Construction method and application of peucedanum praeruptorum dunn genetic transformation system

Abstract

The invention provides a construction method and application of a peucedanum praeruptorum dunn genetic transformation system, and belongs to the technical field of plant genetic transformation, the construction method comprises the following steps: constructing recombinant agrobacterium carrying a target gene and a selection marker, and preparing the recombinant agrobacterium into an agrobacterium infection penetrating fluid; the method comprises the following steps: soaking lateral inflorescences from a flower bud stage to an initial flowering stage on a peucedanum praeruptorum dunn plant in agrobacterium infection penetrating fluid for infection, and bagging and culturing after infection is finished; after the seeds are mature, the seeds are collected and identified. The invention successfully establishes an agrobacterium-mediated peucedanum praeruptorum dunn inflorescence infection genetic transformation system, provides technical support for molecular breeding, gene function research and the like of peucedanum praeruptorum dunn, and also provides a universal technical platform for molecular breeding of umbelliferae medicinal plants.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant genetic transformation, and particularly relates to a construction method and application of a traditional Chinese medicinal material radix peucedani genetic transformation system. BACKGROUND

[0002] Radix peucedani Peucedanum praeruptorum Dunn is a perennial herb of the family Umbelliferae, which was first recorded in Shangqing Records of Famous Physicians. The dried root is used as a medicine, has the effects of reducing qi, expelling phlegm, dispelling wind and clearing heat, is a traditional bulk medicinal material, and has a medicinal history of more than 1500 years. The main active components of radix peucedani are coumarin compounds (including peucedanin, ethyl, etc.), and modern pharmacological studies have confirmed that these components have multiple pharmacological effects such as anti-myocardial ischemia, protection of myocardium, improvement of cardiac function, reduction of blood pressure, antioxidant, expectorant, antibacterial, and anti-tumor, and play an important role in modern medical treatment. Radix peucedani has a wide geographical distribution, but due to over-harvesting and deterioration of the growing environment for a long time, the population of wild radix peucedani has decreased sharply. Although artificial cultivation has been achieved to some extent, the individuals of artificial breeding generally have the phenomenon of early bolting and early flowering, resulting in a significant decrease in root biomass, the content of active ingredients is far from the standard of the pharmacopoeia, and the yield and quality cannot meet the market demand. In order to protect the germplasm resources of wild radix peucedani and meet the market demand, it is of great significance to carry out the advantage breeding of radix peucedani.

[0003] Traditional breeding methods have obvious deficiencies in solving the problems of radix peucedani industry. The seed germination rate of sexual reproduction is low, the seedling emergence is uneven, and there is a large genetic variation risk, which makes it difficult to ensure the stability of the medicinal components. Molecular marker studies have shown that there is significant genetic differentiation (genetic similarity coefficient GS=0.45-0.96) among radix peucedani populations from different regions, and the genetic distance between wild populations and cultivated populations is significantly different. The complexity of this genetic background further increases the difficulty of realizing stable inheritance of excellent traits by traditional breeding. Genetic engineering provides a new idea for the improvement of radix peucedani varieties. Through the genetic transformation technology mediated by Agrobacterium, the key genes for regulating coumarin synthesis, anti-bolting genes and / or stress resistance genes can be precisely introduced into excellent germplasm, so as to realize the directional improvement of target traits.

[0004] The transformation principle of Agrobacterium tumefaciens is to use the T-DNA region and vir region of its Ti plasmid for gene transfer. The T-DNA region can be integrated into the plant genome for expression, and the vir region can transport and integrate the T-DNA into the plant genome. This technology has the characteristics of low copy integration, low gene silencing, high transformation efficiency and precise transfer of DNA fragments between boundary sequences. According to the transformation receptor, technical means and application scenarios, Agrobacterium-mediated genetic transformation can be divided into the following main types: tissue culture method based on explants, gene gun method, immature embryo transformation method and pollen tube channel method, etc. Among various genetic transformation methods, the pollen tube channel method has obvious advantages as a transformation technology without tissue culture. This method soaks the inflorescence with Agrobacterium solution, allowing T-DNA to be directly integrated into the reproductive cells through pollen tubes or ovule pathways, which is simple to operate and can avoid somatic cell variation. The transformation efficiency of this method in Brassicaceae (such as Arabidopsis thaliana) can reach 1%-5%, but it has not been successfully reported in Umbelliferae medicinal plants. SUMMARY

[0005] In view of the technical problems in the background art, the present application provides a method for establishing an Agrobacterium-mediated genetic transformation system of Peucedanum praeruptorum by the pollen tube channel method, aiming to provide technical support for Peucedanum praeruptorum breeding and gene function research, etc.

