Candida parapsilosis and application thereof in extraction of exocarpium leaf essential oil

Abstract

The invention discloses candida parapsilosis and application thereof in extraction of pummelo peel leaf essential oil. The name of the candida parapsilosis is candida parapsilosis JY12, the preservation number of the candida parapsilosis is GDMCC NO: 64469, and the candida parapsilosis is preserved in Guangdong Microbial Culture Collection Center on March 29, 2024. The exocarpium leaf essential oil is finally prepared by taking exocarpium leaves as a raw material, fermenting the exocarpium leaves through candida parapsilosis, extracting the exocarpium leaves through a mixed organic solvent of normal hexane and ethyl acetate, evaporating to remove the solvent, dissolving base oil and the like. Compared with an extraction process without microbial fermentation assistance, the extraction yield of the paste essential oil extract is remarkably improved, and the aroma intensity of the liquid essential oil with the same volume obtained from the exocarpium leaves with the same mass is also remarkably improved. The essential oil obtained by the invention is suitable for the fields of medicines, foods, daily chemicals and the like.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a Candida parapsilosis and application thereof in extracting leaf essential oil of Citrus grandis (L.) Osbeck. BACKGROUND

[0002] Citrus grandis (L.) Osbeck is the immature or nearly mature pericarp of Rutaceae plant Huazhou Pummelo, has the physiological functions of relieving cough and reducing sputum, anti-inflammatory, antioxidant, antithrombotic, anti-fatigue, alcohol liver detoxification, and reducing blood sugar and blood lipids, is one of the "ten rare Chinese medicinal materials" in Guangdong Province, and has become a hotspot in the fields of Chinese medicine and food research and application in recent years. As a Rutaceae plant, the leaf of Citrus grandis (L.) Osbeck has aromatic odor, contains β-pinene, β-myrcene, D-limonene, γ-terpinene, caryophyllene and various flavonoid compounds, and can be used for extracting essential oil, but little attention is paid to this aspect.

[0003] Compared with the pericarp of Citrus grandis (L.) Osbeck, the content of essential oil components in the leaf of Citrus grandis (L.) Osbeck is relatively low, which is the main reason why people rarely use it as raw material for essential oil extraction. However, the fruit of Citrus grandis (L.) Osbeck can only be harvested once a year, while the leaf of Citrus grandis (L.) Osbeck can be picked all year round, has the advantages of convenient source and low price. Developing a method for effectively extracting essential oil from the leaf of Citrus grandis (L.) Osbeck is conducive to promoting the high value-added of the leaf of Citrus grandis (L.) Osbeck. SUMMARY

[0004] The primary purpose of the present application is to overcome the shortcomings and deficiencies of the prior art, and provide a Candida parapsilosis and application thereof in extracting leaf essential oil of Citrus grandis (L.) Osbeck.

[0005] Another purpose of the present application is to provide a method for extracting leaf essential oil of Citrus grandis (L.) Osbeck by microbial assisted fermentation.

[0006] The purpose of the present application is achieved by the following technical scheme: a Candida parapsilosis, named Candida parapsilosis (also known as Candida parapsilosis) JY12, with a preservation number of GDMCC No: 64469, preserved in the Guangdong Microbial Culture Collection Center of the Guangdong Institute of Microbiology, located at No. 59, Building 5, Guangdong Academy of Sciences, 100, Xianlie Road, Guangzhou, on March 29, 2024.

[0007] The application of the above-mentioned Candida parapsilosis in extracting leaf essential oil of Citrus grandis (L.) Osbeck is to ferment the leaf of Citrus grandis (L.) Osbeck by using the above-mentioned Candida parapsilosis, so as to promote the conversion of other compounds in the leaf of Citrus grandis (L.) Osbeck into essential oil components, thereby improving the yield of essential oil extraction.

