KASP mark closely linked with fruit shape of bottle gourd and application of KASP mark

Abstract

The invention discloses a KASP mark closely linked with the fruit shape of a bottle gourd and application of the KASP mark. According to the invention, a method of combining QTL positioning with fine positioning is utilized to obtain an SNP marker closely linked with the shape of the bottle gourd fruit, the SNP marker is converted into a KASP marker of a competitive allele specific PCR technology, then typing is carried out based on specific matching of basic groups at the tail ends of primers, two site specific probes and two fluorescent probes are used for detecting marker sites, and the detection result is accurate. And judging whether the to-be-detected material contains the fruit shape related gene or not according to the genotype.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of vegetable molecular marker development and assisted breeding, and particularly relates to a KASP marker tightly linked to the fruit shape of bottle gourd and uses thereof. BACKGROUND

[0002] Bottle gourd[ Lagenaria siceraria (Molina) Standl .] is an annual herb of the Cucurbitaceae family, with both horticultural and medicinal properties, originating from Africa and having a long history of cultivation in China. It is also known as bottle gourd, pumple gourd, and calabash, and is one of the important melon vegetables in China, particularly in the southern provinces and cities.

[0003] Fruit shape is the most important external commodity trait of melon vegetables such as bottle gourd, directly affecting the purchasing intention of consumers. Currently, long rod-shaped bottle gourds, which are convenient for packaging and transportation, have a high market share, but consumers who pursue flavor and quality prefer bottle gourds with near-round, horseshoe, calabash, or short rod shapes, which have a lower market share. Bottle gourd fruit shapes vary widely, but there is currently no report on a molecular marker that is tightly linked to the fruit shape of bottle gourd.

[0004] Marker-assisted selection (MAS) is a new product and technology resulting from the rapid development of modern molecular biology. It enables rapid and accurate direct selection of genotypes at the molecular level, thereby rapidly screening for specific traits and accelerating the breeding process. There are many types of molecular markers, such as AFLP markers, SSR markers, and InDel markers. However, due to the poor stability and complex operation of these molecular markers, they have gradually been replaced by the new DNA molecular marker technology SNP. Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by single nucleotide variation at the genomic level (Vignal et al. 2002). It has the characteristics of wide distribution, high density, good stability, and suitability for large-scale screening. Competitive allele-specific PCR (KASP) technology is a commonly used SNP molecular marker typing method that is based on the specific matching of primer terminal bases to genotype SNPs. It uses two site-specific probes and two fluorescent probes to detect multiple SNP sites. However, to date, the application of SNP sites combined with KASP technology in bottle gourd has not been widely promoted, and no KASP marker tightly linked to important traits of bottle gourd has been reported. Developing a KASP marker suitable for rapid screening of bottle gourd fruit shape and using it to assist in screening bottle gourd fruit shape can contribute to the genetic improvement of the external quality of bottle gourd from a molecular design perspective, and is of great significance for promoting the quality and efficiency of the bottle gourd industry. SUMMARY

[0005] The present application aims at the deficiencies of the prior art, and provides a KASP marker closely linked to the fruit shape of Lagenaria siceraria, and the fruit shape of Lagenaria siceraria is assisted in breeding by using the marker.

[0006] The present application uses the QTL positioning combined with the fine positioning method to obtain the SNP marker closely linked to the fruit shape of Lagenaria siceraria, and converts the SNP marker into the KASP marker of the competitive allele-specific PCR technology, and then performs typing based on the specific matching of the primer end base, detects the marker site by using two site-specific probes and two fluorescent probes, and determines whether the material to be detected contains the fruit shape related gene according to the genotype.

[0007] The present application is mainly realized by the following technical scheme: The present application discloses a KASP marker closely linked to the fruit shape of Lagenaria siceraria, and the KASP marker is 06_5890308.

[0008] As preferred, the nucleotide sequence of the KASP marker is shown in SEQ ID NO. 1.

[0009] The present application discloses a KASP primer for detecting the KASP marker, including 06_5890308-F1, 06_5890308-F2 and 06_5890308-R. 06_5890308-F1 is shown in SEQ ID NO. 2. 06_5890308-F2 is shown in SEQ ID NO. 3. 06_5890308-R is shown in SEQ ID NO. 4.

[0010] As preferred, the KASP primers 06_5890308-F1 and 06_5890308-F2 are respectively connected with different fluorescent groups.

