SNP marker, primer pair, kit and application for identifying genetic sex of soft-shelled turtle (apalone snelli)

By applying SNP markers and primer pairs to Chinese softshell turtles, early, rapid, and efficient sex identification of Chinese softshell turtles has been achieved, solving the problems of long sex identification cycles and low accuracy in existing technologies, and improving breeding efficiency and economic benefits.

CN120966976BActive Publication Date: 2026-04-14PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
Filing Date
2025-10-20
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

In existing technologies, sex identification of Chinese softshell turtles is time-consuming, has low accuracy and efficiency, and is difficult to achieve accurate identification in the juvenile stage. Furthermore, the tissue section method is highly invasive and not suitable for large-scale farming.

Method used

This invention provides an SNP marker, its detection primer pair, and a kit to enable rapid and efficient identification of the genetic sex of the Chinese softshell turtle by detecting the C/T polymorphism at the 78th base of the nucleotide sequence, and to determine the genotype using PCR amplification and Sanger sequencing.

Benefits of technology

This technology enables early, rapid, efficient, and accurate sex identification of Chinese softshell turtles, reduces breeding costs, improves screening efficiency and selection intensity, and promotes the high-quality development of the Chinese softshell turtle farming industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120966976B_ABST
    Figure CN120966976B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of molecular marker assisted breeding, and particularly relates to a SNP marker for genetic sex identification of Pelodiscus sinensis, a primer pair, a kit and application, wherein the SNP marker is located at the 78th base of a nucleotide sequence shown as SEQ ID NO. 3 and / or 4, and when the 78th base is a CC genotype, the to-be-tested Pelodiscus sinensis individual is male, and when the 78th base is a CT genotype, the to-be-tested Pelodiscus sinensis individual is female. The present application provides a SNP marker for genetic sex identification of Pelodiscus sinensis, which provides a key tool for realizing sex identification and sex control breeding of Pelodiscus sinensis. Through detection of the genotype of the molecular marker, sex prediction and identification are performed at a genetic level, and the present application has the advantages of rapidness, high efficiency, high throughput, small interference of environmental factors, high accuracy, good reliability, short selection cycle and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker-assisted breeding technology, and in particular to an SNP marker, primer pair, kit, and application for genetic sex identification of the Chinese softshell turtle. Background Technology

[0002] The Chinese softshell turtle (Palea steindachneri), belonging to the class Reptilia, order Chelonia, family Trionychidae, and genus Palea, is commonly known as the mountain turtle, softshell turtle, or turtle. It possesses extremely high economic and ecological value, holding an important position in both the artificial breeding industry and biological resource conservation. It is one of my country's important medicinal and edible aquatic products. The artificial breeding industry of Chinese softshell turtles has reached a large-scale development trend. The economic value of individuals of different sexes differs significantly: female Chinese softshell turtles, due to their continuous egg-laying ability, are the core resource for breeding and maintaining the reproductive cycle of the farmed population; male Chinese softshell turtles, due to their faster growth rate and more robust body shape, have higher economic benefits in commercial turtle farming. Therefore, in the process of large-scale Chinese softshell turtle farming, if early and accurate sex identification can be achieved, "targeted breeding" of male and female individuals and separate ponds for each sex can be carried out, significantly reducing the waste of resources such as feed and space, and significantly improving the efficiency and profitability of the aquaculture industry.

[0003] Currently, sex determination in Chinese softshell turtles mainly relies on visual identification and histological sectioning. Adult Chinese softshell turtles exhibit significant dimorphism in appearance, allowing for sex determination based on physical characteristics such as tail length (males have longer tails with the tip protruding from the carapace skirt, while females have shorter tails that do not protrude), cloacal opening location (males have the cloacal opening on the outer side of the carapace skirt, while females have it on the inner side), and hind limb spacing (males have a narrower hind limb spacing, while females have a wider spacing). However, sex determination based on morphological characteristics requires waiting until sexual maturity. In the juvenile stage, males and females are very similar in appearance, making sex determination based on body shape impossible. Furthermore, the growth cycle is long, with sexual maturity at 5-6 years of age, resulting in a lengthy sex determination process. This method is also susceptible to individual growth status (such as morphological variations caused by malnutrition), leading to low accuracy. Histological sectioning involves sex determination through gonadal tissue, but this requires dissection and collection of gonadal tissue, which is invasive, easily leading to individual mortality, and cannot efficiently process large batches of samples from multiple populations, making it unsuitable for early sex determination in large-scale aquaculture.

