A group b streptococcus typing detection multiplex pcr primer and probe composition and kit
By using multiplex PCR primer and probe combinations and flow-through hybridization gene chip technology, the accuracy problem of Group B Streptococcus serotyping detection has been solved, achieving highly sensitive and specific detection and reducing the risk of neonatal infection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- CHAOZHOU HYBRIBIO BIOCHEMISTRY LTD
- Filing Date
- 2025-09-16
- Publication Date
- 2026-07-28
AI Technical Summary
Existing group B streptococcal nucleic acid detection methods cannot quickly and accurately classify different serotypes, leading to missed detections and failing to meet clinical needs.
Develop a multiplex PCR primer and probe composition, combined with flow-guided hybridization gene chip technology, to achieve accurate typing detection of Group B Streptococcus Ia, Ib, II, III, IV, V, VI, VII, VIII and IX serotypes, and use internal standards to monitor the detection process to avoid false negatives and false positives.
It achieves highly sensitive, specific, and accurate detection of various serotypes of Group B Streptococcus, reducing the risk of neonatal infection and improving the repeatability and accuracy of detection.
Smart Images

Figure CN120967027B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of gene detection service technology, and relates to gene detection of pathogens. More specifically, it relates to a multiplex PCR primer and probe composition and kit for Group B Streptococcus typing detection. Background Technology
[0002] Group B streptococci Streptococcus GBS, also known as agalactia-resistant streptococci (GBS) Streptococcus agalactiae GBS (Gastrococcus spp.) is a facultative anaerobic Gram-positive coccus and one of the main pathogens causing neonatal infections. GBS can colonize the digestive and genitourinary tracts of pregnant women and, under certain conditions, can transform from a colonized state into an opportunistic pathogen, leading to invasive GBS disease in pregnant women or newborns. Clinical symptoms in pregnant women can include asymptomatic bacteriuria, cystitis, pyelonephritis, bacteremia, amniotic cavity infection, pneumonia, premature birth, postpartum endometritis and postpartum sepsis, and even intrauterine fetal death. When GBS is transmitted from mother to newborn, it can cause sepsis and central nervous system infection in offspring, leading to death in severe cases. Survivors may suffer from neurological sequelae due to inflammatory damage.
[0003] Based on the differences in the capsular polysaccharide (CPS) antigens of Group B Streptococcus (GBS), GBS can be classified into serotypes Ia, Ib, II, III, IV, V, VI, VII, VIII, and IX. Different GBS serotypes exhibit varying virulence, invasiveness, and antibiotic resistance. Serotyping of each GBS serotype is more beneficial for GBS prevention and control, as well as for epidemiological tracking and outbreak investigation. Culture-based methods remain the gold standard for GBS detection, but these methods are time-consuming and cannot meet the demand for rapid detection. Nucleic acid amplification detection for GBS screening yields results comparable to, or even better than, culture-based methods; however, existing GBS nucleic acid detection reagents can mostly only detect the serotypes of GBS, but cannot accurately classify them. Furthermore, in clinical practice, there are cases where individuals simultaneously carry or are infected with multiple GBS serotypes; the inability to accurately detect the serotype of the carried or infected GBS will lead to missed diagnoses. In conclusion, there is still a need to develop a product based on nucleic acid amplification detection technology for the serotyping of various Group B Streptococcus serotypes to facilitate accurate diagnosis, treatment, and vaccine development for GBS. Summary of the Invention
[0004] To address the shortcomings of the prior art, this invention provides a multiplex PCR primer and probe composition and kit for Group B Streptococcus typing detection.
[0005] The first objective of this invention is to provide a multiplex PCR primer and probe composition.
[0006] The second objective of this invention is to provide a gene chip.
[0007] A third objective of this invention is to provide a reagent kit.
[0008] A fourth object of the present invention is to provide the use of the composition, the gene chip, and the kit in the preparation of Group B Streptococcus detection and / or typing detection products.
[0009] The above-mentioned objective of this invention is achieved through the following technical solution: This invention aims to achieve accurate typing of Group B Streptococcus serotypes Ia, Ib, II, III, IV, V, VI, VII, VIII, and IX. A multiplex PCR primer and probe composition capable of distinguishing these serotypes has been developed for these 10 Group B Streptococcus serotypes. Based on this composition, this invention also develops a kit for visualized typing of Group B Streptococcus using flow-guided hybridization gene chip technology. The kit can detect all 10 Group B Streptococcus serotypes, and can also identify the specific serotype or serotypes present, with high specificity, sensitivity, repeatability, and accuracy. Therefore, this invention seeks protection for the composition and kit.