[0006] The technical solution of the present application is as follows: A method for constructing a genetic transformation system of Peucedanum praeruptorum, comprising the following steps: S1, constructing a recombinant Agrobacterium carrying a target gene and a selection marker and preparing it into an Agrobacterium infection infiltration solution; S2, soaking the lateral inflorescences of Peucedanum praeruptorum plants at the bud stage to the early flowering stage in the Agrobacterium infection infiltration solution for infection, and culturing in a bag after the infection is completed; S3, collecting seeds after the seeds of Peucedanum praeruptorum obtained in step S2 mature, and performing positive identification.

[0007] Preferably, the recombinant Agrobacterium is constructed using Agrobacterium tumefaciens GV3101 (agrocin type).

[0008] In the construction method of the present application, the target gene and the selection marker need to be determined according to the actual situation. In an embodiment of the present application, the target gene is PpRGL2 , and the selection marker is the hygromycin resistance gene HPT, and the preparation method of the recombinant Agrobacterium is: first prepare the pCAMBIA1300 plasmid carrying the PpRGL2 gene sequence, and then transform the plasmid into the GV3101 strain.

[0009] Preferably, the Agrobacterium infection infiltration solution is composed of the recombinant Agrobacterium and the infection infiltration solution, and the OD 600The value is between 0.8 and 1.0, and the infection infiltration liquid contains 10% (m / v) sucrose and 400 μL / L Silwet-77.

[0010] Preferably, the preparation method of the plant of Radix Puerariae in step S2 is as follows: the petiole of Radix Puerariae is sterilized, washed and dried, callus is induced and cultured, and the callus is proliferated and cultured, until the number of true leaf blades of the plant is greater than or equal to 3, the length of the petiole is greater than 5 cm, and the length of the main root is greater than 3 cm, and the seedling is transplanted to soil culture.

[0011] Preferably, step S2 is specifically as follows: the first primary inflorescence of the plant of Radix Puerariae is cut off to promote the growth of lateral inflorescences, the inflorescence is infected within 3-7 days, and the plant is fully watered the day before infection to fully open the stomata of the plant; during the infection, the flowers that have bloomed are removed, the cyme in the bud stage to the initial flowering stage is retained, the inflorescence is soaked in the Agrobacterium infection infiltration liquid for infection for 1 min, then the inflorescence is wrapped with a transparent and thin fresh-keeping bag, the relative humidity is maintained at 60%-80%, the fresh-keeping bag is removed after 2-3 days, the inflorescence is infected again 3 days after the fresh-keeping bag is removed, and the infection is repeated twice, so that the inflorescence is infected for 3 times.

[0012] More preferably, the infection rate of the inflorescence is 40-55%, and the infection rate = the number of the inflorescences infected by a single plant / the total number of the inflorescences of the single plant at the time of infection x 100%.

[0013] Preferably, the positive identification in step S3 includes screening marker identification, target gene identification and seed phenotype identification.

[0014] Preferably, the construction method provided by the application further includes the following steps: S4, planting the T0 generation of positive seeds to obtain transgenic plants.

[0015] Compared with the prior art, the application has the following beneficial effects: The application successfully establishes an inflorescence soaking method genetic transformation system suitable for Radix Puerariae, which is expected to solve the problems of strong genotype dependence, difficult regeneration and long cycle (3-6 months) in traditional transformation methods, and provides a universal technical platform for molecular breeding of plants of the family Umbelliferae.