[0004] By utilizing molecular markers closely linked to genetic sex, and through DNA extraction and PCR detection, molecular marker loci in candidate individuals can be identified and selected, enabling rapid sex determination at various developmental stages (especially the embryonic or juvenile stages). Currently, among turtles, molecular marker-based sex determination technology has been developed for the Chinese softshell turtle (Trionyx sinensis). The sex determination mechanism of the Chinese softshell turtle is ZW-type, and genomic sequencing information is available for comparison and screening of sex-identifying molecular markers. Detection of the female-specific W chromosome facilitates rapid differentiation between male and female individuals. However, genome sequencing of the Chinese softshell turtle (Trionyx sinensis) has not yet been conducted; publicly available databases such as NCBI only contain its mitochondrial genome sequence. Research reports on molecular markers with clearly defined functions, validated effectiveness, and direct applicability for genetic testing are scarce. Therefore, exploring sex-related molecular markers and establishing marker-assisted selection methods will greatly solve the problem of genetic sex determination in the Chinese softshell turtle. Summary of the Invention

[0005] To address the problems of long identification cycles, low accuracy, and / or low efficiency in existing technologies for sex identification of the Chinese softshell turtle, this invention provides a SNP marker for genetic sex identification of the Chinese softshell turtle. This provides a key tool for sex identification and sex-controlled breeding of the Chinese softshell turtle. By detecting the genotype of this molecular marker, sex prediction and identification can be performed at the genetic level, offering advantages such as speed, efficiency, high throughput, minimal interference from environmental factors, high accuracy, high reliability, and short selection cycle. Therefore, this invention provides the application of this SNP marker, its detection primer pairs, or kits in the sex identification of the Chinese softshell turtle. This invention is specifically implemented through the following technical solutions:

[0006] The first aspect of this invention provides an application of SNP markers, primer pairs, or kits for the genetic sex identification of Chinese softshell turtles; the SNP marker is located at the 78th base of the nucleotide sequence shown in SEQ ID NO.3 and / or 4, exhibits C / T polymorphism, and has CT and CC genotypes;

[0007] Specifically, when the 78th base is of the CC genotype, the tested soft-shelled turtle is male; when the 78th base is of the CT genotype, the tested soft-shelled turtle is female.

[0008] A second aspect of the present invention provides a primer pair for genetic sex identification of the Chinese softshell turtle, the primer pair being used to detect SNP markers located at the 78th base of the nucleotide sequence shown in SEQ ID NO. 3 and / or 4, exhibiting C / T polymorphism;

[0009] The primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2.

[0010] A third aspect of the present invention provides a kit for genetic sex identification of the Chinese softshell turtle, the kit comprising the primer pairs described above.

[0011] Furthermore, the kit also includes PCR amplification reagents, which include Taq DNA polymerase, dNTPs, and buffer reagents.

[0012] The fourth aspect of this invention provides a method for identifying the sex of the Chinese softshell turtle, comprising the following steps:

[0013] Genomic DNA was extracted from the individuals of the Chinese softshell turtle to be tested;

[0014] The genomic DNA was amplified by polymerase chain reaction using primer pairs as shown in SEQ ID NO.1-2 to obtain amplification products;

[0015] The genotype of the 78th base of the amplification product is detected, and the sex of the tested soft-shelled turtle is determined based on the genotype.

[0016] The amplified product has CC and CT genotypes at position 78. When it is CC genotype, the tested soft-shelled turtle is determined to be male, and when it is CT genotype, the tested soft-shelled turtle is determined to be female.

[0017] Furthermore, if the amplification product is detected to include only the nucleotide sequence shown in SEQ ID NO.3, the tested soft-shelled turtle individual is determined to be male; if the amplification product is detected to include both the nucleotide sequences shown in SEQ ID NO.3 and 4, the tested soft-shelled turtle individual is determined to be female.

[0018] Furthermore, the PCR amplification reaction system, in 40 μL increments, comprises: 20 μL of 2×Taq Master Mix, 1.6 μL of upstream primer, 1.6 μL of downstream primer, 1 μL of genomic DNA, and 15.8 μL of deionized water.