[0010] This invention provides a multiplex PCR primer and probe composition, which consists of a multiplex PCR primer set and a probe set; the multiplex PCR primer set contains primers with nucleotide sequences as shown in SEQ ID NO. 1 to 20 in sequence; the probe set contains probes with nucleotide sequences as shown in SEQ ID NO. 23 to 32 in sequence.
[0011] To avoid false negatives, this invention also uses the human β-globin gene as an endogenous internal standard, and designs corresponding internal standard primers and internal standard probes (ICs) for monitoring the entire detection process, including sample collection, extraction, and amplification.
[0012] Specifically, the nucleotide sequences of the internal standard primers are shown in SEQ ID NO.21-22, and the nucleotide sequences of the internal standard probes are shown in SEQ ID NO.33.
[0013] In a specific embodiment of the present invention, the multiplex PCR primer set in the composition consists of primers shown in SEQ ID NO. 1 to 22; the probe set consists of probes shown in SEQ ID NO. 23 to 34.
[0014] The composition provided by this invention can effectively and simultaneously amplify specific fragment products of Group B Streptococcus serotypes Ia, Ib, and II–IX in the same reaction tube. Therefore, the application of this composition in the preparation of Group B Streptococcus nucleic acid detection and / or typing products should also be within the scope of protection of this invention.
[0015] Specifically, the Group B streptococci include Group B streptococci serotypes Ia, Ib, II, III, IV, V, VI, VII, VIII, and IX.
[0016] Based on the probe set in the composition of the present invention, the present invention also provides a flow-guided hybridization gene chip, wherein probes with nucleotide sequences as shown in SEQ ID NO. 23-34 are sequentially immobilized on the solid-phase carrier of the chip; wherein the probe with the nucleotide sequence as shown in SEQ ID NO. 34 is a chromogenic system control probe.
[0017] Specifically, the 5' end of the probe with the nucleotide sequence shown in SEQ ID NO. 23-33 is modified with amino grouping; the 5' end of the probe with the nucleotide sequence shown in SEQ ID NO. 34 is modified with biotin.
[0018] Specifically, the biotin-modified chromogenic system control probes are used as BIO points to determine whether the hybridization process is normal. As long as the hybridization process is correct, the BIO points will all show color.
[0019] Optionally, the solid support may be nitrocellulose, cellulose acetate, glass slide, silicone wafer, nylon membrane, polypropylene membrane, or micro-magnetic beads.
[0020] In a specific embodiment of the present invention, the solid support is a nylon membrane.
[0021] Based on the composition and gene chip described in this invention, this invention also provides a kit containing primers shown in SEQ ID NO. 1 to 22 and the gene chip; the 5' ends of the primers are all bound with markers.
[0022] Optionally, the marker is biotin.
[0023] Specifically, the kit also contains reagents required for PCR amplification and flow-through hybridization.
[0024] Specifically, the reagents required for the PCR amplification reaction include PCR buffer and enzyme mixture.
[0025] More specifically, the PCR buffer consists of Tris-HCl, (NH4)2SO4, KCl, MgCl2 and dNTPs.
[0026] More specifically, the enzyme mixture comprises hot-start Taq enzyme and uracil glycosylation enzyme (UNG).
[0027] Specifically, the kit also contains a positive control; the positive control is a recombinant plasmid containing the amplification fragment of the primers shown in SEQ ID NO. 1 to 22.
[0028] In a specific embodiment, the positive control was divided into two groups; group 1 included Group B Streptococcus Ia serotype plasmid, Group B Streptococcus Ib serotype plasmid, Group B Streptococcus II serotype plasmid, Group B Streptococcus III serotype plasmid, Group B Streptococcus V serotype plasmid, and the internal standard β-globin plasmid, with a plasmid concentration of 1.0 × 10⁻⁶. 5 Group 2 included Group B Streptococcus IV, Group B Streptococcus VI, Group B Streptococcus VII, Group B Streptococcus VIII, Group B Streptococcus IX serotype plasmids, and the internal standard β-globin plasmid, with a plasmid concentration of 1.0 × 10⁻⁶ copies / mL; 5 copies / mL.
[0029] The primers in the kit described in this invention can simultaneously amplify the 10 Group B Streptococcus serotypes in a single PCR system based on multiplex PCR technology. The amplification products are then hybridized with nylon membranes labeled with different serotype-specific probes on a flow-through hybridization instrument, followed by chemical colorimetric development using an alkaline phosphatase system. The results are then interpreted using chemical colorimetric analysis. Therefore, this invention also claims protection for the use of the gene chip and the kit in the preparation of Group B Streptococcus detection and / or typing products.
[0030] Specifically, the Group B streptococci include Group B streptococci serotypes Ia, Ib, II, III, IV, V, VI, VII, VIII, and IX.
