese liquor) brewing, which has significant research value and practical implications for improving the yield and overall quality of base liquor. Summary of the Invention
[0005] To enrich microbial resources, this invention screens and isolates a strain of Monascus purpureus with high alcohol and ester production capacity and capable of producing a variety of flavor substances from Luzhou Laojiao mash, and explores its applications.
[0006] To achieve the above-mentioned objectives, the technical solution adopted in this application is as follows:
[0007] In a first aspect, this invention provides a strain of *Monascus purpureus*, which was deposited on April 11, 2024, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University Collection Center, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, 430072, China. The accession number is CCTCC NO: M 2024666, and the strain is named *Monascus purpureus* LJ-Q1.
[0008] The ITS rDNA sequence of the aforementioned Monascus purpureus is shown in SEQ ID NO:1.
[0009] Among them, the colony characteristics of the aforementioned Monascus purpureus are white or light pink and fluffy.
[0010] Secondly, the present invention provides a method for screening, isolating and identifying the aforementioned Monascus purpureus, comprising the following steps: preparing a sample bacterial suspension from Luzhou Laojiao mash, first culturing colonies on malt extract agar medium, then inoculating the colonies into new malt extract agar medium using the streak plate method for multiple generations of culture until all single colonies are purified, then inoculating the purified strains into malt extract slant medium for culture, and identifying the Monascus purpureus by combining morphological, physiological and biochemical characteristics and / or molecular biology.
[0011] The malt extract agar medium consists of: 30.0 g / L malt extract, 5.0 g / L peptone, and 18.0 g / L agar.
[0012] The culture temperature is 28–30°C, and the culture time is 7–9 days.
[0013] Thirdly, the present invention provides a microbial agent containing the fermentation broth, seed liquid, or bacterial cells of the aforementioned Monascus purpureus; wherein the bacterial cells are live cells or dried bacterial cells of Monascus purpureus.
[0014] Fourthly, the present invention provides the application of the above-mentioned Monascus purpureus or microbial agents in the preparation of brewing starter, wherein the brewing starter includes at least one of wheat starter, large starter, small starter, bran starter, red starter, and fortified large starter.
[0015] Fifthly, the present invention provides the application of the above-mentioned Monascus purpureus or microbial agents in the brewing of baijiu, wherein the baijiu is at least one of the following types: soy sauce aroma, strong aroma, light aroma, rice aroma, and mixed aroma.
[0016] Sixthly, the present invention provides the application of the above-mentioned Monascus purpureus or microbial inoculants in the production of flavor substances: the flavor substances include: ethanol, isobutanol, n-butanol, isoamyl alcohol, n-pentanol, 2-heptanol, octanol, 1-octen-3-ol, n-heptanol, 2-ethylhexanol, 2-nonyl alcohol, 1-nonanol, furfuryl alcohol, cis-3-nonen-1-ol, 2-undecyl alcohol, trans-nerolidol, benzyl alcohol, phenethyl alcohol, 3-phenylpropanol, ethyl acetate, ethyl thiocarboxylate, ethyl octanoate, ethyl 3-methylpyrazole-4-carboxylate, ethyl nonanoate, ethyl 2-furfurylate, ethyl decanoate, ethyl benzoate, propyl benzoate, ethyl phenylacetate, isobenzoic acid... The following are included in the following list: butyl acetate, phenethyl acetate, 3-hydroxy-2,2,4-trimethylpentyl 2-methylpropionic acid, 2,2,4-trimethyl-1,3-pentanediol diisobutyrate, ethyl palmitate, cis-4-hydroxy-6-dodecenoic acid lactone, ethyl transoleate, octanoic acid, nonanoic acid, benzoic acid, acetophenone, 3-tert-butyl-2-pyrazolino-5-one, orange acetone, 2,6-di(tert-butyl)-4-hydroxy-4-methyl-2,5-cyclohexen-1-one, octadecylcyclononoxysiloxane, o-cresol, 2,4-di-tert-butylphenol, 4-methoxystyrene, 3,4-dimethoxystyrene, p-hydroxystyrene, and coconut aldehyde.