[0016] The inflorescence soaking method genetic transformation system of Radix Puerariae established by the application helps to promote the molecular design breeding of Chinese herbal medicine Radix Puerariae into a new stage, which not only serves basic research (such as gene function verification), but also accelerates the process of excellent variety breeding, and provides core technical support for guaranteeing the sustainable utilization of Radix Puerariae. BRIEF DESCRIPTION OF DRAWINGS

[0017] In order to more clearly illustrate the technical solutions of the present application, the drawings used in the present application will be briefly introduced as follows. Obviously, the drawings described below are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative effort on the basis of these drawings.

[0018] Figure 1 The technical roadmap for establishing the genetic transformation system of the white flower of Peucedanum praeruptorum in the present application; Figure 2 The gel electrophoresis detection results of the SK-gRNA entry vector before and after Aar I enzyme digestion in the examples are shown in the figure, lane 1 is the enzyme digestion product, lane 2 is the original solution of the vector, and lane M is DL5000; Figure 3 The bacterial liquid PCR identification results of the SK-gRNA-PpRGL2-1 / 2 recombinant plasmid in the examples are shown in the figure, wherein the target band size is 490 bp, lane 1 is the SK-gRNA-PpRGL2-1 recombinant plasmid, lane 2 is the SK-gRNA-PpRGL2-2 recombinant plasmid, and lane M is DL5000; Figure 4 The gel electrophoresis detection results of the SK-gRNA-PpRGL2-1 / 2 recombinant plasmid (A) and pC1300-Cas9 empty vector (B) after double enzyme digestion in the examples are shown in the figure; lane A-5 is the SK-gRNA-PpRGL2-1 recombinant plasmid, lane A-7 is the SK-gRNA-PpRGL2-2 recombinant plasmid, lanes A-6 / 8 are empty controls, lane A-M is DL5000, the target band in the box in A is 545 bp, lane B-1 is pC1300-Cas9, lane B-2 is an empty control, lane B-M is DL15000, and the target band in the box in B is 15627 bp; Figure 5 The bacterial liquid PCR identification results of the pC1300-Cas9- PpRGL2 recombinant plasmid in the examples are shown in the figure, wherein the target band size is 143 bp, lanes 5-8 are pC1300-Cas9- PpRGL2 recombinant plasmids, and lane M is DL2000; Figure 6 The bacterial liquid PCR identification results of the GV3101 recombinant strain in the examples are shown in the figure, wherein the target band size is 143 bp, lanes 5-8 are pC1300-Cas9- PpRGL2 recombinant plasmids, and lane M is DL2000; Figure 7The flowchart of the GV3101 recombinant strain-mediated infection of the inflorescence of Angelica dahurica in the example is shown, where ① is the state of the infected object, ② is the infection of the inflorescence, ③ is the bagging and moisturizing after infection, ④ is the state of the inflorescence after removing the bag, and ⑤ is the result of the inflorescence after infection. Figure 8 This is a diagram showing the hygromycin identification results of the T0 generation transgenic plants in Example 3. Lanes 1-15 represent different transgenic plants, lane 16 is the negative control, and lane M is DL2000. Figure 9 For the T0 generation transgenic plants in Example 3 PpRGL2 The genetic identification results are shown in the diagram. Lanes 1-15 are different transgenic plants, lane 16 is the negative control, and lane M is DL2000. Figure 10 Wild-type seeds in Example 3 and PpRGL2 Morphological comparison of gene-edited T0 generation seeds: ① and ③ are wild type, ② and ④ are T0 generation seeds; Figure 11 This is a comparison diagram of the growth status of wild-type plants and T0 generation transgenic plants in Example 3 (60 days after germination). A represents wild-type plants, and C represents T0 generation transgenic plants. Detailed Implementation

[0019] The technical solution of the present invention will now be described in detail with reference to the accompanying drawings and embodiments.

[0020] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs; the terminology used herein is for the purpose of describing particular implementations only and is not intended to limit the invention; the terms “comprising” and “having” and any variations thereof are intended to cover non-exclusive inclusion.

[0021] As an ancient Chinese medicinal herb, *Angelica dahurica* plays an important role in modern medical treatment. However, the wild population of *Angelica dahurica* has declined sharply, and artificial cultivation often results in premature bolting and flowering, leading to insufficient yield and quality to meet market demand. Furthermore, traditional breeding methods have significant shortcomings, greatly limiting the application and industrial development of *Angelica dahurica*. This invention provides a method for constructing a genetic transformation system for *Angelica dahurica* using a flower-soaking method, offering a new approach and technical support for gene function research and breeding improvement of *Angelica dahurica*.