[0031] Based on the kit described in this invention, this invention also provides a method for detecting Group B Streptococcus nucleic acid typing, the method comprising the following steps: S1. Collect the sample to be tested and extract the nucleic acid from the sample; S2. Using the nucleic acid sample obtained in S1 as a template, perform multiplex PCR amplification using the primers in the kit described in this invention; S3. After denaturing the multiplex PCR amplification product obtained in S2, hybridize it with the gene chip in the kit described in this invention and perform color development. S4. Result Interpretation: When both IC and Bio spots on the gene chip are colored, the presence of colored spots at other locations indicates a positive serotype; otherwise, it is negative.
[0032] Optionally, the sample is a vaginal swab sample or a rectal swab sample.
[0033] Specifically, when performing multiplex PCR amplification, the PCR buffer and the primers are prepared into a PCR reaction solution; then the PCR reaction solution is prepared with an enzyme mixture and other solutions to obtain a multiplex PCR reaction system.
[0034] In a specific embodiment of the present invention, the multiplex PCR reaction system is as follows: 5 μL of extracted sample nucleic acid, 24.3 μL of PCR reaction solution and 0.7 μL of enzyme mixture (0.5 μL of hot-start Taq enzyme and 0.2 μL of uracil glycosylase).
[0035] Specifically, in the multiplex PCR reaction system, the concentrations of the upstream and downstream primers used to detect the target gene of Group B Streptococcus are 150–250 nM, and the concentration of the probe is 5–30 nM; the concentrations of the upstream and downstream primers used to detect the internal standard gene β-globin are 80–120 nM, and the concentration of the probe is 5–30 nM. Preferably, in the multiplex PCR reaction system, the concentrations of the upstream and downstream primers used to detect the target gene of Group B Streptococcus are 100 nM, and the concentration of the probe is 10 nM; the concentrations of the upstream and downstream primers used to detect the internal standard gene β-globin are 100 nM, and the concentration of the probe is 10 nM.
[0036] Specifically, in the multiplex PCR reaction system, the concentration of Tris-HCl is 26–30 mol / L, the concentration of (NH4)2SO4 is 15–25 mmol / L, the concentration of KCl is 28–32 mmol / L, the concentration of MgCl2 is 3.5–6.5 mmol / L, and the concentration of dNTPs is 0.15–0.25 mol / L.
[0037] Preferably, in the multiplex PCR reaction system, the concentration of Tris-HCl is 28 mol / L, the concentration of (NH4)2SO4 is 20 mmol / L, the concentration of KCl is 30 mmol / L, the concentration of MgCl2 is 5.0 mmol / L, and the concentration of dNTPs is 0.2 mol / L.
[0038] Specifically, the Tris-HCl is pH 8.0 Tris-HCl. Specifically, in the multiplex PCR reaction system, the amount of hot-start Taq enzyme is 2–5 U / person (reaction), and the amount of uracil glycosylation enzyme is 0.1–0.3 U / person (reaction).
[0039] Preferably, in the multiplex PCR reaction system, the amount of hot-start Taq enzyme is 2.5 U / person (reaction), and the amount of uracil glycosylase is 0.2 U / person (reaction).
[0040] The present invention has the following beneficial effects: This invention targets the CPS genes of Group B Streptococcus serotypes Ia, Ib, II, III, IV, V, VI, VII, VIII, and IX, respectively, and develops a multiplex PCR primer and probe composition capable of distinguishing these serotypes. Based on this composition, this invention also develops a kit for visualized typing detection of Group B Streptococcus by combining flow-through hybridization gene chip technology. Using the kit of this invention, not only can the 10 serotypes of Group B Streptococcus be detected, but also the specific serotype or the presence of specific serotypes. Furthermore, this invention uses the human β-globin gene as an endogenous internal standard, enabling the detection of serotypes through internal... Standard Quality control is implemented throughout the detection process, monitoring the entire experimental procedure from sample collection and extraction to detection, to avoid false negatives. The UNG enzyme + dUTP anti-contamination measures prevent false positive results caused by PCR product contamination. The kit exhibits high specificity, high sensitivity, good repeatability, low false negative and false positive rates, and high detection accuracy, effectively distinguishing between various serotypes of Group B Streptococcus. This invention is of great significance for preventing perinatal infections in pregnant women and newborns, and reducing neonatal mortality. Attached Figure Description
[0041] Figure 1 The results are obtained by using the primer and probe combination shown in Control Group 1 to detect the positive control, internal standard plasmid, and negative clinical sample.
[0042] Figure 2 The results are obtained by using the primer and probe combination shown in control group 2 to detect the positive control, internal standard plasmid, and negative clinical sample.
[0043] Figure 3 The results are obtained by using the primer and probe combination shown in control group 3 to detect the positive control, internal standard plasmid, and negative clinical sample.
[0044] Figure 4 The results are obtained by using the primer and probe composition described in this invention to detect the positive control, internal standard plasmid, and negative clinical sample.