[0008] A method for extracting leaf essential oil of Citrus grandis (L.) Osbeck by microbial assisted fermentation, comprising the following steps:

[0009] (1) Fermenting of Folium Biotae Orientalis: fresh Folium Biotae Orientalis is washed clean, cut into pieces, mixed with water, peptone, glucose, sodium citrate, potassium dihydrogen phosphate, homogenized and sterilized to obtain a fermentation medium; after cooling, the above-mentioned culture solution of Candida parapsilosis is inoculated, and fermentation is carried out to obtain a fermentation liquor;

[0010] (2) Extraction of essential oil of Folium Biotae Orientalis: the fermentation liquor and an organic solvent are mixed and homogenized, and then centrifuged to obtain a supernatant; the supernatant is placed in a columnar separator, and after being stably separated into layers, the water layer liquid is discharged, and the organic solvent layer liquid is collected; the organic solvent layer liquid is placed in a distiller, and the solvent is evaporated to obtain an essential oil paste, and the organic solvent distilled out is recovered by condensation;

[0011] (3) Preparation of essential oil of Folium Biotae Orientalis: base oil is added to the essential oil paste, which is heated in a hot water bath to dissolve the essential oil paste, and a liquid essential oil is obtained.

[0012] In step (1), the Folium Biotae Orientalis and the water are mixed at a mass ratio of 1:(2-4), and more preferably at a mass ratio of 1:(2.8-3.2).

[0013] The water is preferably pure water.

[0014] The amount of the peptone is preferably 2.5%-3.5% (w / w) of the mass of the Folium Biotae Orientalis, and more preferably 2.8%-3.2% (w / w) of the mass of the Folium Biotae Orientalis.

[0015] The amount of the glucose is preferably 25%-35% (w / w) of the mass of the Folium Biotae Orientalis, and more preferably 28%-32% (w / w) of the mass of the Folium Biotae Orientalis.

[0016] The amount of the sodium citrate is preferably 3%-8% (w / w) of the mass of the Folium Biotae Orientalis, and more preferably 5%-6% (w / w) of the mass of the Folium Biotae Orientalis.

[0017] The amount of the potassium dihydrogen phosphate is preferably 0.6%-0.9% (w / w) of the mass of the Folium Biotae Orientalis, and more preferably 0.72%-0.78% (w / w) of the mass of the Folium Biotae Orientalis.

[0018] The homogenization is preferably carried out at 6000-10000 r / min for 15-25 min, and more preferably at 7000-8000 r / min for 18-20 min.

[0019] The sterilization is preferably carried out at 121°C for 5-15 min, and more preferably at 121°C for 6-10 min.

[0020] The homogenization is preferably carried out at 6000-10000 r / min for 15-25 min, and more preferably at 7000-8000 r / min for 18-20 min.

[0021] The near-smooth Candida culture solution is preferably prepared by the following steps: inoculating the near-smooth Candida preservation strain into a liquid culture medium, and oscillating culture to obtain the near-smooth Candida culture solution.

[0022] The composition of the liquid culture medium is as follows: glucose 90-110 g / L, proteose peptone 9-11 g / L, yeast extract 9-11 g / L, potassium dihydrogen phosphate 2-3 g / L, magnesium sulfate 0.3-0.5 g / L, pH 6.8-7.2, and water as solvent; more preferably, glucose 100 g / L, proteose peptone 10 g / L, yeast extract 10 g / L, potassium dihydrogen phosphate 2.4 g / L, magnesium sulfate 0.4 g / L, pH 7.0, and water as solvent.

[0023] The sterilization condition is preferably 121°C for 15-25 min; more preferably, 121°C for 20 min.

[0024] The inoculation amount of the near-smooth Candida preservation strain is preferably 2 loopfuls of bacteria per 120-200 mL of the liquid culture medium.

[0025] The oscillating culture condition is preferably 25-30°C, 180-200 r / min for 15-25 h; more preferably, 28°C, 200 r / min for 18-20 h.

[0026] The inoculation amount of the near-smooth Candida culture solution is preferably 0.2%-1.0% of the volume of the water used in the fermentation medium; more preferably, 0.4%-0.8% of the volume of the water used in the culture medium.

[0027] The fermentation condition is preferably as follows: temperature 28-30°C, stirring speed 180-240 r / min, aeration ratio controlled at 0.24-0.36 vvm for 0-18 h, aeration ratio controlled at 0.36-0.44 vvm for 19-28 h, aeration ratio controlled at 0.32-0.36 vvm for 29-40 h, aeration ratio controlled at 0.28-0.32 vvm for 41 h and later, and fermentation cycle 48-56 h.

[0028] In step (2), the organic solvent is preferably an organic solvent obtained by mixing n-hexane and ethyl acetate; more preferably, an organic solvent obtained by mixing n-hexane and ethyl acetate at a volume ratio of 1:1.

[0029] The organic solvent is preferably used in an amount of 50%-80% of the volume of the water used in the fermentation medium; more preferably, 60%-70% of the volume of the water used in the fermentation medium.