[0017] In a seventh aspect, the present invention provides a method for producing flavor substances using the above-mentioned Monascus purpureus or microbial agents: Monascus purpureus or microbial agents are activated, then inoculated into malt extract liquid culture medium to obtain a bacterial suspension, and then the bacterial suspension is inoculated into sorghum liquid culture medium to produce a variety of flavor substances;
[0018] The flavoring substances include: ethanol, isobutanol, n-butanol, isoamyl alcohol, n-pentanol, 2-heptanol, octanol, 1-octen-3-ol, n-heptanol, 2-ethylhexanol, 2-nonyl alcohol, 1-nonyl alcohol, furfuryl alcohol, cis-3-nonen-1-ol, 2-undecyl alcohol, trans-nerolidol, benzyl alcohol, phenethyl alcohol, 3-phenylpropanol, ethyl acetate, ethyl thiocarboxylate, ethyl octanoate, ethyl 3-methylpyrazole-4-carboxylate, ethyl nonanoate, ethyl 2-furfurylate, ethyl decanoate, ethyl benzoate, propyl benzoate, ethyl phenylacetate, isobutyl benzoate, ethyl phenylacetate, 3-hydroxymethyl 2-propionic acid. The following are at least one of the following: 2,2,4-trimethylpentyl ester, 2,2,4-trimethyl-1,3-pentanediol diisobutyrate, ethyl palmitate, cis-4-hydroxy-6-dodecenoic acid lactone, ethyl transoleate, octanoic acid, nonanoic acid, benzoic acid, acetophenone, 3-tert-butyl-2-pyrazolino-5-one, orange acetone, 2,6-di(tert-butyl)-4-hydroxy-4-methyl-2,5-cyclohexen-1-one, octadecylcyclononoxysiloxane, o-cresol, 2,4-di-tert-butylphenol, 4-methoxystyrene, 3,4-dimethoxystyrene, p-hydroxystyrene, and coconut aldehyde.
[0019] The bacterial activity of the bacterial suspension is 10. 5 ~10 6 The inoculum concentration was CFU / mL, the inoculum size was 3-5% (v / v), the culture temperature was 30℃, and the culture time was 9-11 days.
[0020] Eighthly, the present invention provides the application of the above-mentioned Monascus purpureus or microbial inoculants in increasing the content of flavor substances in base liquor: the flavor substances include at least one of 3-hydroxy-2-butanone, 2-ethoxy-5-methylfuran, n-hexanol, ethyl decanoate, valeric acid, ethyl laurate, and octanoic acid.
[0021] Ninthly, the present invention provides a method for increasing the content of flavor substances in base liquor using the above-mentioned Monascus purpureus or microbial agents: in the medium-temperature Daqu mixing stage, Monascus purpureus or microbial agents are inoculated onto the wheat, and then produced according to the medium-temperature Daqu preparation process to obtain fortified Daqu; the fortified Daqu is used in Baijiu brewing, and brewing Daqu and fortified Daqu are added in the spreading and adding stage to ferment, thereby obtaining base liquor with increased flavor substance content;
[0022] The flavor compounds include at least one of the following: 3-hydroxy-2-butanone, 2-ethoxy-5-methylfuran, n-hexanol, ethyl decanoate, valeric acid, ethyl laurate, and caprylic acid.
[0023] The inoculation amount of the red yeast or microbial agent is 3-5% of the dry weight of the wheat; the total addition amount of the brewing koji and the fortified koji is 10-20% of the weight of the grain, and the mass ratio of the brewing koji and the fortified koji is 1:10.
[0024] Beneficial Effects: This invention isolates a strain of *Monascus purpureus* from Luzhou Laojiao mash, with accession number CCTCC NO: M 2024666. The *Monascus purpureus* LQ-Q1 provided by this invention has high alcohol and ester production capabilities, and can utilize sorghum for fermentation and metabolism, producing a variety of flavor compounds. Simultaneously, using *Monascus purpureus* LQ-Q1 to prepare fortified koji (fermentation starter culture) and applying it to baijiu brewing can increase the variety and content of flavor compounds in the resulting base liquor, thereby improving the quality and yield of the base liquor.
[0025] The *Monascus purpureus* provided by this invention was deposited on April 11, 2024, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University Collection Center, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, 430072, China. The accession number is CCTCC NO: M 2024666, and the name is *Monascus purpureus* LJ-Q1. Attached Figure Description
[0026] Figure 1 Morphological characteristics of Monascus purpureus LJ-Q1 on malt extract agar and PDA agar;
[0027] Wherein, a represents the morphological characteristics of LJ-Q1 cells on malt extract agar medium, and b represents the morphological characteristics of LJ-Q1 cells on PDA agar medium;
[0028] Figure 2 Microscopic observation of Monascus purpureus LJ-Q1 after 7 days of culture;
[0029] Figure 3 A phylogenetic tree of Monascus purpureus strain LJ-Q1 was constructed based on ITS sequencing.
[0030] Figure 4 This is a growth curve of Monascus purpureus LJ-Q1.