[0045] Figure 5 The results are for detecting the positive control plasmid and the blank control using the kit described above.
[0046] Figure 6The results are for detecting different concentrations of Group B Streptococcus Ia serotype plasmids using the kit described above.
[0047] Figure 7 The results are for detecting Group B Streptococcus Ib serotype plasmid using the kit described above.
[0048] Figure 8 The results are for detecting Group B Streptococcus II serotype plasmids using the kit described above.
[0049] Figure 9 The results are for detecting Group B Streptococcus III serotype plasmids using the kit described above.
[0050] Figure 10 The results are for detecting Group B Streptococcus IV serotype plasmids using the kit described above.
[0051] Figure 11 The results are for detecting Group B Streptococcus V serotype plasmid using the kit described above.
[0052] Figure 12 The results are for detecting Group B Streptococcus VI serotype plasmid using the kit described above.
[0053] Figure 13 The results are for detecting Group B Streptococcus VII serotype plasmid using the kit described above.
[0054] Figure 14 The results are for detecting Group B Streptococcus VIII serotype plasmids using the kit described above.
[0055] Figure 15 The results are for detecting Group B Streptococcus IX serotype plasmid using the kit described above.
[0056] Figure 16 The results are from testing clinical Ia serotype positive samples using the kit described above.
[0057] Figure 17 The results are from testing clinical Ib serotype positive samples using the kit described.
[0058] Figure 18 The results are from testing clinical serological type II positive samples using the kit described.
[0059] Figure 19 The results are from testing clinical serological type III positive samples using the kit described.
[0060] Figure 20The results are from testing clinical serological type V positive samples using the kit described above.
[0061] Figure 21 The results of cross-tests using the kit to detect Neisseria gonorrhoeae, Chlamydia trachomatis, Ureaplasma urealyticum, Mycoplasma hominis, Candida albicans, and Lactobacillus inertis.
[0062] Figure 22 The results are for detecting Group B Streptococcus serotypes ATCC BAA-1138 (serotype Ia), ATCC27956 (serotype Ib), ATCC BAA-2675 (serotype II), ATCC BAA-2674 (serotype III), ATCC BAA-2673 (serotype IV), ATCC BAA-2672 (serotype V), ATCC BAA-2671 (serotype VI), ATCC BAA-2670 (serotype VII), ATCC BAA-2669 (serotype VIII), and ATCC BAA-2668 (serotype IX) using the kit described above. Detailed Implementation
[0063] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.
[0064] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.
[0065] Example 1: Obtaining the primer and probe composition 1. Primer and probe design and screening Multiplex PCR is not simply a matter of mixing multiple pairs of specific primers into a single reaction system. The difficulty of multiplex PCR lies in the incompatibility of amplification conditions between multiple target sites; each target site requires the cooperation of other primers nearby. Multiplex PCR requires that the added primer pairs neither bind to each other nor to regions on the template DNA other than the target fragment. In other words, each primer cannot have significant complementarity with other amplified fragments, nor can the amplified fragments have significant homology. This significantly increases the difficulty of designing the primers included in the multiplex PCR reaction system.
[0066] This invention analyzed the CPS gene sequences of Group B Streptococcus serotypes Ia, Ib, II, III, IV, V, VI, VII, VIII, and IX. Based on the basic principles of primer and probe design, preliminary design and screening were performed using design software. Three primer and probe combinations with the best scores were selected and named Control Group 1, Control Group 2, and Control Group 3, respectively, with their sequences shown in Tables 1-3. However, actual experimental testing revealed that Control Groups 1-3 showed weak detection signals for some serotypes, indicating low detection sensitivity and unfavorable for accurate detection of the 10 Group B Streptococcus serotypes. Therefore, the inventors redesigned and optimized the primer and probe combinations, obtaining primer and probe combinations with relatively better detection performance, with their sequences shown in Table 4.
[0067] Table 1 Primer and probe compositions for control group 1
[0068] Table 2 Primer and probe compositions for control group 2
[0069] Table 3 Primer and probe compositions for control group 3
[0070] Table 4 Primer and probe compositions of the present invention
[0071] 2. Detection efficacy test of primer and probe combination This invention combines flow-through hybridization gene chip technology to test the detection efficacy of the primer and probe compositions shown in Tables 1-4. The primer and probe compositions and chromogenic control probes (nucleotide sequence: CAGTTATATTTATACTACGTC, SEQ ID NO. 34) shown in Tables 1-4 were synthesized. Biotin was added to the 5' end of the primers and the chromogenic control probes, and aminoation was added to the 5' end of the probes. The synthesized probes were used to prepare flow-through hybridization gene chips. Recombinant plasmids containing CPS gene sequences of Group B Streptococcus serotypes Ia, Ib, II, III, IV, V, VI, VII, VIII, and IX, as well as internal standard plasmids (containing β-globin gene sequences) and nucleic acids from Group B Streptococcus negative clinical samples were used as templates. Detection was performed using the primers in the compositions shown in Tables 1-4 and the prepared gene chips, respectively, to test the typing efficacy of the primer and probe compositions for each serotype of Group B Streptococcus.