[0019] Furthermore, the PCR amplification reaction program includes: 94 °C pre-denaturation for 3 min, 94 °C denaturation for 30 s, 60 °C annealing for 30 s, 72 °C extension for 15 s, for a total of 35 cycles; running at 72 °C for 5 min; and storing the amplification reaction solution at 4 °C for later use.

[0020] Furthermore, the genotype was detected using Sanger sequencing.

[0021] The advantages and positive effects of this invention are as follows:

[0022] The SNP molecular markers closely linked to the genetic sex traits of the Chinese softshell turtle provided by this invention offer a crucial tool for sex identification and sex-controlled breeding of this species. By transforming the determination of individual sex traits in Chinese softshell turtles into the determination of SNP molecular marker genotypes, it facilitates early targeted breeding in the Chinese softshell turtle farming industry, significantly reducing farming costs, improving farming efficiency, and promoting the high-quality and sustainable development of the Chinese softshell turtle farming industry. Moreover, sex prediction and identification at the genetic level has advantages such as speed, efficiency, high throughput, and minimal interference from environmental factors. It greatly improves the screening efficiency and selection intensity of male and female individuals of Chinese softshell turtles and significantly shortens the selection cycle, thereby improving the accuracy and reliability of early sex selection in Chinese softshell turtles. It has broad application prospects and social significance in the field of Chinese softshell turtle sex identification. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 This is an agarose gel electrophoresis image of the SNP marker amplification products used for genetic sex identification of the Chinese soft-shelled turtle according to an embodiment of the present invention;

[0025] Figure 2 This is a diagram showing the comparison results between the mitochondrial genome of the Chinese softshell turtle and the NCBI online database in an embodiment of the present invention;

[0026] Figure 3 This is a sequencing peak diagram of the genetic sex SNP marker amplification products in female Chinese softshell turtles according to an embodiment of the present invention;

[0027] Figure 4 This is a sequencing peak diagram of the genetic sex SNP marker amplification products in male Chinese softshell turtles according to an embodiment of the present invention;

[0028] Figure 5 This is a sequencing comparison diagram of different genotypes of genetic sex SNP markers in male and female soft-shelled turtles according to an embodiment of the present invention. Detailed Implementation

[0029] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0030] Based on the information contained herein, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0031] To better understand the invention and not to limit its scope, all figures and other numerical values ​​used in this invention to indicate amounts, percentages, or other quantities should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.

[0032] The terms “comprising,” “including,” “containing,” “having,” and similar words are non-restrictive and can include other steps and other components that do not affect the result. The term “and / or” should be considered as a specific disclosure of each of the two specified features or components, with or without the other. For example, “A and / or B” is considered to include (i) A, (ii) B, and (iii) A and B.

[0033] To make the above-mentioned objectives, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below.

[0034] Single nucleotide polymorphism (SNP) molecular markers refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level, including single-base transversions, transitions, insertions, and deletions. They are the most numerous and widely distributed molecular markers in the genome, possessing advantages such as ease of genotyping, good genetic stability, and ease of automation and batch processing, and are considered the most valuable next-generation genetic markers. Developing novel SNP molecular markers associated with or linked to the sex specificity of the Chinese softshell turtle will provide a powerful tool and detection method for early sex molecular identification of the Chinese softshell turtle.

[0035] The Chinese softshell turtle lacks complete whole-genome information. This invention first performed whole-genome resequencing on 20 randomly selected Chinese softshell turtles. The raw high-throughput sequencing data was quality filtered to assemble the genome data. Then, the differences between the sequenced genomes of male and female individuals were compared to obtain SNP genotyping data. Association analysis with sex was performed to identify SNP variants on the sex chromosome (Z / W chromosome) that are closely linked to the sex trait of the Chinese softshell turtle, named SRB_SNP (SRB is short for Chinese softshell turtle). Primers were designed to specifically amplify the SNP locus. Population testing was conducted using 16 samples (8 females and 8 males) to further verify the association between the genotype of this SNP locus and the sex of the Chinese softshell turtle. Therefore, SRB_SNP can be developed as a sex-specific SNP molecular marker for genetic sex identification.