[0031] Figure 5 The figure shows the temperature tolerance results of Monascus purpureus LJ-Q1. Detailed Implementation
[0032] To make the technical problems, solutions, and beneficial effects of this application clearer, the following detailed description is provided in conjunction with the embodiments. Unless otherwise defined, all technical terms used herein have the same meaning as understood by one of ordinary skill in the art.
[0033] In one embodiment of the present invention, a strain of *Monascus purpureus* was screened, isolated, and identified from Luzhou Laojiao mash, with accession number CCTCC NO: M 2024666. It was deposited on April 11, 2024, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University Collection Center, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, 430072, China. It was named *Monascus purpureus* LJ-Q1.
[0034] Molecular biological identification revealed that the ITS rDNA sequence of the aforementioned Monascus purpureus is shown in SEQ ID NO:1.
[0035] The ITS rDNA sequence of Monascus purpureus LJ-Q1 (SEQ ID NO:1) is as follows:
[0036] GGGGGCGGGCATCCTACCTGATCCGAGGTCACCTAAGGAAAAAAGGTTGGAGAGG
[0037] GCAAAGGCCCCGGCCCGACCTACTGAGCGGGTGACAAAGCCCCATACGCTCGAGGACC
[0038] GGACGCGGCGCCGCCACTGCCTTTCGGGCCCGTCCCCGTTGCCCGGAGGCGCAGGGGA
[0039] CGGCGGCCCAACACACAAGCCGCGCTTGAGGGGCAGTAATGACGCTCGGACAGGCATG
[0040] CCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCT
[0041] GCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGAT
[0042] CCGTTGTTGAAAGTTTTAACCGATTTGGTATGTTTACTCAGACAGCAATCCTTTTCAAAG
[0043] ACAGCGTTCGAGAAGATGTCTCCGGCGGGCCCCAGGGGGCCGCGCCGAAGCAACAGG
[0044] AGGTACAATAATCACGGGGTGGGAGGTTGGGTCCCACGAAGGGGACCCGCACTCGGTAA
[0045] TGATCCCTCCGGCAGATTCACCTACGGAAGA.
[0046] Among them, the colony characteristics of the aforementioned Monascus purpureus on malt extract agar medium are white or light pink fluffy.
[0047] The malt extract agar medium consists of: 30g malt extract, 5g peptone, 18g agar, 1000mL deionized water, natural pH, sterilized at 121℃ and 0.1MPa for 15min.
[0048] In some embodiments of the present invention, a microbial agent is prepared, which contains the fermentation broth, seed liquid or cell of Monascus purpureus mentioned above; the cell is a live cell or a dry cell of Monascus purpureus.
[0049] In one embodiment of the present invention, the above-mentioned Monascus purpureus or microbial inoculant is inoculated into a sorghum liquid culture medium and cultured, which can metabolize and produce a variety of flavor substances, including ethanol, isobutanol, n-butanol, isoamyl alcohol, n-pentanol, 2-heptanol, octanol, 1-octen-3-ol, n-heptol, 2-ethylhexanol, 2-nonyl alcohol, 1-nonanol, furfuryl alcohol, cis-3-nonen-1-ol, 2-undecyl alcohol, trans-nerolidol, benzyl alcohol, phenethyl alcohol, 3-phenylpropanol, ethyl acetate, ethyl thiocyanate, ethyl octanoate, ethyl 3-methylpyrazole-4-carboxylate, ethyl nonanoate, ethyl 2-furfurylate, ethyl decanoate, ethyl benzoate, propyl benzoate, and ethyl phenylacetate. Isobutyl benzoate, phenethyl acetate, 3-hydroxy-2,2,4-trimethylpentyl 2-methylpropionic acid, 2,2,4-trimethyl-1,3-pentanediol diisobutyrate, ethyl palmitate, cis-4-hydroxy-6-dodecenoic acid lactone, ethyl transoleate, octanoic acid, nonanoic acid, benzoic acid, acetophenone, 3-tert-butyl-2-pyrazoline-5-one, orange acetone, 2,6-di(tert-butyl)-4-hydroxy-4-methyl-2,5-cyclohexen-1-one, octadecylcyclononoxysiloxane, o-cresol, 2,4-di-tert-butylphenol, 4-methoxystyrene, 3,4-dimethoxystyrene, p-hydroxystyrene, coconut aldehyde.