[0072] (1) Fabrication of gene chips The fabrication of gene chips includes the following steps: ① Preparation of probe solution: The synthesized probes shown in Tables 1 to 4 and the colorimetric control probes were dissolved in ultrapure water to prepare a stock solution with a concentration of 100 μM. The stock solution was then dissolved in a solution of 0.5 M Na2CO3 and 0.5 M NaHCO3 at pH 8.4 to make the final concentration 10 μM. ② Nylon membrane treatment: Immerse the nylon membrane in 0.1 M HCl solution for 30 s to remove residual solution, then immerse it in 20% EDAC solution for 15 min. Rinse it in a washing tray with 200 mL purified water for 10 s. Repeat this step 3 times. Place it on absorbent paper to remove excess residual liquid, then transfer it to a drying oven at 20℃ and 45% humidity for 12 h. Separate the dried nylon membrane with Kimwipes paper, pack it into a sealed film bag, and store it in the refrigerator of the membrane application room at 4℃ for later use. ③Preparation of gene chip: The probe solution prepared in (1) was applied to the nylon membrane treated in (2) by micropipette, with each drop being 1.0 μL. After the membrane was applied, it was placed at room temperature for 15 min to react. The membrane was then immersed in 0.1 M NaOH solution for 10 min to stop the reaction. The washed membrane was then placed in a drying oven at 20℃ and 45% humidity for 12 h to obtain the gene chip.
[0073] (2) Test results of detection effect Using the primers and corresponding gene chips in the compositions shown in Tables 1-4, the 10 types of compounds at a concentration of 1×10⁻⁶ were subjected to [further action]. 5 The results of the detection of serum recombinant plasmids (copies / mL), internal standard plasmids, and negative sample nucleic acids are as follows: Figures 1-4 As shown in Table 5. From Figures 1-4 As shown in Table 5, compared with the control groups 1-3, the primers and corresponding gene chips shown in Table 4 have the strongest signal intensity for each serotype, indicating that their detection sensitivity is optimal.
[0074] Table 5. Results of primer and probe combinations in detecting 10 serotype plasmids, internal standard plasmids, and negative samples.
[0075] Note: "++" indicates a strong positive result signal, "++" indicates a moderate positive result signal, "+" indicates a weak positive result signal, and "-" indicates a negative result.
[0076] Example 2: Construction of Group B Streptococcus Nucleic Acid Typing Detection Kit and Detection Method 1. Group B Streptococcus Nucleic Acid Typing Kit This invention, based on the primer and probe combinations shown in Table 4, combined with multiplex PCR and flow-through hybridization gene chip technology, constructs a nucleic acid typing detection kit for Group B Streptococcus serotypes Ia, Ib, II, III, IV, V, VI, VII, VIII, and IX. The kit includes the primers shown in Table 4, and a gene chip prepared using the probes and colorimetric system shown in Table 4. It also includes PCR buffer, enzyme mixture, blank control, and positive control. The specific components are as follows: (1) Multiplex PCR primer set and gene chip The multiplex PCR primer set consists of primers shown in SEQ ID NO. 1–20 and internal standard primers shown in SEQ ID NO. 21–22. The gene chip is prepared using probes shown in SEQ ID NO. 23–34. All primers and the chromogenic control probes are biotin-labeled at their 5' ends, and the remaining probes on the gene chip have undergone amino-modification at their 5' ends. The internal standard (IC) primers and probes are used to assess sample quality and PCR inhibition factors. The biotin-modified chromogenic control probes serve as BIO spots to determine whether the hybridization process is normal; as long as the hybridization process is correct, all BIO spots will show color.
[0077] (2) PCR buffer The components contained in the PCR buffer include: pH 8.0 Tris-HCl, (NH4)2SO4, KCl, MgCl2 and dNTPs.
[0078] (3) Enzyme mixture The enzyme mixture consists of hot-start Taq enzyme and uracil glycosylation enzyme (UNG); wherein the uracil glycosylation enzyme contains dUTP.