[0030] The organic solvent is preferably used in an amount of 50%-80% of the volume of the water used in the fermentation medium; more preferably, 60%-70% of the volume of the water used in the fermentation medium.

[0031] The homogenization condition is preferably 7000-8000 r / min for 6-10 min.

[0032] The centrifugal separation condition is preferably 6000-7000 r / min for 18-22 min.

[0033] The temperature for evaporating the solvent is preferably 75-90℃; more preferably 80-85℃.

[0034] In step (3), the temperature of the water bath is preferably 80-110℃; more preferably 90-100℃.

[0035] The base oil is preferably jojoba oil.

[0036] The base oil is preferably jojoba oil.

[0037] The temperature of the water bath is preferably 80-110℃; more preferably 90-100℃.

[0038] The present application has the following advantages and effects over the prior art:

[0039] (1) The Candida parapsilosis JY12 screened in the present application can be used to increase the content of essential oil components in the leaves of Clausena lophantthi by fermentation.

[0040] (2) There is no prior art of extracting essential oil from the leaves of Clausena lophantthi, and no research report of increasing the content of essential oil components in the leaves of Clausena lophantthi by microbial fermentation. The present application uses Candida parapsilosis to ferment the leaves of Clausena lophantthi, which promotes the conversion of other compounds in the leaves of Clausena lophantthi into essential oil components, thereby significantly increasing the yield of essential oil extraction. Compared with the control without fermentation, the yield of the paste-like extract is 1.6 times that of the control, the aroma intensity of the liquid essential oil is 5.4 times that of the control, and the content of D-limonene, β-pinene, β-myrcene and γ-terpinene in the liquid essential oil is 3.5 times, 1.5 times, 3.1 times and 1.7 times that of the control, respectively. The obtained essential oil can be used as an additive for pharmaceuticals, food and daily chemical products, which is conducive to the high-value development and utilization of the leaves of Clausena lophantthi. BRIEF DESCRIPTION OF DRAWINGS

[0041] Figure 1 is a scanning electron microscope photograph of strain JY12. DETAILED DESCRIPTION

[0042] The present application will be further described in detail below, but the embodiments of the present application are not limited thereto. Unless otherwise specified, the reagents, methods and apparatus used in the present application are conventional reagents, methods and apparatus in the art. Unless otherwise specified, the reagents and materials used in the present application are commercially available.

[0043] Example 1

[0044] (1) Enrichment culture

[0045] Enrichment medium: glucose 50 g / L, proteose peptone 10 g / L, yeast extract 10 g / L, potassium dihydrogen phosphate 2.4 g / L, magnesium sulfate 0.4 g / L, dissolve the various materials in water, adjust pH to 7.0, and prepare the medium.

[0046] Prepare 100 mL of enrichment medium, put it into a 500 mL conical flask, sterilize at 121 °C for 20 min, after cooling, inoculate 5 g of fermentation product of Citrus grandis cv. 'Tomentosa' leaf compost fermentation, and place it in a 28 °C, 200 r / min shaking culture for 20 h to obtain the enrichment culture.

[0047] (2) Plate screening

[0048] Plate screening medium: glucose 30 g / L, proteose peptone 5 g / L, yeast extract 10 g / L, potassium dihydrogen phosphate 1.5 g / L, agar 20 g / L, dissolve the various materials in water, adjust pH to 7.0, and prepare the medium.

[0049] Plate the medium at 121 °C for 20 min, pour into a culture dish, and make a plate. Dilute the enrichment culture to 10 -6 and 10 -7 of the original concentration with sterile water, spread the obtained dilution on the plate screening medium, and incubate at 28 °C for 48 h. Pick 42 colonies with larger diameters, inoculate into slant medium (its composition is the same as that of the plate screening medium), incubate at 20 °C for 36 h, and store in a 4 °C refrigerator for standby use.

[0050] (3) Shake flask screening

[0051] 1) Shake flask medium preparation: weigh 100 g of fresh Citrus grandis cv. 'Tomentosa' leaves, wash them clean, cut them into pieces, mix them with 300 mL of pure water, add 3 g of proteose peptone, 30 g of glucose, 6 g of sodium citrate, and 0.75 g of potassium dihydrogen phosphate, homogenize at 8000 r / min for 20 min, adjust pH to 7.0, put it into a 1000 mL conical flask, sterilize at 121 °C for 20 min, and cool it down for standby use.