[0022] Reference Figure 1 The method for constructing a genetic transformation system of Angelica dahurica provided in this embodiment of the invention includes the following steps: (1) Cultivation of white angelica plants: Explants were disinfected, and after inducing callus tissue and differentiating into healthy and strong sterile seedlings, they were moved from the incubator to natural light for 3-6 days to adapt, and then transplanted into soil. (2) Preparation of Agrobacterium infection permeate: A recombinant plasmid carrying the target gene and selection marker was constructed and transformed into strain GV3101. The positive strain was prepared into Agrobacterium infection permeate using infection permeate (10% sucrose (m / v) + 400 μL / L Silwet-77). (3) Inflorescence infection: When the white-flowered Angelica dahurica plants obtained in step (1) grow to the flowering period, pick out the inflorescences and soak them in Agrobacterium infection solution for infection, and repeat the infection multiple times; (4) After the seeds of the infected Angelica dahurica plants mature, the plants are divided and the seeds are harvested to obtain T0 generation seeds; T0 generation seeds are sown and subjected to hygromycin positive identification, DNA molecular identification of the target gene and T0 generation seed phenotypic identification.

[0023] The following are some specific embodiments. It should be noted that the embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention. Where specific techniques or conditions are not specified in the embodiments, they shall be performed in accordance with the techniques or conditions described in the literature in this field or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all conventional products that can be obtained commercially.

[0024] Example 1 by PpRGL2 Taking genes as an example, this example provides a recombinant Agrobacterium tumefaciens strain containing the target gene based on CRISPR-Cas9 technology. Its construction includes the following steps: (1) Construction of SK-gRNA recombination introductory vector.

[0025] exist PpRGL2 The most suitable Cas9-PAM site was selected, and a sticky end GGCA of the Aar I restriction endonuclease was added to the 5' of the upstream primer, while a reverse sticky end AAAC was added to the 5' of the downstream primer. Two target sites were selected to perform dual-target editing of the target gene, as detailed in Table 1.

[0026] Table 1 PpRGL2 Primers and their sequences used in gene editing

[0027] The SK-gRNA initiation vector was digested with Aar I to convert it into a linear state with two sticky ends. The digestion system is shown in Table 2, and the digestion conditions were 37℃ for 12 h. After digestion, 3 µL of the digestion product was subjected to gel electrophoresis to confirm successful digestion (see Table 2). Figure 2The remaining product was also subjected to electrophoresis, and the recovered product was stored at 4°C.

[0028] Table 2 Aar I enzyme digestion system of SK-gRNA entry vector

[0029] The target primers SK-gRNA-PpRGL2-1 and SK-gRNA-PpRGL2-2 were diluted to a concentration of 10 nmol / L, 5 μL of F and 5 μL of R were mixed, boiled in a water bath at 100°C for 5 min to form double-stranded DNA, and then stored at 0°C after cooling to room temperature on ice.

[0030] The two products (linearized vector and primer double-stranded DNA) were ligated, and the ligation system is shown in Table 3. The reaction was performed at room temperature for 2 h.

[0031] Table 3 Ligation reaction system

[0032] The obtained ligation product was transformed into E. coli competent cells DH5α. The specific operation was as follows: 2 μL of ligation product was added to 30 μL of DH5α in a clean bench, and then mixed gently by hand. The mixture was incubated in an ice bath for 0.5 h, and then incubated in a dry thermostat at 42°C for 90 s, followed by ice bath for 5 min. Then, 750 μL of LB liquid medium was added, and the mixture was incubated at 37°C for 45 min. The mixture was centrifuged at 12000 rpm for 2 min, and then 600 μL of supernatant was discarded. The remaining cells were resuspended and spread on LB solid medium containing Amp (100 mg / L), and then incubated at 37°C for 12 h.