[0050] In one embodiment of the present invention, since the aforementioned Monascus purpureus or microbial agents can metabolize and produce a variety of flavor substances, including many important flavor substances found in baijiu (Chinese white liquor) or yeast starters, they have wide applications in baijiu brewing or yeast starter preparation. Specifically, the baijiu brewing includes at least one of the following: soy sauce aroma type, strong aroma type, light aroma type, rice aroma type, and mixed aroma type; the yeast starter includes at least one of the following: wheat yeast starter, daqu (large yeast starter), xiaoqu (small yeast starter), bran yeast starter, red yeast starter, and fortified daqu starter.
[0051] In one embodiment of the present invention, during the mixing stage of medium-temperature Daqu (a type of starter culture), Monascus purpureus or a microbial agent is inoculated onto the wheat feed at a rate of 3-5% of the dry weight of the wheat feed. Then, the Daqu is produced according to the medium-temperature Daqu preparation process to obtain fortified Daqu. Alternatively, Monascus purpureus or a microbial agent is activated and then inoculated into a malt extract liquid culture medium to obtain a bacterial suspension (with a bacterial activity of 10). 5 ~10 6 The bacterial suspension was then inoculated onto the wheat feed at a rate of 3–5 L / 100 kg of dry wheat feed. The feed was then processed according to the medium-temperature Daqu preparation process to obtain fortified Daqu.
[0052] In one embodiment of the present invention, the process of using the above-mentioned fortified koji for brewing baijiu to prepare base liquor with improved flavor content is as follows: (1) Crushing: The sorghum after impurity removal is fed into a crusher and crushed. The crushing degree is preferably less than 30% passing through a 20-mesh sieve. (2) Moistening: The water temperature for moistening the grain is above 85℃. The amount of water added is 55% to 60% of the weight of the sorghum powder. After adding water, stir thoroughly so that the raw materials absorb an appropriate amount of water, which is convenient for gelatinization. (3) Steaming: The steaming time is 35 to 50 minutes. After steaming, the grains are not raw in the center and are cooked but not sticky, which is conducive to starch gelatinization and subsequent fermentation. (4) Spreading and adding koji: Select a mass ratio of grain to mash of 1:1.8 to 1:2.5. Cool the mash after distillation and the steamed grains, mix them evenly, and add a well mixed koji (brewing koji + fortified koji, mass ratio of 1:10). The amount of koji added is 10 to 20% of the weight of the grains. (5) Fermentation: The fermented mash after spreading and adding yeast is transferred to a stainless steel fermentation tank for sealed fermentation. The fermentation cycle is 15-25 days. (6) Distillation: The fermented mash in the mobile cellar is taken out, and an appropriate amount of rice husk is added according to the fermentation status of the mash and mixed evenly. The mash is then placed in a still for distillation to obtain base liquor with improved flavor substances and content. Specifically, the newly added flavor substances include at least one of 3-hydroxy-2-butanone, 2-ethoxy-5-methylfuran, n-hexanol, ethyl decanoate, valeric acid, ethyl laurate, and octanoic acid. The flavor substances with improved content include at least one of ethyl acetate, acetal, ethyl isobutyrate, tert-amyl alcohol, sec-butanol, ethyl butyrate, isobutanol, sec-amyl alcohol, n-butanol, isoamyl alcohol, n-amyl alcohol, ethyl octanoate, acetic acid, furfural, propionic acid, ethyl nonanoate, butyrate, isovaleric acid, furfuryl alcohol, β-phenylethanol, ethyl palmitate, and ethyl oleate.
[0053] The following specific embodiments will be provided to explain the solution of the present invention. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.
[0054] The culture medium formulation and preparation method involved in the examples are as follows:
[0055] Malt extract agar / slant culture medium: 30g malt extract, 5g peptone, 18g agar, 1000mL deionized water; autoclave at 121℃ for 15min.
[0056] Malt extract liquid culture medium: 30g malt extract, 5g peptone, 1000mL deionized water; autoclave at 121℃ for 15min.
[0057] PDA agar medium: 6g potato extract powder, 20g glucose, 20g agar, 1000mL deionized water; autoclave at 115℃ for 20min.
[0058] Sorghum liquid culture medium: After pulverizing 200g of sorghum sample, add 4 times the weight of water of sorghum, cook for 3h until it becomes a paste, cool and add 50 units / g of saccharifying enzyme, keep at 30℃ for 4h, filter the filtrate, and adjust the sugar content to 12°Bx with distilled water.
[0059] The specific method for determining volatile products using headspace solid-phase microextraction (HS-SPME) and gas chromatography-mass spectrometry (GC-MS) is as follows: 5 mL of sample is added to a headspace vial, along with 2 g NaCl and 10 μL of internal standard (0.822 g / L 2-octanol). After equilibration at 60 °C for 5 min, the sample is extracted at 60 °C for 50 min using a 50 / 30 μm DVB / CAR / PDMS extraction head. Following extraction, desorption is performed at 250 °C for 5 min at the GC inlet. Using 0.822 g / L 2-octanol as the internal standard, the compound search results are matched with the NIST standard spectral library. Compounds with a similarity of 80% or higher are confirmed as target compounds.
