Application of rice OsSAFM10 gene in improving resistance of rice to rice blast

Abstract

The invention discloses application of a rice OsSAFM10 gene in improving resistance of rice to rice blast. Researches find that the rice gene OsSAFM10 plays an important role in the rice blast resistance process of the rice. The over-expression of the OsSAFM10 gene can improve the disease resistance of the rice to the rice blast, so that the OsSAFM10 gene of the rice can be used for improving the resistance of the rice to the rice blast.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to rice. OsSAFM10 Application of genes in improving rice resistance to rice blast. Background Technology

[0002] Rice blast fungus ( Magnaporthe oryzae Rice blast, caused by fungal infection, is a serious fungal disease that can occur throughout the entire growth cycle of rice. Based on the stage and location of infection, it is mainly classified into seedling blast, leaf blast, node blast, neck blast, and grain blast. Rice blast is characterized by its high susceptibility to outbreaks, wide distribution, and rapid spread.

[0003] Long-term effective control of rice blast remains challenging. Currently, the most effective means of field control of rice blast is to plant high-yielding varieties carrying disease-resistant genes. However, the rice blast pathogen has a complex population structure in the field and mutates rapidly under the pressure of natural selection, thus evading selective recognition by the host. Therefore, single-gene resistance is usually short-lived, especially under long-term, large-scale planting of a single rice variety, where rice resistance is lost rapidly.

[0004] To address this problem, an effective solution is to conduct follow-up investigations. AVR The variation of genes in field pathogen populations provides a reference for rational crop rotation of resistant varieties. Simultaneously, planting different... R Genetic diversification or multi-lineage varieties composed of gene loci such as those resistant to rice blast can also delay the loss of rice resistance. Furthermore, the rational use of broad-spectrum rice blast resistance genes or gene editing technology to cultivate new disease-resistant rice varieties is a key direction for effective rice blast control in the future green economy.

[0005] Over the past decade, several broad-spectrum genes for resistance to rice blast have been identified in rice.

[0006] These include: C2H2 type transcription factors bsr-d1 The natural alleles of rice were identified and conferred broad-spectrum resistance to rice blast. The rice RING protein OsBBI1 with E3 ligase activity modifies the cell wall defense mechanism, increases ROS accumulation in cells, and has broad-spectrum resistance to rice blast fungus. Phosphorylation of rice light-harvesting complex II protein LHCB5 induces the release of ROS in chloroplasts, enhancing the broad-spectrum resistance of rice to rice blast. The immune regulatory protein PICI1 enhances defense metabolism to obtain broad-spectrum disease resistance by promoting the methionine-ethylene metabolic pathway and participating in the rice PTI and ETI pathways.

[0007] The ERAD-associated ubiquitin-binding enzyme OsUBC45 regulates rice yield and broad-spectrum disease resistance by promoting the degradation of OsGSK3, a negative regulator of rice yield, and OsPIP2;1, a negative regulator of disease resistance.

[0008] In addition, researchers combined artificial mutagenesis with whole-genome sequencing to clone the key regulatory gene RBL1 for broad-spectrum disease resistance in rice, and created new rice materials with broad-spectrum disease resistance that take into account both growth and yield through gene editing technology.

[0009] The key protein OsBDR1, responsible for rice blast resistance, negatively regulates rice resistance by phosphorylating MPK3 and inhibiting the synthesis of jasmonic acid and terpenoids. Screening for recessive OsBDR1 genetic materials holds promise for obtaining broad-spectrum resistant rice varieties.

[0010] Therefore, exploring new rice blast resistance genes and resistance resources, and cultivating broad-spectrum disease-resistant varieties is a green and efficient strategy to ensure crop yield and quality, which is of great significance to agricultural production. Summary of the Invention

[0011] This invention has discovered that rice OsSAFM10 The gene is associated with the immune response of rice to rice blast, and overexpression of it... OsSAFM10 Genes can enhance rice's resistance to rice blast.

[0012] This invention first provides rice OsSAFM10 The application of genes in improving rice resistance to rice blast, OsSAFM10 The gene was overexpressed in rice plants.

[0013] Preferred rice OsSAFM10 The nucleotide sequence of the gene CDS is shown in SEQ ID No. 1.

[0014] Preferably, during overexpression, rice is first... OsSAFM10 The gene was cloned into a vector and transformed into Agrobacterium, then transferred into rice cells through callus transformation to obtain high expression. OsSAFM10 Genetically modified rice.

[0015] This invention also provides a method for regulating rice resistance to rice blast. When it is necessary to improve rice resistance to rice blast, the method involves adding ingredients from rice... OsSAFM10 Gene overexpression, rice OsSAFM10 The nucleotide sequence of the gene CDS is shown in SEQ ID No. 1.

[0016] This invention also provides rice OsSAFM10 The application of genes in rice breeding, through screening for rice varieties with high gene expression. OsSAFM10 Rice plants with genetically modified rice varieties were used to obtain rice lines resistant to rice blast.