[0036] The genetic sex determination mechanism of the Chinese softshell turtle is ZW-type. Females have a ZW sex chromosome composition, while males have a ZZ sex chromosome composition. The SRB_SNP locus is C on the Z chromosome and T on the W chromosome. Therefore, in females, the SRB_SNP locus represents the CT genotype, while in males, it represents the CC genotype.

[0037] Based on this, one embodiment of the present invention provides the application of SNP markers, primer pairs, or kits for genetic sex identification of Chinese softshell turtles in the sex identification of Chinese softshell turtles; the SNP marker is located at the 78th base of the nucleotide sequence shown in SEQ ID NO. 3 and / or 4, exhibiting C / T polymorphism, and having CT and CC genotypes; wherein, when the 78th base is the CC genotype, the Chinese softshell turtle to be tested is male, and when the 78th base is the CT genotype, the Chinese softshell turtle to be tested is female.

[0038] The SNP molecular markers closely linked to the genetic sex traits of the Chinese softshell turtle provided by this invention offer a crucial tool for sex identification and sex-controlled breeding of this species. By transforming the determination of an individual's sex trait into the determination of the SNP molecular marker genotype, it facilitates early targeted breeding in the Chinese softshell turtle aquaculture industry. Specifically, by detecting the genotype of this molecular marker during the seedling or juvenile stage, sex can be rapidly identified. Female individuals can then be introduced into breeding ponds to ensure reproduction, while male individuals are bred into marketable turtles. This significantly reduces breeding costs, improves breeding efficiency, and promotes the high-quality and sustainable development of the Chinese softshell turtle aquaculture industry. Furthermore, this invention performs sex prediction and identification at the genetic level, offering advantages such as speed, efficiency, high throughput, and minimal interference from environmental factors. It solves the problems of inaccurate sex determination by visual inspection before gonadal maturity and the long sex identification cycle, greatly improving the screening efficiency and selection intensity of male and female Chinese softshell turtles and significantly shortening the selection cycle. This enhances the accuracy and reliability of early sex selection in Chinese softshell turtles, demonstrating broad application prospects and social significance in the field of Chinese softshell turtle sex identification.

[0039] The detection of the SNP marker genotype of this invention can be performed using methods commonly used in the prior art, such as gene chip technology, competitive allele-specific PCR (KASP) technology, Taqman probe technology, high-resolution melting curve (HRM) method, allele-specific PCR (AS-PCR) technology, direct sequencing method, and matrix-assisted laser desorption / ionization time-of-flight mass spectrometry.

[0040] This invention preferably employs a direct sequencing method, including the steps of extracting genomic DNA from the individual soft-shelled turtle to be tested, PCR amplification of the target fragment, and sequencing of the target fragment. In the sequencing peak diagram, a homozygous SNP marker genotype shows a single peak, while a heterozygous genotype shows a double peak, making it easy to distinguish between different genotypes. Specifically, in the sequencing peak diagram, a single peak of C at position 78 indicates the CC genotype, while a double peak of CT indicates the CT genotype.

[0041] Another embodiment of the present invention provides a primer pair for genetic sex identification of the Chinese softshell turtle. The primer pair is used to detect the SNP markers as described above. The primer pair includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer (F) is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer (R) is shown in SEQ ID NO.2.

[0042] SRB_SNP_F: AACACAGACTCGTTTTTCAG (see SEQ ID NO.1);

[0043] SRB_SNP_R: AGATTCCGCCATTCCAGTG (see SEQ ID NO. 2).

[0044] This invention uses the genomic DNA of the Chinese softshell turtle to be tested as a template, performs PCR amplification using the above-mentioned detection primer pair, and sequences the amplification product to obtain accurate base information of the SNP marker site (base position 78 of the amplification product). The primers have high specificity and good molecular marker genotyping effect, which is conducive to the rapid, accurate and efficient identification of SNP marker genotypes, and thus the identification of the sex of the Chinese softshell turtle individual to be tested.

[0045] In a typical implementation, when the amplification product is detected to include only the nucleotide sequence shown in SEQ ID NO.3, the SNP is labeled as CC genotype, and the tested softshell turtle individual is predicted or determined to be male; when the amplification product is detected to include both the nucleotide sequences shown in SEQ ID NO.3 and 4, the SNP is labeled as CT genotype, and the tested softshell turtle individual is predicted or determined to be female.