[0060] GC-MS detection chromatographic conditions:
[0061] Gas chromatography conditions: HP INNOWAX column (60m×0.25mm×0.25μm); temperature program: initial temperature 40℃, hold for 5 min, increase to 100℃ at 4℃ / min, then increase to 230℃ at 6℃ / min, hold for 10 min; carrier gas is high-purity helium (1.0mL / min); injection port temperature 250℃, splitless.
[0062] Mass spectrometry conditions: electron ionization source, electron energy 70 eV; electron multiplier voltage 350 V; ion source temperature 230 °C; transfer line temperature 250 °C; mass range 40–450 m / z.
[0063] Example 1: Isolation and Identification of Strains
[0064] (1) Strain Isolation: Using Luzhou Laojiao fermented mash as raw material, 10g of fermented mash was placed in a 500mL Erlenmeyer flask containing sterile glass beads and 90mL of physiological saline and mixed thoroughly. 1mL of the supernatant was then extracted and added according to a gradient (10... -1 10 -2 10 -3 10 -4 10 -5 10 -6 ) diluted, and 10 were prepared respectively. -1 10 -2 10 -3 10-4 10 -5 10 -6 Dilute the solution; take 200 μL of each dilution and spread it onto malt extract agar medium, incubate at 30°C until colonies appear. Inoculate the colonies into fresh malt extract agar medium using the streak plate method for multiple generations until no other visible microorganisms interfere with the cultured colonies. Refer to the *Handbook of Fungal Identification* to observe the colony morphology of individual bacteria; select single colonies with a white or light pink fluffy appearance, inoculate them onto malt extract slant agar medium, incubate at 30°C for 7 days, and then store the purified strain on malt extract slant agar medium at 4°C.
[0065] The strains were inoculated onto malt extract agar and PDA agar media, respectively, and incubated at 30°C to observe their macroscopic morphology. Initially, both strains were milky white or light red; after maturity, their morphology resembled... Figure 1 As shown. Among them, Figure 1 (a) shows the morphology of LJ-Q1 cells after maturation on malt extract agar medium. The cells are dark red with the dark red pigment spreading on the back. The hyphae are velvety and wrinkled with dry edges. Figure 1 (b) shows the cell morphology of LJ-Q1 after maturation on PDA agar medium, which is orange-red.
[0066] The microstructure of the strain is as follows Figure 2 As shown: The strain produces conidia, the cells contain granules when young, the fungal body has conidiophores, and the hyphae have septa and are filamentous.
[0067] (2) Strain identification:
[0068] The strain was sent to Shanghai Paisenno Biotechnology Co., Ltd. for sequencing. The primers were ITS1 (SEQ ID NO:2): 5-TCCGTAGGTGAACCTGCGG-3; ITS4 (SEQ ID NO:3): 5-TCCTCCGCTTATTGATATGC-3.
[0069] PCR amplification reaction system: Add the components shown in Table 1 to a 0.2 mL centrifuge tube, gently tap to mix, and briefly centrifuge to collect the droplets on the tube wall to the bottom. Perform the PCR reaction on a PCR amplification instrument with the following parameters: pre-denaturation 95℃, 5 min; denaturation 95℃, 30 s; annealing 58℃, 30 s; extension 72℃, 1 min; final extension 72℃, 7 min; cycle number 35. After the reaction, take 3 μL of PCR product for 1% agarose gel electrophoresis to confirm the PCR amplification fragment.
[0070] Table 1 PCR reaction system
[0071]
[0072] The sequencing results were compared using BLAST on the NCBI website, and a phylogenetic tree was constructed. Figure 3 The fungus was identified as *Monascus purpureus* and named *Monascus purpureus* LJ-Q1. It was deposited on April 11, 2024, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University Collection Center, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, 430072, China. The accession number is CCTCC NO: M 2024666.