[0079] (4) Blank control and positive control The blank control was sterilized deionized water. The positive controls consisted of recombinant plasmids containing the CPS gene sequences of Group B Streptococcus serotypes Ia, Ib, II, III, IV, V, VI, VII, VIII, and IX, respectively, and a β-globin gene sequence. The positive controls were divided into two groups; positive control group 1 included Group B Streptococcus Ia serotype plasmid, Group B Streptococcus Ib serotype plasmid, Group B Streptococcus II serotype plasmid, Group B Streptococcus III serotype plasmid, Group B Streptococcus V serotype plasmid, and the internal standard β-globin plasmid, with a plasmid concentration of 1.0 × 10⁻⁶. 5 copies / mL; Positive control group 2 included Group B Streptococcus IV serotype plasmid, Group B Streptococcus VI serotype plasmid, Group B Streptococcus VII serotype plasmid, Group B Streptococcus VIII serotype plasmid, Group B Streptococcus IX serotype plasmid, and internal standard β-globin plasmid, with a plasmid concentration of 1.0 × 10⁻⁶.5 copies / mL.
[0080] 2. Group B Streptococcus nucleic acid typing detection method This invention also provides a method for detecting Group B Streptococcus nucleic acid using the above-mentioned kit, the method comprising the following steps: (1) Sample collection and processing Sample collection methods include vaginal swabs and rectal swabs, specifically: 1) Vaginal swab: Wipe away excess vaginal secretions, place a sterile polyester swab in the lower third of the reproductive tract, gently rotate to obtain a mucosal secretion sample, place it in a sampling tube labeled with the patient's number, seal and send for testing. DNA is extracted from the sample using nucleic acid extraction or purification reagents (product registration number: Yuechao Medical Device Registration 20210003), using a fully automated nucleic acid extractor from KBP Biotechnology.
[0081] 2) Rectal swab: Carefully insert a sterile swab into the anus, gently rotate it about 2-5 cm above the anal sphincter to obtain the specimen, place it in a sampling tube labeled with the patient number, seal it, and send it for testing. DNA is extracted from the sample using nucleic acid extraction or purification reagents (product registration number: Yuechao Medical Device Registration 20210003), using a fully automated nucleic acid extractor from KBP Biotechnology.
[0082] (2) Sample testing 1) Multiplex PCR reaction Multiplex PCR reaction system (30 μL): 5 μL of extracted sample nucleic acid, 24.3 μL of PCR reaction solution and 0.7 μL of enzyme mixture (0.5 μL of hot-start Taq enzyme and 0.2 μL of uracil glycosylase (UNG); wherein the amount of hot-start Taq enzyme is 2.5 U / person (reaction) and the amount of uracil glycosylase is 0.2 U / person (reaction)); the PCR reaction solution includes primers and PCR buffer; Multiplex PCR reaction procedure: Place in a PCR instrument for reaction; 50℃ for 2 min; hot start at 95℃ for 9 min; thermal cycling at 95℃ for 30 s, 56℃ for 30 s, and 72℃ for 1 min for a total of 45 cycles; 72℃ for 5 min, and hold at 16℃.
[0083] In this invention, positive control 1 and positive control 2 were used as templates, and a blank control was set up to test the concentrations of each component of primers, probes and PCR buffer in the multiplex PCR reaction system. The results are shown in Tables 6 to 8.
[0084] Table 6 Primer concentration test results
[0085] Table 7 Probe Concentration Test Results
[0086] Table 8. Concentration test results of each component in the PCR buffer.
[0087] As shown in Tables 6 to 8, the detection can be completed within the specified concentration range.
[0088] 2) Hybridization of amplification products The obtained multiplex PCR amplification products were denatured at 95℃ for 5 min, quickly transferred to an ice-water mixture, and incubated for 2 min. Then, 0.8 mL of hybridization buffer (2×SSC / 0.1%SDS) preheated to 45℃ was added, mixed, and added to the reaction wells of the hybridization instrument. This was applied to the gene chip, and hybridization was performed at 45℃ for 20 min. Then, at 45℃, the membrane was rinsed three times with 0.5 mL of washing buffer (0.5×SSC / 0.1%SDS) preheated to 45℃, and the water pump was turned off. The hybridization instrument was set to 25℃, and 0.5 mL of blocking solution (0.25% skim milk powder, 0.05% thimerosal) was added to each well, and blocking was performed for 5 minutes. The pump was turned on to dissipate the blocking solution, and then turned off. 0.5 mL of enzyme-labeled solution (AP enzyme dissolved in TBS with streptavidin label) was added, and incubated for 5 minutes. All solutions were dissipated. The temperature was set to 36℃, and solution A (TBS, 0.1%SDS) was used. Wash four times with Tween 20 and 0.05% sodium azide, 0.8 mL each time; add 0.5 mL of colorimetric reagent (NBT / BCIP); develop for 5 minutes, and then interpret the results.
[0089] 3) Result Judgment If the sample being tested is a clinical sample, then if both the IC and Bio spots on the gene chip are colored, the presence of colored spots at other locations indicates a positive serotype; otherwise, it is negative. If only the Bio spot is colored when testing a clinical sample, it is recommended to resample and test.