[0017] This invention also provides a method for constructing transgenic rice resistant to rice blast, wherein rice... OsSAFM10 High expression of the gene was obtained by transferring it into rice plants.OsSAFM10 Transgenic rice of the gene.

[0018] Preferably, the rice OsSAFM10 The CDS region nucleotide sequence of the gene is cloned into a vector, and is first transformed into Agrobacterium, and then is transformed into rice cells through callus transformation to obtain a high expression OsSAFM10 Transgenic rice.

[0019] Preferably, the rice OsSAFM10 The CDS nucleotide sequence of the gene is shown in SEQ ID No. 1.

[0020] The present application finds that the rice gene OsSAFM10 plays an important role in the process of rice resistance to rice blast. Overexpression OsSAFM10 of the gene can improve the disease resistance of rice to rice blast, so the rice Figure 1 gene can be used to improve the resistance of rice to rice blast. BRIEF DESCRIPTION OF DRAWINGS

[0021] OsSAFM10 is Figure 2 The detection result graph of the overexpression positive plant, *** p<0.001.

[0022] OsSAFM10 is the rice Figure 2 The identification result graph of the overexpression plant resistance to rice blast; wherein, Figure 2 A: in vitro inoculation graph in the Figure 3 B: length statistics of diseased leaf spots, ** p<0.01.

[0023] OsSAFM10 is OsSAFM10 The active oxygen determination result graph of the overexpression plant: the accumulation amount of ROS in the wild type ZH11 and OsSAFM10 overexpression plant after chitin treatment. DETAILED DESCRIPTION

[0024] Example 1

[0025] The preparation of the rice OsSAFM10 gene overexpression plant.

[0026] According to the CDS sequence of LOC_Os12g36880 ( OsSAFM10 ), the primers OsSAFM10-OE-F / R are designed. The primer sequences are as follows: OsSAFM10-OE-F: gttacttctgcactaggtaccATGGCTCCGGCCTGCGTCTC; OsSAFM10-OE-R: tcttagaattcccggggatccTTAGGCGTATTCGGCAGGGGTGA.

[0027] Using the genome of wild-type rice ZH11 (Zhonghua 11) (seeds saved from the China National Rice Research Institute) as a template, the gene was amplified using primers OsSAFM10-OE-F / R. Kpn The CDS sequence was obtained. After purification, the amplified product was ligated into the pCAMBIA1390 vector using seamless cloning technology. Bam I / OsSAFM10 The plasmid was digested with HI double enzymes. The ligated plasmid was transformed into *E. coli* using a heat shock method, and positive clones were selected for detection. After successful sequencing, the plasmid was sent to Wuhan Boyuan Biotechnology Co., Ltd., transformed into *Agrobacterium*, and then introduced into rice callus tissue for transformation. Using ZH11 as a background, rice... OsSAFM10 Plants with overexpressed genes.

[0028] Example 2

[0029] OsSAFM10 Detection of positive overexpression plants.

[0030] To verify OsUbiquitin To determine whether the overexpression-treated plants were successfully created, the rice seedlings returned by the company were tested. The specific procedures are as follows: First, total RNA was extracted from rice seedlings using Trizol reagent. Then, cDNA was synthesized by reverse transcription of the RNA using M-MLV reverse transcriptase and Oligo(dT). Further analysis was conducted using rice genes... LOC_Os03g13170 ( OsSAFM10 () is an internal reference gene for rice. Figure 1 Genes were subjected to real-time quantitative PCR.

[0031] Reaction system: TB Green Master: 5 μL; Primer-F (10 μmol / L): 0.2 μL; Primer-R (10 μmol / L): 0.2 μL; cDNA: 2 μL; ddH2O: 2.6 μL.

[0032] Reaction conditions: Pre-denaturation at 95℃ for 30 s; denaturation at 95℃ for 20 s, extension at 60℃ for 30 s, 40 cycles. (Use 2...) -ΔΔCT The relative expression level of a gene can be calculated.

[0033] The primer sequences are shown below: qOsUBQ-F:AAGAAGCTGAAGCATCCAGC; qOsUBQ-R:CCAGGACAAGATGATCTGCC; qOsSAFM10-F:GATGTGCTCGAGGCAGAAAG; qOsSAFM10-R:GAGCTCGTACTCCACCTTGA.

[0034] Test results as follows OsSAFM10 As shown, two overexpression plants were obtained. OsSAFM10 -OE-5 and OsSAFM10 -OE-9, among which, overexpressing plants OsSAFM10 -OE-5 OsSAFM10 The relative expression level of the gene was 10.77 times that of the wild-type plant, and the overexpressing plant... OsSAFM10 -OE-9 OsSAFM10 The relative expression level of the gene was 5.76 times that of the wild-type plant.

[0035] Example 3

[0036] OsSAFM10 The impact on disease resistance in rice.