[0052] Prepare 43 bottles of culture medium according to step 1). Take one bottle as a control, do not inoculate it, and place it directly at 30℃ and 200r / min with shaking for 48 hours. Inoculate the slant culture of the colonies picked in step (2) into each bottle, and inoculate 3 loops of bacterial growth into each bottle. Ferment at 30℃ and 200r / min for 48 hours. Then, transfer the material from each bottle into beakers, add 100mL of n-hexane and 100mL of ethyl acetate to each beaker, homogenize at 8000r / min for 8min, and then centrifuge at 7000r / min for 20min. Collect the supernatant and place it in a separatory funnel. After standing and separating the layers, remove the organic solvent layer and place it in a 250mL volumetric flask, and make up to volume with n-hexane. The contents of limonene and myrcene in the volumetric flask solution were detected by gas chromatography (References: [1] Li Shanshan, Yang Min, Wu Weijian. Comparison of botanical characteristics and volatile components of grapefruit, lemon and sour orange flowers [J]. Southern Fruits of China, 2022, 51(2):35-39; [2] Liu Panpan, Zheng Pengcheng, Gong Ziming et al. Aroma characteristics and flavor components analysis of tangerine peel tea [J]. Food Science, 2021, 42(8):198-205.), and the results are shown in Table 1. Among them, the extract of fermentation broth of strain JY12 had the highest contents of citric acid and myrcene, so strain JY12 was selected as the test strain of this invention. The cell morphology of strain JY12 was observed under electron microscopy, as shown in Table 1. Figure 1 As shown, the cells are oval in shape, similar in morphology to yeast.

[0053] Table 1. Content of limonene and myrcene in fermentation materials of various strains

[0054]

[0055]

[0056] (4) Strain identification

[0057] Strain JY12 was sent to a gene sequencing company for ITS sequence detection. The detected sequence was identified as *Candida parapsilosis* after being searched and compared on the NCBI data platform. The strain was named *Candida parapsilosis* JY12 and deposited on March 29, 2024, at the Guangdong Provincial Microbial Culture Collection Center, Institute of Microbiology, Guangdong Academy of Sciences, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, with accession number GDMCC No: 64469.

[0058] The ITS sequence of Candida parapsilosis JY12 is as follows:

[0059] TCCGTAGGTGAACCTGCGGAAGGATCATTACAGAATGAAAGTGCTTAACTGCATTTTTTCTTACACATGTGTTTT

[0060] TCTTTTTTTGAAAACTTTGCTTTGGTAGGCCTTCTATATGGGGCCTGCCAGAGATTAAACTCAACCAAATTTTATTTAAT

[0061] GTCAACCGATTATTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGC

[0062] GATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGC

[0063] ATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCTCGGGTTTGGTGTTGAGCGATACGCTGGGTTTGCTTGAAAGAAAGG

[0064] CGGAGTATAAACTAATGGATAGGTTTTTTCCACTCATTGGTACAAACTCCAAAACTTCTTCCAAATTCGACCTCAAATCA

[0065] GGTAGGACTACCCGCTGAACTTAAGC.

[0066] Example 2

[0067] (1) Culture of *Near-smooth yeast*

[0068] Prepare 360 ​​mL of liquid culture medium (culture medium formula: glucose 100 g / L, peptone 10 g / L, yeast extract 10 g / L, potassium dihydrogen phosphate 2.4 g / L, magnesium sulfate 0.4 g / L, adjust pH to 7.0, solvent is water), dispense into two 1000 mL Erlenmeyer flasks, sterilize at 121 °C for 20 min, after cooling, inoculate each Erlenmeyer flask with two loops of *Candida glabrata* JY12 slant culture, and incubate at 28 °C and 200 r / min for 19 h.

[0069] (2) Fermentation of Citrus reticulata leaves

[0070] Weigh 20 kg of fresh Citrus reticulata leaves, wash and chop them, mix with 60 L of purified water, add 0.6 kg of peptone, 6 kg of glucose, 1.1 kg of sodium citrate and 0.15 kg of potassium dihydrogen phosphate, homogenize at 7500 rpm for 19 min, and transfer to a 100 L fermenter for sterilization at 121 °C for 8 min. After cooling, inoculate with 360 mL of the above-mentioned Candida glabrata culture medium, start stirring, control the stirring speed at 210 rpm, and control the fermentation temperature at 29 °C. During fermentation, the aeration ratio is controlled at 0.24–0.36 vvm from 0 to 18 h, 0.36–0.44 vvm from 19 to 28 h, 0.32–0.36 vvm from 29 to 40 h, and 0.28–0.32 vvm from 41 h onwards, with a fermentation cycle of 52 h.