[0073] Example 2: Growth characteristics of Monascus purpureus LJ-Q1
[0074] Inside a clean bench, using a sterile inoculation loop, three loops of mycelium or spores were picked from activated Monascus purpureus LJ-Q1 agar medium and inoculated into an Erlenmeyer flask containing malt extract broth. After inoculation, the flask was gently shaken and placed in a constant-temperature shaker at 30°C and 120 rpm to obtain a bacterial suspension. The spore suspension was then diluted to 10⁻¹ using a hemocytometer. 5 1 spore / mL was inoculated into malt extract liquid culture medium. Samples were collected daily from the start of inoculation and culture until the red yeast rice growth entered the decline phase. Three parallel samples were collected from each treatment group each time to reduce experimental error. 5 mL of fermentation broth was taken each time and placed in a centrifuge tube, centrifuged at 4000 rpm and 4℃ for 10 min. After centrifugation, the supernatant was discarded, and the cell pellet was collected. The cell pellet was transferred to a pre-weighed weighing bottle. The weighing bottle was dried in a 105℃ oven until constant weight, then removed and cooled to room temperature in a desiccator before weighing. The formula for calculating the dry weight of the cells (in g) is: Dry weight of cells = Weight of weighing bottle + Dry weight of cells - Weight of weighing bottle.
[0075] Plot the growth curve of Monascus purpureus LJ-Q1, as follows: Figure 4 As shown in the figure, LJ-Q1 is in the growth lag phase from 0 to 2 days, with slow cell growth and little increase in dry weight. It grows rapidly from 3 to 7 days, entering the logarithmic phase. After 7 days, it enters the growth stationary phase, with no significant cell growth.
[0076] The growth of Monascus purpureus LJ-Q1 varies at different temperatures (e.g.) Figure 5 The cells grew well between 25℃ and 35℃, but the maximum cell dry weight was observed at 30℃. Growth slowed at 40℃, and cell dry weight decreased significantly at 45℃, indicating more pronounced growth restriction. These results suggest that the optimal growth temperature for LJ-Q1 is 30℃.
[0077] Example 3: GC-MS component analysis of Monascus purpureus LJ-Q1 sorghum liquid culture medium
[0078] Culture medium of Monascus purpureus LJ-Q1 (experimental group): Three rings of mycelium or spores were picked from activated Monascus purpureus LJ-Q1 agar medium using a sterile inoculation loop and inoculated onto malt extract liquid medium. The medium was then cultured on a shaker at 120 rpm and 30°C for 7 days to obtain a bacterial suspension (10... 5 The bacterial suspension was then inoculated into sorghum liquid culture medium at an inoculation rate of 4% (V / V) and cultured on a shaker at 36℃ and 160 r / min for 9 days. A blank control group was also set up under the same culture conditions. The volatile products were analyzed using headspace solid-phase microextraction (HS-SPME) and gas chromatography-mass spectrometry (GC-MS). The culture medium without bacterial fermentation was used as the blank control group. A variety of substances were detected. The specific substances and yields are shown in Table 2 below.
[0079] Monascus purpureus LJ-Q1 produces a variety of flavor compounds, including ethanol, isobutanol, n-butanol, isoamyl alcohol, n-pentanol, 2-heptanol, octanol, 1-octen-3-ol, n-heptanol, 2-ethylhexanol, 2-nonyl alcohol, 1-nonanol, furfuryl alcohol, cis-3-nonen-1-ol, 2-undecyl alcohol, trans-nerolidol, benzyl alcohol, phenethyl alcohol, 3-phenylpropanol, ethyl acetate, ethyl thiocyanate, ethyl octanoate, ethyl 3-methylpyrazole-4-carboxylate, ethyl nonanoate, ethyl 2-furfurylate, ethyl decanoate, ethyl benzoate, propyl benzoate, ethyl phenylacetate, isobutyl benzoate, ethyl acetate, and 2-methyl... 3-Hydroxy-2,2,4-Trimethylpentyl ester of methylpropionic acid, 2,2,4-Trimethyl-1,3-pentanediol diisobutyrate, ethyl palmitate, cis-4-hydroxy-6-dodecenoic acid lactone, ethyl transoleate, octanoic acid, nonanoic acid, benzoic acid, acetophenone, 3-tert-butyl-2-pyrazolino-5-one, orange-based acetone, 2,6-di(tert-butyl)-4-hydroxy-4-methyl-2,5-cyclohexen-1-one, octadecylcyclononoxysiloxane, o-cresol, 2,4-di-tert-butylphenol, 4-methoxystyrene, 3,4-dimethoxystyrene, p-hydroxystyrene, coconut aldehyde.
[0080] Table 2. Volatile components (%) produced by Monascus purpureus LJ-Q1 in sorghum liquid culture medium.
[0081]
[0082]
[0083] As shown in Table 2, the aroma components of Monascus purpureus strain LJ-Q1 are mostly fruity and floral, so its fermentation liquid is also quite fragrant.