[0033] Positive identification: a single colony with appropriate size was selected and added to 3 mL of LB liquid medium containing Amp (100 mg / L), and then incubated at 37°C for 12 h. Then, 0.4 μL of bacterial solution was used as an amplification template for PCR identification. The primers were T3F (ATTAACCCTCACTAAAGGGA, SEQ ID NO. 5) and SK-gRNA-PpRGL2-R. The PCR reaction system is shown in Table 4, and the PCR reaction program is shown in Table 5. The amplified product was subjected to gel electrophoresis detection (see Figure 3 ), and the positive sample was sent to a company for sequencing according to the band size.

[0034] Table 4 PCR reaction system for identifying SK-gRNA-PpRGL2-1 / 2 recombinant vector

[0035] Table 5 PCR reaction program for identifying SK-gRNA-PpRGL2-1 / 2 recombinant vector

[0036] Take 500 μL of the correct positive sample bacterial solution and add it to an equal volume of 40% glycerol. Mix well and store in a -80°C freezer. The remaining bacterial solution is used to extract plasmids using the CWBIO plasmid extraction kit through alkaline lysis.

[0037] (2) pC1300-Cas9 -PpRGL2 Recombinant vector construction.

[0038] The recombinant entry vector SK-gRNA-PpRGL2-1 was double digested with Kpn I and Sal I, the recombinant entry vector SK-gRNA-PpRGL2-2 was double digested with Xho I and Bam H I, and the pC1300-Cas9 empty vector (i.e., pCAMBIA1300, carrying a hygromycin resistance gene) was double digested with Bam H I and Kpn I. The enzyme digestion systems are shown in Tables 6-8. The enzyme digestion conditions for plasmids SK-gRNA-PpRGL2-1 and SK-gRNA-PpRGL2-2 were 1 h at room temperature, and the enzyme digestion conditions for the pC1300-Cas9 empty vector were 1 h at 37°C.

[0039] Table 6 Double enzyme digestion system of plasmid SK-gRNA-PpRGL2-1

[0040] Table 7 Enzyme digestion reaction system of plasmid SK-gRNA-PpRGL2-2

[0041] Table 8 Enzyme digestion reaction system of empty vector pC1300-Cas9

[0042] After enzyme digestion, 3 μL of the digestion product was taken for gel electrophoresis detection. After the correct band size appeared (see Figure 4 ), the remaining product of the corresponding system was also subjected to gel electrophoresis. After electrophoresis, the gel was cut and recovered according to the Vazyme Kit steps.

[0043] The three enzyme digestion products were mixed in a molar concentration ratio of SK-gRNA-PpRGL2-1:SK-gRNA-PpRGL2-2:pC1300-Cas9=3:3:2, and T4 ligase was used for ligation. The ligation system is shown in Table 9, and the reaction conditions were 30 min at room temperature.

[0044] Table 9 Ligation system of SK-gRNA-PpRGL2-1 / 2 and pC1300-Cas9

[0045] The obtained ligation product was transformed into DH5α, and the medium resistance was Kan, and the transformation method was referred to step (1).

[0046] Positive identification: select a single colony of appropriate size and add it to 3 mL of LB liquid medium containing Kan (50 μg / mL), and incubate in a 37°C shaking incubator for 12 h. Take 0.2 μL of the bacterial solution as the amplification template for PCR identification. The PCR system is the same as Table 4, the PCR reaction program is the same as Table 5, and the primers are pC1300F (ACACTTTATGCTTCCGGCTC, SEQ ID NO. 6) and SK-gRNA-PpRGL2-R. The amplified product was detected by gel electrophoresis, and the positive sample (see Figure 5 ) was sent to the company for sequencing according to the band size.

[0047] The bacterial solution of the positive sample with correct sequencing results was taken 500 μL and added to an equal volume of 40% glycerol. After mixing, it was stored in a -80°C refrigerator. The remaining bacterial solution was extracted by alkali lysis method using the plasmid extraction kit of CWBIO company.

[0048] (3) Transform Agrobacterium.