[0011] As preferred, the primer 06_5890308-F1 is connected with a FAM group; and the primer 06_5890308-F2 is connected with a HEX group. The FAM group is a carboxyfluorescein, the excitation wavelength of which is about 492 nm, and the emission wavelength is about 517-520 nm; the HEX belongs to a fluorescein derivative, the excitation wavelength of which is 532 nm, and the emission wavelength is 556 nm, which can be recognized by an argon laser (543 nm) and realizes signal detection in the wave band of 550-650 nm.

[0012] The genotyping result of the KASP molecular marker is C or T.

[0013] The application further provides an application of the KASP primer or the reagent or kit containing the KASP primer in detecting the fruit shape of Cucurbita.

[0014] The application further provides a method for breeding the fruit shape of Cucurbita with the aid of the KASP primer, and the method specifically comprises the following steps. S1) extracting genomic DNA of Cucurbita material; S2) using the genomic DNA of Cucurbita material as a template, and performing PCR amplification with the KASP primer according to any one of claims 3-5; S3) reading the fluorescence signal of the PCR amplification product, when the fluorescence signal of the genomic DNA of the Cucurbita plant sample shows the fluorescence group signal of the primer 06_5890308-F1, the result shows C, and it can be judged that the fruit of the material is long and rod-shaped; when the fluorescence signal of the primer 06_5890308-F2 is shown, the result shows T, and it can be judged that the fruit of the material is nearly round.

[0015] A method for screening the fruit shape of Cucurbita and assisting fruit shape breeding, wherein the genomic DNA of the Cucurbita to be detected is subjected to competitive allele-specific PCR amplification with the primer, the experimental result is analyzed by using the data analysis software KlusterCaller of LGC for genotyping, and whether it is nearly round fruit shape is judged according to the genotyping result, wherein if the genotyping result is T, the Cucurbita to be detected is nearly round fruit shape.

[0016] As a preferred, the PCR system for KASP reaction detection further comprises 2xKASP Master mix reagent.

[0017] As a preferred, the PCR system for KASP reaction detection is: DNA 0.8 μl, 2xKASP Master mix and primer mixture 0.8 μl in total.

[0018] The primer mixture is a mixture of primer 06_5890308-F1, primer 06_5890308-F2 and primer 06_5890308-R. The volume of primer 06_5890308-F1 or primer 06_5890308-F2 is 0.2 μl, and the concentration is 10 mM. The volume of primer 06_5890308-R is 0.4 μl, and the concentration is 10 mM.

[0019] As preferred, the PCR reaction procedure for KASP reaction detection is 94℃ pre-denaturation for 15 minutes, 94℃ denaturation for 20 seconds, 61-55℃ gradient recombination for 60 seconds, 10 cycles; then 94℃ denaturation for 20 seconds, 55℃ recombination for 60 seconds, extension for 60 seconds, 26 cycles, 4℃ storage.

[0020] The beneficial effects of the present application are: (1) Using the marker closely linked to the fruit shape of the bottle gourd, the fruit shape phenotype of the detected bottle gourd seedling leaf can be quickly and accurately judged according to the genotype, and the traditional fruit phenotype identification needs multiple processes such as seedling culture, false planting, planting, vine pulling, flowering and fruiting, and the identification period is long and laborious.

[0021] (2) Using the molecular marker closely linked to the fruit shape of the bottle gourd for assisted screening of the fruit shape of the bottle gourd, the seedling period can be batch detected in a short time, which is not limited by the test land, can save manpower and material resources, and greatly improves the breeding efficiency. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 To fine map the main QTL related to the fruit shape of the bottle gourd in Example 1 of the present application; Figure 2 KASP marker genotyping map of the hybrid offspring of the long rod-shaped bottle gourd and the nearly round bottle gourd in Example 2; Figure 3 Fruit phenotype photos of bottle gourds with different genotypes in Example 2. DETAILED DESCRIPTION

[0023] The technical solutions of the present application will be further specifically described below through specific examples.

[0024] In the present application, unless specified, the raw materials and equipment used can be purchased from the market or commonly used in the art.

[0025] Example 1. Obtaining and designing of KASP marker closely linked to fruit shape of bottle gourd 1. Obtaining of molecular marker closely linked to fruit shape of bottle gourd (1) Population construction: long rod-shaped Hangzhou local variety "Hangzhou Changgua" (from Zhejiang Academy of Agricultural Sciences Vegetable Research Institute) and nearly round bottle gourd germplasm resource "YD-4" were used for hybridization, F1 generation was selfed to obtain F2 generation population, and part of F2 generation was selfed to obtain F2:3 population.