[0084] Example 4: Application of Monascus purpureus LJ-Q1 in fortified koji and brewing
[0085] In the medium-temperature Daqu mixing process, Monascus purpureus LJ-Q1 was inoculated onto the wheat feed at a rate of 4% of the dry weight of the wheat feed. The Daqu was then prepared according to the medium-temperature Daqu cultivation process, and fermented for 15 days to obtain the fortified Daqu. A medium-temperature Daqu prepared by conventional inoculation (without adding LJ-Q1) served as the control group. The indicators of the fortified Daqu and the medium-temperature Daqu were tested, and the results are shown in Table 3.
[0086] Table 3. Indicators after adding Monascus purpureus LJ-Q1 to Daqu (a type of starter culture)
[0087]
[0088]
[0089] (2) The fortified Daqu was used for production test fermentation. Through comparative experiments of adding medium-temperature Daqu and fortified Daqu respectively, the effects of strains on Baijiu brewing and quality were studied. The specific fermentation steps are as follows.
[0090] Crushing: Feed the sorghum after removing impurities into a crusher and crush it. The crushing degree should be such that less than 30% of the sorghum passes through a 20-mesh sieve.
[0091] Moistening the grain: The water temperature for moistening the grain should be above 85℃, and the amount of water added should be 58% of the weight of the sorghum flour. After adding water, stir thoroughly so that the raw materials can absorb an appropriate amount of water, which facilitates gelatinization.
[0092] Steaming the grain: The steaming time is 40 minutes. After steaming, the grain will not be raw in the center, and it will be cooked but not sticky, which is conducive to starch gelatinization and subsequent fermentation.
[0093] Spreading and adding yeast: Select a grain to mash mass ratio of 1:1.8, cool and mix the mash after distillation with the cooked grain, add the mixed yeast, and add 15% of the dry grain mass.
[0094] Fermentation: The fermented mash after being spread out and mixed with yeast is transferred to a stainless steel fermentation tank for sealed fermentation, which takes 15 days.
[0095] Distillation: The fermentation mash was removed from the mobile fermentation pit, and an appropriate amount of rice husks was added and mixed evenly according to the fermentation status of the mash. The mixture was then placed in a still for distillation. The alcohol yield and flavor compounds were calculated. The flavor compounds of the experimental group samples were determined using the GC-FID method according to national standards. The specific results are shown in Tables 4 and 5.
[0096] Table 4. Yield of different yeast starters
[0097]
[0098] As shown in Table 4, the alcohol yield of the experimental group (with added fortified Daqu) was higher than that of the control group, increasing by 4%. Therefore, using fortified Daqu made from Monascus purpureus LJ-Q1 in Baijiu brewing can improve the alcohol yield.
[0099] Table 5. Flavor substance content of different yeast base liquors
[0100]
[0101]
Claims
1. Monascus purpureus, characterized by: The accession number is CCTCC NO: M 2024666.
2. A microbial inoculant, characterized in that: The fermentation broth, seed broth, or mycelium of Monascus purpureus as described in claim 1 is contained in the fermentation broth, seed broth, or mycelium; wherein the mycelium is a live cell or a dry mycelium of Monascus purpureus.
3. The application of the Monascus purpureus according to claim 1 or the microbial agent according to claim 2 in the preparation of brewing yeast, characterized in that: The yeast starter includes at least one of wheat yeast starter, large yeast starter, small yeast starter, bran yeast starter, red yeast starter, and fortified large yeast starter.
4. The application of the Monascus purpureus according to claim 1 and the microbial agent according to claim 2 in the brewing of Baijiu (Chinese liquor), characterized in that: The liquor is at least one of the following: soy sauce aroma type, strong aroma type, light aroma type, rice aroma type, and mixed aroma type.
5. The application of the Monascus purpureus according to claim 1 or the microbial agent according to claim 2 in the production of flavor substances, characterized in that: The flavor compounds include: ethanol, isobutanol, n-butanol, isoamyl alcohol, n-pentanol, 2-heptanol, octanol, 1-octen-3-ol, n-heptol, 2-ethylhexanol, 2-nonyl alcohol, 1-nonanol, furfuryl alcohol, cis-3-nonen-1-ol, 2-undecyl alcohol, trans-nerolidol, benzyl alcohol, phenethyl alcohol, 3-phenylpropanol, ethyl acetate, ethyl thiocyanate, ethyl octanoate, ethyl 3-methylpyrazole-4-carboxylate, ethyl nonanoate, ethyl 2-furfurylate, ethyl decanoate, ethyl benzoate, propyl benzoate, ethyl phenylacetate, isobutyl benzoate, ethyl acetate, 3-hydroxy-2-methylpropionic acid. At least one of the following: 2,2,4-trimethylpentyl ester, 2,2,4-trimethyl-1,3-pentanediol diisobutyrate, ethyl palmitate, cis-4-hydroxy-6-dodecenoic acid lactone, ethyl transoleate, octanoic acid, nonanoic acid, benzoic acid, acetophenone, 3-tert-butyl-2-pyrazoline-5-one, orange acetone, 2,6-di(tert-butyl)-4-hydroxy-4-methyl-2,5-cyclohexen-1-one, octadecylcyclononsiloxane, o-cresol, 2,4-di-tert-butylphenol, 4-methoxystyrene, 3,4-dimethoxystyrene, p-hydroxystyrene, and coconut aldehyde.