[0049] In the clean bench, 1.5 mL EP tubes were taken, 35 μL of completely thawed Agrobacterium competent cells GV3101 were added, and then 2 μL of recombinant plasmid (pC1300-Cas9-PpRGL2 obtained in step (2)) was added. Mix gently by hand, ice bath for 5 min. Insert the EP tube into the floating foam plate, and immerse the bottom in liquid nitrogen for 5 min. Immediately place it in a 28°C constant temperature dry bath for 5 min, and then ice bath for 5 min. Add 700 μL of LB liquid medium to the EP tube in the clean bench, and incubate in a 28°C constant temperature shaking incubator for 2.5 h.

[0050] After incubation, centrifuge at 6000 rpm for 2 min, retain 150 μL of supernatant, resuspend the bacterial cells by gentle blowing, and spread on LB solid medium containing Kan (50 μg / mL) and Rif (50 μg / mL) double resistance. Seal the bottle with a film and invert in a 28°C constant temperature incubator for 72 h. Observe the growth of the bacterial cells during the period.

[0051] A single colony of appropriate size was selected and inoculated into 3 mL of LB liquid medium containing Kan (50 μg / mL) and Rif (50 μg / mL) and cultured in a 28°C, 180 rpm shaking incubator for 48 h. 0.4 μL of the bacterial solution was taken as a template for amplification and PCR identification, and the PCR system and reaction program were the same as Tables 2 and 3, and the primers were pC1300F and SK-gRNA-PpRGL2-R.

[0052] The positive identification results are shown in Table 4. Figure 6

[0053] Example 2 The present example provides a method for constructing a genetic transformation system of P. decursiva, comprising the following steps: (1) Planting of P. decursiva.

[0054] The petioles of wild P. decursiva were washed clean and then subjected to disinfection treatment with 75% ethanol and sodium hypochlorite solution, respectively, rinsed with sterile water and blown dry, and then inoculated into an induction medium (1 / 2 MS + NAA (1-naphthaleneacetic acid) 400 mg / L + TDZ (thidiazuron) 100 mg / L). When the callus grew to about 5x5 mm in size, it was transferred to a proliferation medium (1 / 2 MS + NAA 400 mg / L + KT (kinetin) 200 mg / L). After the callus proliferated for about 7 days, the size of the callus was about twice that of the size at the time of transfer. The callus was then transferred to a differentiation medium (B5 medium) for differentiation of adventitious buds and roots. When the number of true leaves of the callus differentiated plants was ≥3, the petiole length was >5 cm, the main root length was >3 cm, and the aseptic seedlings were relatively healthy and strong, with certain stress resistance, they were transferred to 24°C natural light for 3-6 days, and then soil-cultured.

[0055] (2) Preparation of Agrobacterium tumefaciens infiltration solution.

[0056] First, the recombinant Agrobacterium tumefaciens was prepared according to the method of Example 1. It can be understood that the skilled person can replace the PpRGL2 gene with the desired gene according to the actual situation, and replace the hygromycin resistance gene with other resistance genes as a selection marker, so as to construct different recombinant Agrobacterium tumefaciens for infection.

[0057] 3 μL of the recombinant Agrobacterium tumefaciens bacterial solution was inoculated into 3 mL of LB liquid medium containing Kan (50 μg / mL) and Rif (50 μg / mL), and cultured at 28°C, 180 rpm for 12 h. Then, it was transferred to 150 mL of LB liquid medium containing Kan (50 μg / mL) and Rif (50 μg / mL) for expansion culture, and cultured at 28°C, 180 rpm for 36 h. ​

[0058] The expanded bacterial solution was divided into 50 mL centrifuge tubes and centrifuged at 4000 rpm for 20 min. The supernatant was discarded, 120 mL of infection infiltration solution (see Table 10 for formula) was added, and the mixture was resuspended and mixed by blowing with a pipette gun. At this time, the OD of the bacterial solution was 0.8-1.0, i.e., the Agrobacterium tumefaciens infection infiltration solution was obtained. 600

[0059] Table 10 Formula of infection infiltration solution

[0060] (3) Infestation of inflorescences.

[0061] As shown in Figure 7 , the infestation of inflorescences includes the following processes: The flowering period of Peucedanum praeruptorum is from July to September. Select plants in full bloom, cut off the first primary inflorescences of the plants, promote the growth of lateral inflorescences, and perform inflorescence immersion within 3-7 days. Water the plants thoroughly the day before immersion to fully open the stomata of the plants. Trim off the already opened flowers and retain the racemose inflorescences in the bud stage to the early flowering stage (pollen not dispersed). Select well-grown, large-sized, and full-bodied inflorescences of Peucedanum praeruptorum as the immersion objects.