[0026] (2) Genotypic and phenotypic identification: Phenotypic information of each parent and population material in step (1) was recorded. Genomic DNA of the above parents and populations was extracted, and combined with the phenotypes of each parent and population, a gene pool for long rod-shaped / nearly round fruits was constructed using BSA (Bulked Segregant Analysis). The genomes of different gene pools were resequencing based on the Illumina high-throughput sequencing platform to obtain the major QTLs controlling fruit shape (Xu et al, 2021).

[0027] (3) Fine mapping of QTLs and acquisition of linkage markers: Using 1150 F2 and 840 F2:3 populations as materials, map-based cloning technology was used for fine mapping, and the genes controlling the above major QTLs were finally located in a region of about 6 kb on chromosome 6. Figure 1 The markers 06_5890308 (location 5890308 on chromosome 6) and 06_5896403 (location 5896403 on chromosome 6) are closely linked to genes associated with bottle gourd fruit shape. Among them, 06_5890308, in the F2 and F2:3 populations, showed a nearly round fruit shape when genotyped as T. Designing KASP primers for the 06_5890308 locus creates a KASP marker closely linked to bottle gourd fruit shape.

[0028] 2. Design of KASP primers and fruit shape screening The KASP marker 06_5890308 obtained in this embodiment is located on chromosome 6, and its SNP site is located at 5890308bp. The SNP polymorphism is C / T, and its nucleotide sequence is shown in SEQ ID NO.1.

[0029] Based on this sequence, the present invention designed a series of KASP primers, including 06_5890308-F1, 06_5890308-F2 and 06_5890308-R, whose sequences from 5' to 3' are shown below.

[0030] 06_5890308-F1 is shown in SEQ ID NO. 2; 06_5890308-F2 is shown in SEQ ID NO. 3; 06_5890308-R is shown in SEQ ID NO. 4.

[0031] Competitive allele-specific PCR amplification was performed in the materials to be detected using the designed KASP primer; when the color showed the fluorescent group connected by 06_5890308-F1, the genotyping result was C, and the fruit shape of the detected bottle gourd would be long and rod-shaped; when the color showed the fluorescent group connected by 06_5890308-F2, the genotyping result was T, and the fruit shape of the detected bottle gourd would be nearly round.

[0032] Sequence: SEQ ID NO. 1: TTTAGTGTAGAAAAAAAAAAAACAATACAAGAAGAGAGAGAAAGAGAGAGATAGAGTAAACAATATATAAAAGTATAGAAAAAAGCATAATACTTAGGTG[C / T]ATCCCGGTAGCACTCATCTTGATCCATTTTATTCTCGTCATTTACATAAAAAAAATCATTAAAATATTTTTAAAAAGAAATAAGAAGAATTTTTCATACA; SEQ ID NO. 2: GAAGGTGACCAAGTTCATGCTCAAGATGAGTGCTACCGGGATG; SEQ ID NO. 3: GAAGGTCGGAGTCAACGGATTTCAAGATGAGTGCTACCGGGATA; SEQ ID NO. 4: AGAGAGATAGAGTAAACAATATATAAAAGTATAGAAA.

[0033] Example 2. Identification of bottle gourd fruit phenotype with 06_5890308 KASP molecular marker (1) Extract the genomic DNA of each single plant of the long rod-shaped Hangzhou local variety "Hangzhou Changgu" and the nearly round bottle gourd germplasm resource "YD-4" and its F2 generation and F2:3 population; plant the F2:3 population and record the fruit shape; (2) The obtained genomic DNA is subjected to competitive allele-specific PCR amplification by using 06_5890308 KASP molecular marker primers; the PCR reaction system (10 μL) is: 5 μL of bottle gourd genomic DNA, 4.2 μL of 2x Master mix, and 0.8 μL of primer mix. The primer mix is composed of primer 06_5890308-F1, primer 06_5890308-F2, and primer 06_5890308-R, the primer 06_5890308-F1 is connected with a FAM group, the primer 06_5890308-F2 is connected with a HEX group. The volume of primer 06_5890308-F1 or primer 06_5890308-F2 is 0.2 μl, and the concentration is 10 mM. The volume of primer 06_5890308-R is 0.4 μl, and the concentration is 10 mM. The Master Mix is provided with a kit, and the kit brand is LGC (Biosearch Technologies). The PCR program is: 94 ℃ for 15 min, 94 ℃ for 20 s, 61-55 ℃ for 60 s (Touch-Down PCR, 0.6 degrees Celsius per cycle) for 10 cycles, 94 ℃ for 20 s, 55 ℃ for 60 s, and 26 cycles.