[0071] (3) Extraction of essential oil from Citrus reticulata leaves

[0072] The fermentation broth was placed in a high-speed homogenizer, and 19.5 L of n-hexane and 19.5 L of ethyl acetate were added. Homogenization was carried out at 7500 rpm for 8 min. The mixture was then centrifuged at 6500 rpm for 20 min, and the supernatant was collected. The supernatant was placed in a column separator and allowed to stand for 50 min. The aqueous layer was discarded, yielding 21 L of organic solvent extract. The organic solvent extract was then distilled at 82 °C to remove the solvent, yielding 118.1 g of essential oil paste. The extraction yield of the paste was 0.59% relative to 20 kg of fresh Citrus reticulata leaves.

[0073] The yield is calculated as follows:

[0074] Extraction yield of the paste (%) = mass of essential oil paste (g) / mass of fresh tangerine peel leaves (g) × 100%.

[0075] (4) Preparation of Citrus reticulata leaf essential oil

[0076] Add 1.6L of jojoba oil to the paste and heat it in a 95℃ hot water bath to dissolve the paste, obtaining a fresh, sweet, and strongly scented liquid essential oil. Take 1mL of this liquid essential oil and dilute it with jojoba oil to 806.2mL, reaching the aroma threshold (evaluated multiple times by a panel of 9 aroma evaluators), indicating that the liquid essential oil has a very high aroma intensity. The contents of D-limonene, β-pinene, β-myrcene and γ-terpinene in the liquid essential oil were detected by gas chromatography (References: [1] Li Shanshan, Yang Min, Wu Weijian. Comparison of botanical characteristics and volatile components of grapefruit, lemon and orange blossoms [J]. Southern Fruits of China, 2022, 51(2):35-39; [2] Liu Panpan, Zheng Pengcheng, Gong Ziming et al. Aroma characteristics and flavor components analysis of tangerine peel tea [J]. Food Science, 2021, 42(8):198-205.). The contents of D-limonene, β-pinene, β-myrcene and γ-terpinene were 8.95 mg / L, 32.22 mg / L, 13.96 mg / L and 60.98 mg / L, respectively, which were significantly higher than those of the control sample (the sample obtained from the control example).

[0077] Example 3

[0078] (1) Culture of *Near-smooth yeast*

[0079] Prepare 448 mL of liquid culture medium (culture medium formula: glucose 100 g / L, peptone 10 g / L, yeast extract 10 g / L, potassium dihydrogen phosphate 2.4 g / L, magnesium sulfate 0.4 g / L, adjust pH to 7.0, solvent is water), dispense into 3 1000 mL Erlenmeyer flasks, sterilize at 121 °C for 20 min, after cooling, inoculate each Erlenmeyer flask with 2 loops of *Candida glabrata* JY12 slant culture, and incubate at 28 °C and 200 r / min for 20 h.

[0080] (2) Fermentation of Citrus reticulata leaves

[0081] Weigh 20 kg of fresh Citrus reticulata leaves, wash and chop them, mix with 56 L of purified water, add 0.56 kg of peptone, 5.6 kg of glucose, 1 kg of sodium citrate, and 0.144 kg of potassium dihydrogen phosphate. Homogenize at 8000 rpm for 18 min, then transfer to a 100 L fermenter and sterilize at 121 °C for 10 min. After cooling, inoculate with 448 mL of the above-mentioned Candida glabrata culture medium, start stirring, control the stirring speed at 240 rpm, and control the fermentation temperature at 30 °C. During fermentation, the aeration ratio is controlled at 0.24–0.36 vvm from 0 to 18 h, 0.36–0.44 vvm from 19 to 28 h, 0.32–0.36 vvm from 29 to 40 h, and 0.28–0.32 vvm from 41 h onwards. The fermentation cycle is 48 h.