6. A method for producing flavor substances using the Monascus purpureus according to claim 1 or the microbial agent according to claim 2, characterized in that: The red mold or microbial inoculant is activated and then inoculated into malt juice liquid culture medium to obtain a bacterial suspension. The bacterial suspension is then inoculated into sorghum liquid culture medium to produce a variety of flavor substances. The flavoring substances include: ethanol, isobutanol, n-butanol, isoamyl alcohol, n-pentanol, 2-heptanol, octanol, 1-octen-3-ol, n-heptanol, 2-ethylhexanol, 2-nonyl alcohol, 1-nonyl alcohol, furfuryl alcohol, cis-3-nonen-1-ol, 2-undecyl alcohol, trans-nerolidol, benzyl alcohol, phenethyl alcohol, 3-phenylpropanol, ethyl acetate, ethyl thiocarboxylate, ethyl octanoate, ethyl 3-methylpyrazole-4-carboxylate, ethyl nonanoate, ethyl 2-furfurylate, ethyl decanoate, ethyl benzoate, propyl benzoate, ethyl phenylacetate, isobutyl benzoate, ethyl phenylacetate, 3-hydroxymethyl 2-propionic acid. The following are at least one of the following: 2,2,4-trimethylpentyl ester, 2,2,4-trimethyl-1,3-pentanediol diisobutyrate, ethyl palmitate, cis-4-hydroxy-6-dodecenoic acid lactone, ethyl transoleate, octanoic acid, nonanoic acid, benzoic acid, acetophenone, 3-tert-butyl-2-pyrazolino-5-one, orange acetone, 2,6-di(tert-butyl)-4-hydroxy-4-methyl-2,5-cyclohexen-1-one, octadecylcyclononoxysiloxane, o-cresol, 2,4-di-tert-butylphenol, 4-methoxystyrene, 3,4-dimethoxystyrene, p-hydroxystyrene, and coconut aldehyde.
7. The method according to claim 6, characterized in that: The bacterial suspension has a bacterial activity of 10. 5 ~10 6 The inoculum concentration was CFU / mL, the inoculum size was 3-5% (v / v), the culture temperature was 30℃, and the culture time was 9-11 days.
8. The application of the Monascus purpureus according to claim 1 or the microbial agent according to claim 2 in increasing the content of flavor substances in base liquor, characterized in that: The flavor compounds include at least one of the following: 3-hydroxy-2-butanone, 2-ethoxy-5-methylfuran, n-hexanol, ethyl decanoate, valeric acid, ethyl laurate, and caprylic acid.
9. A method for increasing the content of flavor substances in base liquor using the Monascus purpureus according to claim 1 or the microbial agent according to claim 2, characterized in that: In the medium-temperature Daqu mixing process, red yeast or microbial agents are inoculated onto the wheat, and then the process is carried out according to the medium-temperature Daqu preparation process to obtain fortified Daqu. When the fortified Daqu is used in Baijiu brewing, brewing Daqu and fortified Daqu are added during the spreading and adding process to obtain base liquor with improved flavor substance content. The flavor compounds include at least one of the following: 3-hydroxy-2-butanone, 2-ethoxy-5-methylfuran, n-hexanol, ethyl decanoate, valeric acid, ethyl laurate, and caprylic acid.
10. The method according to claim 9, characterized in that: The inoculation amount of the red yeast or microbial agent is 3-5% of the dry weight of the wheat; the total addition amount of the brewing koji and the fortified koji is 10-20% of the weight of the grain, and the mass ratio of the brewing koji and the fortified koji is 1:10.
Citation Information
Patent Citations
Monascus for high yield of saccharifying enzyme, esterifying enzyme and protease and isolated culture method and application thereof
CN110317734A
Monascus purpureus for highly yielding saccharifying enzyme and esterifying enzyme, and application thereof
CN110903983A
New monascus purpureus strain and application thereof
CN119530022A