[0046] In practical applications, since there are other variant sites downstream of the molecular marker site of the present invention that are not completely linked to sex, the amplification product may also include other sequences besides those shown in SEQ ID NO.3 and / or 4; the variant type (C / T polymorphism) and genotype of the 78th base in these sequences are completely linked to sex. Therefore, in the preferred embodiment of the present invention, the 78th base of the amplification product is used as an independent detection target.

[0047] Another embodiment of the present invention provides a kit for genetic sex identification of the Chinese softshell turtle, the kit comprising the primer pairs described above.

[0048] The advantages of the kit over existing technologies are the same as those of the detection primers described above, and will not be repeated here.

[0049] Optionally, the kit may also include PCR amplification reagents. The present invention does not have any special limitation on the source of the PCR amplification reagents, and conventional commercially available products in the art can be used.

[0050] In a typical implementation, the PCR amplification reagents include Taq DNA polymerase, dNTPs, and buffer reagents, such as the 2×Taq Master Mix (Dye) kit from Jiangsu Kangwei Century Technology Co., Ltd.

[0051] This invention does not impose specific limitations on the total amount of PCR amplification reagents and detection primers in the kit; the amounts can be set according to the standard requirements of the kit. Generally, the concentrations of the upstream and downstream primers are 10-20 mM, which is usually the concentration of the stock solution.

[0052] Based on the same inventive concept as described above, another embodiment of the present invention provides a method for identifying the sex of the Chinese softshell turtle, comprising the following steps:

[0053] Genomic DNA was extracted from the individuals of the Chinese softshell turtle to be tested;

[0054] The genomic DNA was amplified by polymerase chain reaction (PCR) using the primer pairs shown in SEQ ID NO.1-2 to obtain the amplification product;

[0055] The genotype of the 78th base of the amplification product is detected, and the sex of the tested soft-shelled turtle is determined based on the genotype.

[0056] Among them, the 78th base of the amplification product has CC and CT genotypes. When it is CC genotype, the tested soft-shelled turtle is male, and when it is CT genotype, the tested soft-shelled turtle is female.

[0057] This invention does not specifically limit the method for extracting genomic DNA from individual soft-shelled turtles. Commonly used genomic DNA extraction methods in the field can be used, such as the commonly used phenol-chloroform crude extraction method or CTAB extraction method, or commercially available genomic DNA extraction kits, such as the general-purpose column-type genomic DNA extraction kit from Jiangsu Kangwei Century Technology Co., Ltd.

[0058] Optionally, the PCR amplification reaction system, in 40 μL, comprises: 20 μL of 2×Taq Master Mix (Dye), 1.6 μL of upstream primer, 1.6 μL of downstream primer, 1 μL of genomic DNA, and 15.8 μL of deionized water (ddH2O).

[0059] Optionally, the PCR amplification reaction program includes: 94 °C pre-denaturation for 3 min, 94 °C denaturation for 30 s, 60 °C annealing for 30 s, 72 °C extension for 15 s, for a total of 35 cycles; running at 72 °C for 5 min; and storing the amplification reaction solution at 4 °C for later use.

[0060] Optionally, the genotype of the 78th base of the amplification product can be detected by Sanger sequencing.

[0061] The present invention will be further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory, or generally under the conditions recommended by the manufacturer.

[0062] 1. Experimental group

[0063] The 20 Chinese softshell turtles used for genome resequencing and the 16 Chinese softshell turtles used for population validation of molecular markers were all from the Turtle and Softshell Turtle Breeding and Conservation Research Base of the Pearl River Fisheries Research Institute. After confirming that they were free of infection on their body surface and were active normally, they were used for subsequent genome extraction.

[0064] 2. Gender determination

[0065] The sex phenotype of the tested individuals was determined by collecting sexually mature individuals and observing their gonadal phenotypes after dissection. The Chinese softshell turtles were cultured to sexual maturity, and preliminary classification was performed based on morphological observation. Female Chinese softshell turtles had short tails that did not protrude from their ventral margins, wide-set hind legs, and thicker bodies; males had long tails with the tail tip protruding from their ventral margins, narrow-set hind legs, and thinner bodies. Each individual was then anesthetized in an ice box. After anesthesia, the entire body was disinfected with 75% ethanol to remove contaminants. The genital opening was then cut open to observe the gonads, ultimately determining the sex.