[0090] The detection results of the positive controls (positive control 1 and positive control 2) and the blank control using the kit described in this invention are as follows: Figure 5 As shown. By Figure 5 It is evident that the kit described in this invention can accurately detect mixed samples containing different serotypes of Group B Streptococcus.
[0091] Example 3: Detection Effect Test To verify the accuracy, specificity, and sensitivity of the Group B Streptococcus nucleic acid typing detection kit constructed in Example 2 of this invention for detecting Group B Streptococcus serotypes Ia, Ib, II, III, IV, V, VI, VII, VIII, and IX, this invention used Group B Neisseria gonorrhoeae Ia serotype plasmid, Group B Streptococcus Ib serotype plasmid, Group B Streptococcus II serotype plasmid, Group B Streptococcus III serotype plasmid, Group B Streptococcus IV serotype plasmid, Group B Streptococcus V serotype plasmid, Group B Streptococcus VI serotype plasmid, Group B Streptococcus VII serotype plasmid, Group B Streptococcus VIII serotype plasmid, Group B Streptococcus IX serotype plasmid, clinical serotype Ia positive samples, clinical serotype Ib positive samples, clinical serotype II positive samples, clinical serotype III positive samples, and clinical serotype V positive samples (diluted at different concentrations: 1×10⁻⁶). 5 copies / mL, 1×10 4 copies / mL, 1×10 3 The test sample consisted of copies / mL, and control samples of Neisseria gonorrhoeae, Chlamydia trachomatis, Ureaplasma urealyticum, Mycoplasma hominis, Candida albicans, and Lactobacillus inertis were used as control samples. The kit was used to detect these bacteria.
[0092] The detection results of different concentrations of Group B Neisseria gonorrhoeae Ia serotype plasmid, Group B Streptococcus Ib serotype plasmid, Group B Streptococcus II serotype plasmid, Group B Streptococcus III serotype plasmid, Group B Streptococcus IV serotype plasmid, Group B Streptococcus V serotype plasmid, Group B Streptococcus VI serotype plasmid, Group B Streptococcus VII serotype plasmid, Group B Streptococcus VIII serotype plasmid, Group B Streptococcus IX serotype plasmid, clinical serotype Ia positive samples, clinical serotype Ib positive samples, clinical serotype II positive samples, clinical serotype III positive samples, and clinical serotype V positive samples using the kit described in this invention are as follows: Figures 6-20 As shown. By Figures 6-20 It is evident that the kit described in this invention can not only accurately detect various Group B Streptococcus serotypes, but also has high detection sensitivity with a detection limit of 1000 copies / mL (5 copies / reaction).
[0093] The detection results of gonococci, chlamydia trachomatis, ureaplasma urealyticum, mycoplasma hominis, candida albicans, and inert lactobacillus quality control samples using the kit described in this invention are as follows: Figure 21 As shown. By Figure 21 It is known that the kit described in this invention has no cross-reactivity with Neisseria gonorrhoeae, Chlamydia trachomatis, Ureaplasma urealyticum, Mycoplasma hominis, Candida albicans, and Lactobacillus inertis, indicating that it has good detection specificity.
[0094] This invention also purchased Group B Streptococcus strains ATCC BAA-1138 (serotype Ia), ATCC 27956 (serotype Ib), ATCC BAA-2675 (serotype II), ATCC BAA-2674 (serotype III), ATCC BAA-2673 (serotype IV), ATCC BAA-2672 (serotype V), ATCC BAA-2671 (serotype VI), ATCC BAA-2670 (serotype VII), ATCC BAA-2669 (serotype VIII), and ATCC BAA-2668 (serotype IX), and performed tests using the Group B Streptococcus nucleic acid typing detection kit constructed in Example 2 of this invention. The results are as follows. Figure 22 As shown, all of the Group B streptococcal serotypes can be accurately detected.
[0095] In addition, to verify the reproducibility of the Group B Streptococcus nucleic acid typing detection kit constructed in Example 2 of this invention, clinical samples of serological types Ia, Ib, II, III, and V were diluted to a concentration of 1×10⁻⁶. 4 The samples were tested in 10 replicates at a concentration of 1 copy / mL. The results showed that the sample was detected in all 10 replicates, indicating good repeatability.
[0096] The above results demonstrate that the Group B Streptococcus nucleic acid typing detection kit constructed in this invention can specifically detect the 10 Group B Streptococcus serotypes, and has good detection accuracy and high sensitivity.
[0097] Example 4 Actual Testing The kit of this invention was used to test 149 clinical samples, and gene sequencing was used for verification. The consistency between the kit and the sequencing method was evaluated through data analysis. The statistical examples of paired count data are shown in Table 9.