[0037] To verify the gene OsSAFM10 It participates in the defense response of rice against rice blast, and OsSAFM10 The overexpression was used to identify rice blast resistance in plants. The specific procedures are as follows: Wild-type rice blast fungus strain RB22 was activated on OA medium and cultured in the dark at 25°C for 3 days, followed by light culture for 4 days. Sterile ddH2O was added to the culture dish, and the mycelia were gently scraped off with an inoculation loop to elute the rice blast fungus spores from the medium. The eluent was filtered through a filter cloth to obtain a spore suspension. The spore suspension was placed in a 2 mL centrifuge tube and centrifuged at 12000 rpm for 2 min. The supernatant was discarded (avoiding the discarding of spores at the bottom), and sterile ddH2O was added to adjust the spore concentration to no less than 1 × 10⁻⁶. 6 1 / mL of spores / mL. Add 1 / 10 volume of 0.1% Gelatin (final Gelatin concentration 0.01%, v / v) to the spore solution for inoculation with rice blast fungus.

[0038] In vitro inoculation: Cut rice seedlings at the 4-leaf stage ( OsSAFM10 To express the strains of rice blast fungus (both wild-type and overexpressing varieties), cut rice leaves into 5-8 cm segments. Gently prick the leaves with a pipette tip to create wounds (piercing the leaf but not penetrating it), then spread the leaves and fix them onto moist water agar. Add a prepared suspension of rice blast fungus spores (1-2 × 10⁻⁶). 6After mixing, the mixture was dropped on the leaf wound with a pipette, and left for more than 30 min to facilitate the spore settlement of the rice blast fungus. The leaves were cultured in a 25℃ incubator for 5-7 days after inoculation, and the infection of the rice blast fungus was observed and the length of the lesion was measured.

[0039] The results of inoculation Figure 2 showed that the lesion area of the overexpression plants OsSAFM10 -OE-5 and OsSAFM10 -OE-9 were significantly smaller than that of the wild type, indicating that the overexpression OsSAFM10 enhanced the resistance of rice to rice blast.

[0040] Example 4

[0041] OsSAFM10 Effect on reactive oxygen burst.

[0042] Reactive oxygen burst assay: The same size of 4-leaf stage rice leaves were punched on both sides of the main veins with a puncher to obtain uniform circular leaf discs. The leaf discs were placed in ddH2O and left in the dark at room temperature overnight. One leaf disc was randomly selected from each sample with tweezers and placed on an absorbent paper to dry the surface moisture. The leaf disc was placed at the bottom of a 1.5 mL centrifuge tube containing 100 μL luminol, 1 μL horseradish peroxidase and 1 μL chitin. Then the centrifuge tube was quickly placed in a Glomax 20 / 20Luminometer instrument, and the fluorescence intensity was measured every 60 s using the dynamic detection mode on the instrument, a total of 20 times, for 20 min. All the data measured were saved in Excel software and analyzed, and each treatment was repeated 5 times.

[0043] The results of the luminol chemiluminescence assay Figure 3 showed that the growth rate of ROS in the overexpression plants OsSAFM10 -OE-5 and OsSAFM10 -OE-9 was faster, and the accumulation was significantly higher than that of the wild type, indicating that the overexpression OsSAFM10 gene enhanced the resistance of rice to rice blast.

Claims

1. Rice UsSAFM10 The application of genes in improving rice resistance to rice blast is characterized by, Rice UsSAFM10 The gene was overexpressed in rice plants.

2. The application according to claim 1, characterized in that, rice UsSAFM10 The nucleotide sequence of the gene CDS is shown in SEQ ID No.

1.

3. The application according to claim 1, characterized in that, When expressing, first rice UsSAFM10 The gene was cloned into a vector and transformed into Agrobacterium, then transferred into rice cells through callus transformation to obtain high expression. UsSAFM10 Genetically modified rice.

4. A method for regulating rice resistance to rice blast, characterized in that, When it is necessary to improve the resistance of rice to rice blast, the rice... UsSAFM10 Gene overexpression, rice UsSAFM10 The nucleotide sequence of the gene CDS is shown in SEQ ID No.

1.

5. Rice UsSAFM10 The application of genes in rice breeding, through screening for rice varieties with high expression. UsSAFM10 Rice plants with genetically modified rice varieties can be used to obtain rice lines resistant to rice blast.

6. A method for constructing transgenic rice resistant to rice blast, characterized in that, Rice UsSAFM10 High expression of the gene was obtained by transferring it into rice plants. UsSAFM10 Genetically modified rice.

7. The method for constructing transgenic rice resistant to rice blast according to claim 6, characterized in that, Rice UsSAFM10 The CDS region nucleotide sequence of the gene was cloned into a vector, first transformed into Agrobacterium, and then transformed into rice cells through callus transformation to obtain high expression. UsSAFM10 Genetically modified rice.

8. The method for constructing transgenic rice resistant to rice blast according to claim 6, characterized in that, rice UsSAFM10 The nucleotide sequence of the gene CDS is shown in SEQ ID No. 1.

Images