[0066] 3. Whole-genome resequencing and sex association analysis of the experimental population

[0067] Muscle tissue was collected from three-year-old Chinese softshell turtles. Genomic DNA was extracted from the samples using a universal column-type genomic DNA extraction kit (purchased from Jiangsu Kangwei Century Technology Co., Ltd., catalog number CW2298M). The operation steps were performed according to the instruction manual.

[0068] After quality control of the extracted genomic DNA, high-throughput resequencing of the genome was performed using the DNBSEQ platform, with a sequencing depth of approximately 15×, a pair-end 150bp sequencing strategy, and a sequencing throughput of approximately 33Gb. Read alignment and filtering (Clean Reads) were performed on the sequencing data to obtain high-quality whole-genome resequencing data. Base identification was performed on the raw image data obtained from the resequencing using CASAVA software, and these raw sequence data were further converted to FASTQ format. However, these raw data often contain sequencing adapter sequences and low-quality reads; therefore, strict filtering was required before further analysis. SOAPnuke (v2.1.0) software developed by BGI Genomics Co., Ltd. was used to remove reads contaminated by adapters, reads with excessively low base quality (i.e., bases with a quality value of 12 or less accounting for 50%), and reads containing too many N bases (more than 10%). The resulting high-quality Clean Data was used for subsequent analysis (after filtering, Clean Data Q20 was greater than 90%, and Q30 was greater than 80%). The aforementioned work was commissioned to Guangzhou Ruike Gene Technology Co., Ltd.

[0069] The assembled genome underwent quality control. The mitochondrial sequencing sequence (composed of SEQ ID NO. 5 + SEQ ID NO. 6 nucleotide sequences) was selected and found to have a similarity of over 99% with the mitochondrial DNA sequences of *Trionyx sinensis* (GenBank: KX882746.1, GenBank: OL405264.1, etc.) in the NCBI database. The sequence alignment results are shown below. Figure 2 The sequencing and assembly data confirmed that it was indeed the genome data of the Chinese softshell turtle, which can be used for the subsequent development of sex-specific molecular markers.

[0070] BWA alignment software was used to align paired-end (PaiR-end) sequencing data using the mem alignment strategy. Default alignment parameters were employed. After alignment, samtools (version 1.14) was used to sort the aligned sequences. Following alignment, DeepvaRiant software with default parameters was used to detect SNP variants across the entire genome, and samtoolsmpileup and Python programs were used for secondary verification of molecular marker genotypes.

[0071] Based on whole-genome sequencing data and chromosome-level genome assembly results, it was confirmed that the Chinese softshell turtle has a ZW-type sex determination mechanism. Therefore, the Chinese softshell turtle has a ZW-type sex determination mechanism. SNP loci on the sex chromosomes that meet the criteria of homozygous genotype in males (Z chromosome) and heterozygous genotype in females (Z chromosome and W chromosome) were selected as potential genetic sex-associated molecular markers.

[0072] Based on the gene sequences assembled from high-throughput sequencing data analysis, a sex-specific SNP locus was discovered in male and female samples of the Chinese softshell turtle, named SRB_SNP. SRB_SNP is located at base 78 of SEQ ID NO. 3 and / or 4, exhibiting C / T polymorphism (sequence alignment results are shown in...). Figure 5 The sequence shown in SEQ ID NO.3 is located on chromosome Z, and the corresponding nucleotide for SRB_SNP is C. The sequence shown in SEQ ID NO.4 is located on chromosome W, and the corresponding nucleotide for SRB_SNP is T. Therefore, SRB_SNP has both CT and CC genotypes. In female individuals, this locus has the CT genotype, and in male individuals, this locus has the CC genotype. The sequence information of SRB_SNP is as follows, with the shaded and bolded positions indicating the SRB_SNP sites:

[0073]

[0074]