[0098] Table 9. Statistical Examples of Paired Count Data
[0099] The formulas for calculating sensitivity, specificity, and overall accuracy are as follows: Sensitivity: a / (a+c)×100%; Specificity: d / (b+d)×100%; Overall compliance rate: (a+d) / (a+b+c+d)×100%.
[0100] 2. Experimental Results The consistency results of the kit described in this invention in detecting various serotypes of Group B Streptococcus with those obtained by sequencing are shown in Tables 10-15. It can be seen that the sensitivity, specificity and overall concordance rate of the kit in detecting various serotypes of Group B Streptococcus are all 100%.
[0101] Table 10. Consistency results between the kit of the present invention for detecting Group B Streptococcus Ia serotype and sequencing method.
[0102] Table 11. Consistency results between the kit of the present invention for detecting Group B Streptococcus Ib serotype and sequencing method.
[0103] Table 12. Consistency results of the kit for detecting Group B Streptococcus II serotypes with sequencing methods.
[0104] Table 13. Consistency results between the kit of the present invention and sequencing methods for detecting Group B Streptococcus III serotypes.
[0105] Table 14. Consistency results between the kit of the present invention for detecting Group B Streptococcus V serotype and sequencing method.
[0106] Table 15. Consistency results of the kit of the present invention in detecting Group B Streptococcus VIII serotype with sequencing method.
[0107] The above results demonstrate that the Group B Streptococcus nucleic acid typing detection kit prepared in this invention has good repeatability and low false negatives and false positives.
[0108] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. The application of a composition in the preparation of a Group B Streptococcus detection product, characterized in that, The composition comprises a probe set and a multiplex PCR primer set; the multiplex PCR primer set contains primers with nucleotide sequences as shown in SEQ ID NO. 1 to 20 in sequence; The probe set contains probes with nucleotide sequences as shown in SEQ ID NO.23-32 in sequence; The Group B streptococci include Group B streptococci serotypes Ia, Ib, II, III, IV, V, VI, VII, VIII, and IX.
2. The application of a composition in the preparation of Group B Streptococcus typing products, characterized in that, The composition comprises a probe set and a multiplex PCR primer set; the multiplex PCR primer set contains primers with nucleotide sequences as shown in SEQ ID NO. 1 to 20 in sequence; The probe set contains probes with nucleotide sequences as shown in SEQ ID NO.23-32 in sequence; The Group B streptococci include Group B streptococci serotypes Ia, Ib, II, III, IV, V, VI, VII, VIII, and IX.
3. The application according to claim 1 or 2, characterized in that, The multiplex PCR primer set also contains internal standard primers with nucleotide sequences as shown in SEQ ID NO. 21-22; the probe set also contains internal standard probes with nucleotide sequences as shown in SEQ ID NO.
33.
4. The application of a reagent kit in the preparation of Group B Streptococcus detection products, characterized in that, The kit contains a gene chip and primers with nucleotide sequences as shown in SEQ ID NO. 1 to 22; each primer has a marker attached to its 5' end. The gene chip has probes with nucleotide sequences as shown in SEQ ID NO. 23-34 sequentially immobilized on its solid support; wherein, the probe with the nucleotide sequence shown in SEQ ID NO. 34 is a colorimetric control probe. The Group B streptococci include Group B streptococci serotypes Ia, Ib, II, III, IV, V, VI, VII, VIII, and IX.
5. The application of a reagent kit in the preparation of Group B Streptococcus typing products, characterized in that, The kit contains a gene chip and primers with nucleotide sequences as shown in SEQ ID NO. 1 to 22; each primer has a marker attached to its 5' end. The gene chip has probes with nucleotide sequences as shown in SEQ ID NO. 23-34 sequentially immobilized on its solid support; wherein, the probe with the nucleotide sequence shown in SEQ ID NO. 34 is a colorimetric control probe. The Group B streptococci include Group B streptococci serotypes Ia, Ib, II, III, IV, V, VI, VII, VIII, and IX.
6. The application according to claim 4 or 5, characterized in that, The probes with nucleotide sequences as shown in SEQ ID NO. 23-33 have an amino-modified 5' end; the probes with nucleotide sequences as shown in SEQ ID NO. 34 have a biotin-modified 5' end.
7. The application according to claim 4 or 5, characterized in that, The solid support is nitrocellulose, cellulose acetate, glass slide, silicone wafer, nylon membrane, polypropylene membrane, or micro-magnetic beads.
8. The application according to claim 4 or 5, characterized in that, The kit also contains reagents required for PCR amplification and flow-through hybridization.
9. The application according to claim 4 or 5, characterized in that, The kit also contains a positive control; the positive control is a recombinant plasmid containing the amplification fragment of the primers shown in SEQ ID NO.1 to 22.