[0082] (3) Extraction of essential oil from Citrus reticulata leaves

[0083] The fermentation broth was placed in a high-speed homogenizer, and 19.6 L of n-hexane and 19.6 L of ethyl acetate were added. Homogenization was carried out at 8000 rpm for 10 min. The mixture was then centrifuged at 7000 rpm for 18 min, and the supernatant was collected. The supernatant was placed in a column separator and allowed to stand for 45 min. The aqueous layer was discarded, yielding 20.8 L of organic solvent extract. The organic solvent extract was then distilled at 85 °C to remove the solvent, yielding 115.8 g of essential oil paste. The extraction yield of the paste was 0.58% relative to 20 kg of fresh Citrus reticulata leaves.

[0084] (4) Preparation of Citrus reticulata leaf essential oil

[0085] Add 1.58L of jojoba oil to the paste and heat it in a 100℃ hot water bath to dissolve the paste, obtaining a fresh, sweet, and strongly scented liquid essential oil. Take 1mL of this liquid essential oil and dilute it with jojoba oil to 788.6mL, reaching the aroma threshold, indicating that the liquid essential oil has a very high aroma intensity. The contents of D-limonene, β-pinene, β-myrcene and γ-terpinene in the liquid essential oil were detected by gas chromatography (References: [1] Li Shanshan, Yang Min, Wu Weijian. Comparison of botanical characteristics and volatile components of grapefruit, lemon and orange blossoms [J]. Southern Fruits of China, 2022, 51(2):35-39; [2] Liu Panpan, Zheng Pengcheng, Gong Ziming et al. Aroma characteristics and flavor components analysis of tangerine peel tea [J]. Food Science, 2021, 42(8):198-205.). The contents of D-limonene, β-pinene, β-myrcene and γ-terpinene were 8.72 mg / L, 31.46 mg / L, 13.64 mg / L and 59.45 mg / L, respectively, which were significantly higher than those of the control sample.

[0086] Example 4

[0087] (1) Culture of *Near-smooth yeast*

[0088] Prepare 256 mL of liquid culture medium (culture medium formula: glucose 100 g / L, peptone 10 g / L, yeast extract 10 g / L, potassium dihydrogen phosphate 2.4 g / L, magnesium sulfate 0.4 g / L, adjust pH to 7.0, solvent is water), dispense into two 1000 mL Erlenmeyer flasks, sterilize at 121 °C for 20 min, after cooling, inoculate each Erlenmeyer flask with two loops of *Candida glabrata* JY12 slant culture, and incubate at 28 °C and 200 r / min for 18 h.

[0089] (2) Fermentation of Citrus reticulata leaves

[0090] Weigh 20 kg of fresh Citrus reticulata leaves, wash and chop them, mix with 64 L of purified water, add 0.64 kg of peptone, 6.4 kg of glucose, 1.2 kg of sodium citrate, and 0.156 kg of potassium dihydrogen phosphate, homogenize at 7000 rpm for 20 min, and place in a 100 L fermenter for sterilization at 121 °C for 6 min. After cooling, inoculate with 256 mL of the above-mentioned Candida glabrata culture medium, start stirring, control the stirring speed at 210 rpm, and control the fermentation temperature at 29 °C. During fermentation, the aeration ratio is controlled at 0.24–0.36 vvm from 0 to 18 h, 0.36–0.44 vvm from 19 to 28 h, 0.32–0.36 vvm from 29 to 40 h, and 0.28–0.32 vvm from 41 h onwards, with a fermentation cycle of 56 h.

[0091] (3) Extraction of essential oil from Citrus reticulata leaves

[0092] The fermentation broth was placed in a high-speed homogenizer, and 19.2 L of n-hexane and 19.2 L of ethyl acetate were added. Homogenization was carried out at 7500 rpm for 8 min. The mixture was then centrifuged at 6500 rpm for 20 min, and the supernatant was collected. The supernatant was placed in a column separator and allowed to stand for 55 min. The aqueous layer was discarded, yielding 20.4 L of organic solvent extract. The organic solvent extract was then distilled at 80 °C to remove the solvent, yielding 124.1 g of essential oil paste. The extraction yield of the paste was 0.62% relative to 20 kg of fresh Citrus reticulata leaves.