[0075] It should be noted that, in the analysis and verification of samples from the Chinese softshell turtle population, the variation type of the 78th base (SRB_SNP) in the sequence shown in SEQ ID NO.3 and / or 4 is completely linked to the sex phenotype. Although other variation sites exist downstream of the SRB_SNP, these variation sites are not completely linked to sex. For example, the A / T polymorphism at position 110 of the sequence shown in SEQ ID NO.3 and / or 4 may be mutated in some male and female individuals, while being completely identical in others. Therefore, these variation sites are not considered for detection in this invention. Furthermore, based on these variations, sequences containing the SRB_SNP molecular marker include, but are not limited to, the sequences shown in SEQ ID NO.3 and / or 4, as well as sequences identical at position 78 of the sequence shown in SEQ ID NO.3 and / or 4, but with minor variations at other positions such as positions 110 and 114.

[0076] 4. Molecular marker validation at the natural population level

[0077] Primers were designed for the aforementioned sex-specific SNP loci. Genomic DNA was extracted from 16 randomly selected population samples (8 females and 8 males) for PCR amplification. Sanger sequencing was then used to verify the SNP genotypes and their association with sex. The final sex of the population samples was confirmed by observing the gonads after dissection. Eight female samples were named SR-F1 to SR-F8, and eight male samples were named SR-M1 to SR-M8.

[0078] 4.1 PCR detection primer sequence design

[0079] Based on the genome sequence and upstream and downstream sequences of molecular markers assembled from high-throughput sequencing data analysis, PCR validation primer pairs SRB_SNP_F and SRB_SNP_R were designed using Primer3 version 4.1.0 software (web link: https: / / bioinfo.ut.ee / primer3-0.4.0 / ). The primer sequences are as follows, with upstream and downstream primers denoted by F and R, respectively:

[0080] SRB_SNP_F: AACACAGACTCGTTTTTCAG (see SEQ ID NO.1);

[0081] SRB_SNP_R: AGATTCCGCCATTCCAGTG (see SEQ ID NO. 2).

[0082] The amplification product is 214 bp in size, and SRB_SNP is located at the 78th base of the amplification product (nucleotide sequence as shown in SEQ ID NO.3 or 4, with the underlined part indicating the primer sequence).

[0083] 4.2 PCR amplification and band detection

[0084] Muscle tissue was collected from three-year-old Chinese softshell turtles, and the genome was extracted using a universal column-type genomic DNA extraction kit from Jiangsu Kangwei Century Technology Co., Ltd.

[0085] PCR amplification was performed using extracted genomic DNA as a template. The PCR amplification system (40 μL) consisted of: 20 μL of 2×TaqMaster Mix (Dye) (purchased from Jiangsu Kangwei Century Technology Co., Ltd., catalog number CW0682L), 1.6 μL of upstream primer, 1.6 μL of downstream primer, 1 μL of genomic DNA, and 15.8 μL of deionized water (ddH2O). The reaction program included: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 60℃ annealing for 30 s, and 72℃ extension for 15 s, for a total of 35 cycles; followed by a 5-min run at 72℃. The amplified reaction solution was stored at 4℃ for later use.

[0086] 3 μL of the amplification product was subjected to electrophoresis on a 1.1% agarose gel at 160V for 30 min. The electrophoresis gel image is shown below. Figure 1 As shown, lane M is the molecular marker (DM2000, purchased from Jiangsu Kangwei Century Biotechnology Co., Ltd., catalog number CW0632M). The DM2000 DNA marker consists of six DNA fragments, with lengths of 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp, respectively. Lanes 1-16 represent female samples SR-F1 to SR-F8 and male samples SR-M1 to SR-M8, respectively. The amplified fragment size is 214 bp, exhibiting a single target band, demonstrating the good specificity of the detection primers.

[0087] The gel electrophoresis bands were cut off, the amplification products were recovered, and Sanger sequencing was performed. The sequencing peak diagrams of female and male SRB_SNPs are shown in Figures 3-4. The sequencing results were analyzed using Codoncode software. After removing low-quality bases, the sequences were spliced ​​to obtain the PCR product sequences. Sequence alignment confirmed the genotypes of the SNP loci. The sequence alignment results for female and male individuals are shown in Figures 3-4. Figure 5 .