[0062] Soak the selected lateral inflorescences in the Agrobacterium tumefaciens infection infiltration solution for 1 min.

[0063] After all the infestations are completed, wrap the inflorescences with transparent and thin preservative bags to maintain a relative humidity of 60%-80%.

[0064] Remove the preservative bags after 2-3 days, and immerse again after 3 days. Repeat twice.

[0065] It should be noted that the infestation rate of different single plants (number of infested inflorescences per single plant / total number of inflorescences per single plant at the time of infestation x 100%) has a significant impact on the transformation rate of Peucedanum praeruptorum. See Table 11 for details.

[0066] Table 11 State of inflorescences and seed setting rate under different immersion rates

[0067] (4) Screening and identification.

[0068] 1. Plant seed collection and soil culture.

[0069] After the seeds mature, collect the seeds and perform sterile soil culture on the obtained mutant seeds.

[0070] ​The soil culture step is specifically as follows: the seeds are soaked in water and placed in a refrigerator at 4°C for vernalization for 3 days; the soil is sterilized by high-pressure steam at 121°C for 20 min, and after sterilization, the soil is mixed with ultrapure water, and the humidity is best when the soil can be formed into a ball after being held in hand but no water drops out; the vernalized mutant seeds are evenly sowed on the surface of the soil, and a thin layer of soil is then sowed on the surface after sowing, which can just cover the seeds but should not be too thick; the surface of the planting box is covered with a plastic wrap to maintain high humidity, and the box is labeled and placed in a greenhouse with good light at 25°C for seed germination; about 10 days later, the seeds germinate, about 20 days later, the first true leaf grows, about 30 days later, the height of the true leaf of the plant reaches 5 cm, about 50 days later, the number of true leaves of the plant is ≥3, and the height of the plant is ≥10 cm, at which time the plant can be transplanted to the field.

[0071] 2. Identification of T0 generation transgenic plants.

[0072] 1. Hygromycin positive identification.

[0073] The extracted plant DNA is used as a template, and hygromycin primers Hyg (i.e., Hyg-F and Hyg-R, the sequences of which are shown in SEQ ID NO. 7 and SEQ ID NO. 8, respectively) are used for PCR amplification to detect the hygromycin positive condition of the plant. The PCR reaction system is the same as Table 4, and the reaction procedure is the same as Table 5. The amplification product is detected by gel electrophoresis.

[0074] 2. Purpose gene editing identification.

[0075] Identification primers are set at positions about 150 bp upstream and downstream of the target site of the purpose gene to detect the mutation site of the transgenic plant. PCR reaction is performed using the identification primers, the PCR reaction system is the same as Table 4, and the reaction procedure is the same as Table 5. The amplification product is detected by gel electrophoresis, and the positive sample is selected according to the band size and sent to the company for sequencing to detect the purpose gene editing condition of the transgenic plant.

[0076] 3. Phenotype identification.

[0077] The dryness, grain length and grain width of the T0 generation seeds and wild type seeds are compared, and the T0 generation plants and wild type seeds are also germinated, and the growth conditions of the transgenic plants and wild type plants are observed and compared under the same conditions after germination.

[0078] Example 3 Based on the recombinant Agrobacterium tumefaciens prepared in Example 1 and the genetic transformation system construction method in Example 2, the T0 generation transgenic plants for the PpRGL2 gene are obtained in this example. PpRGL2

[0079] ​The DNA of the T0 generation transgenic plants was extracted by using the CTAB method to perform hygromycin positive identification and target gene editing identification. Moreover, according to the method in Example 2, the identification results are as follows: (1) Hygromycin positive identification.

[0080] The gel electrophoresis detection results are as shown in Figure 8 : all the transgenic samples are hygromycin positive (500 bp), and the negative control does not amplify the target band.

[0081] (2) Target gene identification.