[0093] (4) Preparation of Citrus reticulata leaf essential oil

[0094] Add 1.62L of jojoba oil to the paste and heat it in a 90℃ hot water bath to dissolve the paste, obtaining a fresh, sweet, and strongly scented liquid essential oil. Take 1mL of this liquid essential oil and dilute it with jojoba oil to 829.5mL, reaching the aroma threshold, indicating that the liquid essential oil has a very high aroma intensity. The contents of D-limonene, β-pinene, β-myrcene and γ-terpinene in the liquid essential oil were detected by gas chromatography (References: [1] Li Shanshan, Yang Min, Wu Weijian. Comparison of botanical characteristics and volatile components of grapefruit, lemon and sour orange flowers [J]. Southern Fruits of China, 2022, 51(2):35-39; [2] Liu Panpan, Zheng Pengcheng, Gong Ziming et al. Aroma characteristics and flavor components analysis of tangerine peel tea [J]. Food Science, 2021, 42(8):198-205.). The contents of D-limonene, β-pinene, β-myrcene and γ-terpinene were 9.18 mg / L, 33.16 mg / L, 14.32 mg / L and 62.78 mg / L, respectively, which were significantly higher than those of the control sample.

[0095] Comparison Example

[0096] (1) Extraction of essential oil from Citrus reticulata leaves

[0097] Weigh 20 kg of fresh Citrus reticulata leaves, wash and chop them, mix with 60 L of purified water, and homogenize in a high-speed homogenizer at 7500 rpm for 19 min. Then, place the material in a cooking pot and heat at 121 °C for 8 min. Next, place the material back into the high-speed homogenizer, add 19.5 L of n-hexane and 19.5 L of ethyl acetate, and homogenize at 7500 rpm for 8 min. Centrifuge the material at 6500 rpm for 20 min and collect the supernatant. Place the supernatant in a column separator, let stand for 50 min, and discard the aqueous layer to obtain 21.8 L of organic solvent extract. Evaporate the organic solvent extract in a distiller at 82 °C to remove the solvent, obtaining 70.8 g of essential oil paste. The extraction yield of the paste is 0.35% relative to 20 kg of fresh Citrus reticulata leaves.

[0098] (2) Preparation of Citrus reticulata leaf essential oil

[0099] Add 1.6L of jojoba oil to the paste and heat it in a 95℃ hot water bath to dissolve the paste, obtaining a fresh, sweet, and strongly scented liquid essential oil. Take 1mL of this liquid essential oil and dilute it with jojoba oil to 145.4mL, reaching the aroma threshold, indicating that the liquid essential oil has a very high aroma intensity. The contents of D-limonene, β-pinene, β-myrcene and γ-terpinene in the liquid essential oil were detected by gas chromatography (References: [1] Li Shanshan, Yang Min, Wu Weijian. Comparison of botanical characteristics and volatile components of grapefruit, lemon and orange blossoms [J]. Southern Fruits of China, 2022, 51(2):35-39; [2] Liu Panpan, Zheng Pengcheng, Gong Ziming et al. Aroma characteristics and flavor components analysis of tangerine peel tea [J]. Food Science, 2021, 42(8):198-205.), and the contents of D-limonene, β-pinene, β-myrcene and γ-terpinene were 2.49 mg / L, 20.81 mg / L, 4.35 mg / L and 33.85 mg / L, respectively.

[0100] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A strain of *Candida parapsilosis*, characterized by: The name of the Candida parapsilosis is Candida parapsilosis JY12, with accession number GDMCC No: 64469. It was deposited on March 29, 2024, at the Guangdong Provincial Microbial Culture Collection Center of the Institute of Microbiology, Guangdong Academy of Sciences, located on the 5th floor of Building 59, No. 100 Xianlie Middle Road, Guangzhou.

2. The application of *Candida salivarius* as described in claim 1 in the extraction of essential oil from the leaves of *Citrus reticulata*.

3. A method for extracting essential oil from Citrus reticulata leaves using microbial-assisted fermentation, characterized in that... Includes the following steps: (1) Fermentation of Citrus reticulata leaves: Clean the fresh Citrus reticulata leaves, cut them into pieces, mix them with water, peptone, glucose, sodium citrate and potassium dihydrogen phosphate, homogenize and sterilize to obtain fermentation medium; after cooling, inoculate with the above-mentioned Candida glabrata culture medium and ferment to obtain fermentation liquid; (2) Extraction of essential oil from Citrus reticulata leaves: The fermentation broth and organic solvent were mixed and homogenized, and centrifuged to obtain the supernatant. The supernatant was placed in a column separator, allowed to stand, and after the layers stabilized, the water layer was drained and the organic solvent layer was collected. The organic solvent layer was placed in a distiller, the solvent was evaporated to obtain an essential oil paste, and the distilled organic solvent was condensed and recovered. (3) Preparation of essential oil from Citrus reticulata leaves: Add base oil to the essential oil paste, heat it in a hot water bath to dissolve the essential oil paste and obtain liquid essential oil.