[0088] In male individuals (sex chromosome ZZ), SRB_SNP sequencing only yielded individuals with the CC genotype, whose sequencing sequence is shown in SEQ ID NO.3 or is a sequence identical to the sequence shown in SEQ ID NO.3 at position 78, with minor variations at other sites; in female individuals (sex chromosome ZW), SRB_SNP sequencing only yielded individuals with the CT genotype, whose sequencing sequence is shown in SEQ ID NO.3-4 or is a sequence identical to the sequence shown in SEQ ID NO.3-4 at position 78, with minor variations at other sites.

[0089] Sex was classified based on the SRB_SNP molecular marker genotype: females were heterozygous and males were homozygous, specifically: the genotype of female samples at the SRB_SNP was CT, and the genotype of male samples was CC. The sex information based on the SNP locus genotype was consistent with the sex information confirmed by physiological anatomy (see Table 1), demonstrating that the SRB_SNP molecular marker of this invention is completely linked to sex, and its genotype can be used for rapid identification of the genetic sex of the Chinese softshell turtle, with a sex differentiation accuracy of 100%.

[0090] Table 1. Statistics on SNP loci genotypes and inherited sex

[0091]

[0092] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of a primer pair or kit for detecting SNP markers in the genetic sex identification of the Chinese softshell turtle, characterized in that, The SNP marker is located at the 78th base of the nucleotide sequence shown in SEQ ID NO.3 and / or 4, exhibiting C / T polymorphism and having CT and CC genotypes; Among them, when the 78th base is CC genotype, the tested soft-shelled turtle is male, and when the 78th base is CT genotype, the tested soft-shelled turtle is female. The primer pair includes an upstream primer and a downstream primer, the nucleotide sequences of which are shown in SEQ ID NO.1-2, respectively, and the kit includes the primer pair.

2. The application of the primer pair or kit for detecting SNP markers for genetic sex identification of the Chinese softshell turtle according to claim 1 in the sex identification of the Chinese softshell turtle, characterized in that, The kit also includes PCR amplification reagents, which include Taq DNA polymerase, dNTPs, and buffer reagents.

3. Primer pairs for genetic sex identification of the Chinese softshell turtle, characterized in that, The primer pair is used to detect SNP markers located at the 78th base of the nucleotide sequence shown in SEQ ID NO. 3 and / or 4, exhibiting C / T polymorphism; the primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

2.

4. A kit for genetic sex identification of the Chinese softshell turtle, characterized in that, The kit includes the primer pair as described in claim 3.

5. A method for determining the sex of the Chinese softshell turtle, characterized in that, Includes the following steps: Genomic DNA was extracted from the individuals of the Chinese softshell turtle to be tested; The genomic DNA was amplified by polymerase chain reaction using primer pairs as shown in SEQ ID NO.1-2 to obtain amplification products; The genotype of the 78th base of the amplification product is detected, and the sex of the tested soft-shelled turtle is determined based on the genotype. The amplified product has CC and CT genotypes at position 78. When it is CC genotype, the tested soft-shelled turtle is determined to be male, and when it is CT genotype, the tested soft-shelled turtle is determined to be female.

6. The method for identifying the sex of the Chinese softshell turtle according to claim 5, characterized in that, When the amplification product is detected to contain only the nucleotide sequence shown in SEQ ID NO.3, indicating the CC genotype, the tested softshell turtle individual is determined to be male; when the amplification product is detected to contain both the nucleotide sequences shown in SEQ ID NO.3 and 4, indicating the CT genotype, the tested softshell turtle individual is determined to be female.

7. The method for identifying the sex of the Chinese softshell turtle according to claim 5, characterized in that, The polymerase chain reaction amplification reaction system, in 40 μL volume, includes: 20 μL of 2×Taq Master Mix, 1.6 μL of upstream primer, 1.6 μL of downstream primer, 1 μL of genomic DNA, and 15.8 μL of deionized water; The polymerase chain reaction amplification procedure includes: pre-denaturation at 94 °C for 3 min; denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 15 s, for a total of 35 cycles; and running at 72 °C for 5 min.

8. The method for identifying the sex of the Chinese softshell turtle according to claim 5, characterized in that, The genotype was detected using Sanger sequencing.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) marker linked with genetic sex of Chinese softshell turtles as well as primer and application thereof

    CN115232882A

  • Molecular marker for identifying sex of wattle-necked softshell turtle, primer pair and application thereof

    CN116042796A