[0034] (3) The experimental result analysis is performed by using the data analysis software Kraken or KlusterCaller of LGC to analyze the above results. The typing effect of the primer on the DNA sample is shown in the following figure: Figure 2 The figure shows that each dot represents a sample to be tested, wherein the blue dot represents that the site is a homozygous genotype "C / C"; the red dot represents that the site is a homozygous genotype "T / T"; the purple dot represents that the site is a heterozygous genotype "C / T"; the black mark represents NTC, i.e., water control; and the gray mark represents that the sample DNA is unqualified and is not typed. The graphical partition boundary of the typing result is obvious, indicating that the KASP marker typing is reliable. Some F2 and F2:3 population sample typing phenotypes are C / C, and the real phenotype after planting is long rod shape, the genotyping phenotype is T / T, and the real phenotype after planting is nearly round Figure 3 , which proves that the 06_5890308 KASP molecular marker is completely co-segregated with the fruit phenotype of bottle gourd.

[0035] Finally, it should be noted that the above enumeration is only some specific embodiments of the present application, and the present application is not limited to the above embodiments, but can also have many variations. All variations that can be directly derived or inferred by those skilled in the art from the disclosed content of the present application should be considered as the protection scope of the present application.

Claims

1. A KASP marker closely linked to the shape of a bottle gourd fruit, characterized in that, The KASP marker is 06_5890308; the SNP site of 06_5890308 is located at 5890308 bp on chromosome 6 of the bottle gourd genome, and the polymorphism is C / T.

2. The KASP mark according to claim 1, characterized in that, The nucleotide sequence of the KASP-tagged label is shown in SEQ ID NO.

1.

3. A KASP primer for detecting the KASP-labeled KASP as described in claim 1 or 2, characterized in that, The KASP primers include 06_5890308-F1, 06_5890308-F2 and 06_5890308-R; 06_5890308-F1 is shown in SEQ ID NO. 2; 06_5890308-F2 is shown in SEQ ID NO. 3; 06_5890308-R is shown in SEQ ID NO.

4.

4. The KASP primer according to claim 3, characterized in that, The KASP primers 06_5890308-F1 and 06_5890308-F2 are respectively linked to different fluorescent groups.

5. The KASP primer according to claim 4, characterized in that, Primer 06_5890308-F1 is linked to the FAM group; primer 06_5890308-F2 is linked to the HEX group.

6. The application of a KASP primer according to any one of claims 3 to 5, or a reagent or kit containing a KASP primer according to any one of claims 3 to 5, in detecting major QTLs of bottle gourd fruit shape.

7. A method for assisted selection of gourd fruit shape using KASP primers according to any one of claims 3 to 5, characterized in that, The method specifically includes the following steps: S1) Extract genomic DNA from bottle gourd material; S2) Using the genomic DNA of the bottle gourd material as a template, PCR amplification was performed using any one of the KASP primers described in claims 3 to 5; S3) Read the fluorescence signal of the PCR amplification product. When the fluorescence signal of the genomic DNA of the bottle gourd plant sample shows the fluorescent group signal of primer 06_5890308-F1, the result is C, which indicates that the fruit of the material is long and rod-shaped; when the fluorescent group signal of primer 06_5890308-F2 is shown, the result is T, which indicates that the fruit of the material is nearly round.

8. The method for assisted selection of bottle gourd fruit shape according to claim 7, characterized in that, The PCR system for KASP reaction detection also includes 2×KASP Master mix reagent.

9. The method for assisted selection of bottle gourd fruit shape according to claim 8, characterized in that, The PCR system for KASP reaction detection consisted of: 0.8 μl DNA, 0.8 μl of 2×KASP Master mix and primer mixture.

10. The method for assisted selection of bottle gourd fruit shape according to claim 7, characterized in that, The PCR reaction program for KASP reaction detection is as follows: pre-denaturation at 94℃ for 15 minutes, denaturation at 94℃ for 20 seconds, gradient annealing at 61~55℃ for 60 seconds, 10 cycles; then denaturation at 94℃ for 20 seconds, annealing at 55℃ for 60 seconds, extension for 60 seconds, 26 cycles, and storage at 4℃.

Images