4. The method for extracting essential oil from Citrus reticulata leaves by microbial-assisted fermentation according to claim 3, characterized in that: In step (1): The leaves of the tangerine peel and the water are mixed in a mass ratio of 1:(2-4); The amount of peptone used is calculated as 2.5% to 3.5% (w / w) of the weight of Citrus reticulata leaves; The amount of glucose used is calculated based on 25% to 35% (w / w) of the weight of Citrus reticulata leaves. The amount of sodium citrate used is calculated based on 3% to 8% (w / w) of the weight of Citrus reticulata leaves; The amount of potassium dihydrogen phosphate used is calculated as 0.6% to 0.9% (w / w) of the weight of Citrus reticulata leaves.

5. The method for extracting essential oil from Citrus reticulata leaves by microbial-assisted fermentation according to claim 4, characterized in that: In step (1): The leaves of the tangerine peel and the water are mixed at a mass ratio of 1:(2.8-3.2); The amount of peptone used is calculated as 2.8% to 3.2% (w / w) of the weight of Citrus reticulata leaves; The amount of glucose used is calculated based on 28% to 32% (w / w) of the weight of Citrus reticulata leaves; The amount of sodium citrate used is calculated based on 5% to 6% (w / w) of the weight of Citrus reticulata leaves; The amount of potassium dihydrogen phosphate used is calculated as 0.72% to 0.78% (w / w) of the weight of Citrus reticulata leaves.

6. The method for extracting essential oil from Citrus reticulata leaves by microbial-assisted fermentation according to claim 3, characterized in that: In step (1): The homogenization conditions are as follows: homogenize at 6000-10000 r / min for 15-25 min; The sterilization conditions are 121℃ for 5-15 minutes; In step (2): The homogenization conditions are as follows: homogenize at 7000-8000 r / min for 6-10 min; The centrifugation conditions are as follows: homogenize at 6000-7000 r / min for 18-22 min; The temperature for evaporating and removing the solvent is 75–90°C; In step (3): The temperature of the hot water bath is 80–110°C.

7. The method for extracting essential oil from Citrus reticulata leaves by microbial-assisted fermentation according to claim 3, characterized in that: The *Candida spp.* culture medium is prepared by the following steps: inoculating the preserved *Candida spp.* strain into a liquid culture medium and shaking the culture to obtain the *Candida spp.* culture medium. The liquid culture medium has the following composition: glucose 90-110 g / L, peptone 9-11 g / L, yeast extract 9-11 g / L, potassium dihydrogen phosphate 2-3 g / L, magnesium sulfate 0.3-0.5 g / L, pH adjusted to 6.8-7.2, and water as the solvent.

8. The method for extracting essential oil from Citrus reticulata leaves by microbial-assisted fermentation according to claim 3, characterized in that: In step (1): The inoculation amount of the *Candida salivarius* culture medium is calculated as 0.2% to 1.0% of the volume of water used in the fermentation medium; The fermentation conditions are as follows: temperature 28–30℃, stirring speed 180–240 r / min, aeration ratio controlled at 0.24–0.36 vvm for fermentation 0–18h, 0.36–0.44 vvm for fermentation 19–28h, 0.32–0.36 vvm for fermentation 29–40h, and 0.28–0.32 vvm for fermentation 41h and beyond, with a fermentation cycle of 48–56h.

9. The method for extracting essential oil from Citrus reticulata leaves by microbial-assisted fermentation according to claim 3, characterized in that: In step (2): The organic solvent is an organic solvent obtained by mixing n-hexane and ethyl acetate; The amount of the organic solvent used is calculated as 50% to 80% of the volume of water used in the fermentation medium; In step (3): The base oil is jojoba oil; The base oil is added at a ratio of fresh tangerine peel leaves to base oil of 100:5-10 (g:mL).

10. The method for extracting essential oil from Citrus reticulata leaves by microbial-assisted fermentation according to claim 9, characterized in that: In step (2): The organic solvent is an organic solvent obtained by mixing n-hexane and ethyl acetate in a volume ratio of 1:1; The amount of the organic solvent used is calculated as 60% to 70% of the volume of water used in the fermentation medium; In step (3): The base oil is added at a ratio of fresh tangerine peel leaves to base oil of 100: 7.9-8.1 (g:mL).

Images