[0082] For the PpRGL2 gene and its target, the sequences (5'-3') of the primers used for identification are as follows: KO- PpRGL2 -F: TTAACTGAGATTATAGT (SEQ ID NO. 9); KO- PpRGL2 -R: TTCCCCAGCTAGTCGTA (SEQ ID NO. 10).

[0083] The gel electrophoresis detection results are as shown in Figure 9 : all the transgenic samples amplify the target band (600 bp), and the negative control does not amplify. The sequencing shows that the editing of the PpRGL2 gene of each transgenic plant is as shown in Table 12.

[0084] Table 12 Target point editing statistics in pC1300-Cas9-PpRGL2 T0 plants

[0085] (3) Phenotype identification.

[0086] The phenotype difference is as shown in Figures 10-11 : from the appearance, compared with the wild type, the seeds of T0 are more shriveled, and the grain length and grain width are significantly smaller than those of the wild type ( Figure 10 ); the transgenic plants have no obvious difference from the wild type ( Figure 11 ).

[0087] It should be noted that the present application is not limited to the above-mentioned embodiments. The above-mentioned embodiments are only examples, and embodiments having the same technical idea and playing the same role within the scope of the technical solutions of the present application are all included in the technical scope of the present application. In addition, within the scope of the main idea of the present application, various modifications that can be thought of by those skilled in the art, and other ways constructed by combining part of the components in the embodiments are also included in the scope of the present application.

Claims

1. A method for constructing a genetic transformation system of Radix Puerariae, characterized in that, It comprises the following steps: S1, constructing recombinant Agrobacterium carrying a target gene and a screening marker and preparing the same into an Agrobacterium infection infiltration solution; S2, soaking the lateral inflorescences of the plant of Peucedanum praeruptorum in the flower bud stage to the initial flowering stage in the Agrobacterium infection infiltration solution for infection, and culturing in a bag after the infection is completed; S3, collecting seeds after the seeds of Peucedanum praeruptorum obtained in step S2 mature, and performing positive identification.

2. The construction method according to claim 1, characterized in that, The Agrobacterium infection infiltration solution is composed of recombinant Agrobacterium and an infection infiltration solution, and the infection infiltration solution contains 10 % sucrose and 400 μL / L Silwet-77.

3. The construction method of claim 2, wherein, The OD of the agrobacterium infection infiltration solution 600 was 0.8-1.

0.

4. The construction method of claim 1, wherein, The recombinant Agrobacterium is constructed by using a GV3101 strain.

5. The construction method of claim 1, wherein, The preparation method of the plant of Peucedanum praeruptorum in step S2 is as follows: taking leaf stalks of Peucedanum praeruptorum, disinfecting, washing and drying, inducing culture to obtain callus, proliferating and differentiating the callus, and then culturing until the number of true leaf blades of the plant is ≥3, the length of the leaf stalk is >5 cm, and the length of the main root is >3 cm, and then transplanting and soil culturing.

6. The construction method of claim 1, wherein, Step S2 is specifically as follows: cutting the primary main inflorescence of the plant of Peucedanum praeruptorum to promote the growth of lateral inflorescences, and performing inflorescence infection within 3-7 days, and fully watering the day before the infection; during the infection, removing the flowers that have bloomed, retaining the compound cyme in the flower bud stage to the initial flowering stage, and soaking the inflorescence in the Agrobacterium infection infiltration solution for infection.

7. The construction method of claim 6, wherein, The infection is specifically as follows: first, soaking the inflorescence in the Agrobacterium infection infiltration solution for 1 min, then wrapping the inflorescence with a transparent preservative bag, maintaining the relative humidity at 60 %-80 %, removing the preservative bag after 2-3 days, removing the preservative bag again after 3 days, and repeating the above operation for a total of 3 times of infection.

8. The construction method of claim 7, wherein, The infection rate of the inflorescence is 40-55 %, and the infection rate = the number of infected inflorescences of a single plant / the total number of inflorescences of the single plant at the time of infection × 100 %.

9. The construction method of claim 1, wherein, It further comprises the following steps: S4, planting the positive seeds of T0 generation to obtain transgenic plants.

10. Application of the construction method according to any one of claims 1-9 in the preparation of transgenic Peucedanum praeruptorum materials.

Images