Molecular marker composition related to cold resistance of rice at booting stage, primer composition, kit and application of molecular marker composition, primer composition and kit
By developing molecular marker compositions and primer compositions related to cold tolerance during the booting stage of rice, the problem of accurately distinguishing between cold tolerance and cold sensitivity during the booting stage of rice in existing technologies has been solved, realizing an efficient breeding method and improving the accuracy and efficiency of breeding.
Patent Information
- Application Number
- CN202511302898.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-12
- Publication Date
- 2025-11-18
AI Technical Summary
Existing technologies cannot accurately distinguish between cold tolerance and cold sensitivity during the booting stage of rice, resulting in low breeding efficiency. Furthermore, traditional phenotypic identification methods are time-consuming and easily affected by environmental factors.
Develop molecular marker compositions and primer compositions related to cold tolerance during the booting stage of rice, including first SNP markers, second SNP markers, third SNP markers and InDels markers, and distinguish cold-tolerant rice varieties by PCR amplification and fluorescence signal detection.
This method enables accurate identification of cold tolerance during the booting stage of rice, improves the precision and efficiency of breeding, and allows for the screening of dominant alleles for cold tolerance during the booting stage.
Smart Images
Figure CN120967048A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of crop genetic breeding, and particularly relates to a molecular marker composition, a primer composition, a kit and application thereof related to cold tolerance of rice at booting stage. BACKGROUND
[0002] At the booting stage, rice often suffers from cold damage due to "cold dew wind", which is manifested as delayed heading, disordered flowering period, irregular flowering, and reduced pollen vitality, thereby affecting pollination and fertilization, leading to decreased seed setting rate and plumping degree, and finally causing irreversible yield loss. Low-temperature cold damage not only significantly reduces rice yield, but also adversely affects rice quality. Cultivating rice varieties with strong cold tolerance has become an important direction of current rice genetic improvement and breeding research.
[0003] Rice cold tolerance is a complex trait controlled by multiple genes, and different genes play a role at different development stages. Since cold tolerance at the booting stage directly affects grain yield, it is crucial to breed rice varieties with cold tolerance at the booting stage. Traditional phenotypic identification methods are not only time-consuming and labor-intensive, but also susceptible to environmental interference, making it difficult to meet the needs of breeding. In recent years, important progress has been made in the research of rice cold tolerance-related genes. However, at present, research on rice cold tolerance mainly focuses on the seedling and bud stages, and specific functional markers for the booting stage, a critical growth stage, are still lacking, which restricts the precision and efficiency of cold tolerance breeding. SUMMARY
[0004] In view of this, the present application provides a molecular marker composition and a primer composition related to cold tolerance of rice at the booting stage, which can accurately distinguish between rice varieties with cold tolerance at the booting stage and cold-sensitive rice varieties.
[0005] To achieve the above-mentioned purpose, the present application provides the following technical solutions: The present application provides a molecular marker composition related to cold tolerance of rice at the booting stage, comprising at least one of the following molecular markers: a first SNP marker, a third SNP marker, and an InDels marker. The first SNP marker is a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 18, and there is a G / A polymorphism at position 25. The InDels marker is a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 19, and there is a deletion polymorphism of a nucleotide sequence as shown in SEQ ID NO: 14 at position 83 and a deletion polymorphism of a nucleotide sequence as shown in SEQ ID NO: 15 at position 149. The second SNP marker is a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 20, and there is a C / T polymorphism at position 20. The third SNP marker is a gene fragment with a nucleotide sequence shown as SEQ ID NO: 21, and a G / C polymorphism at the 43rd position.
[0006] The application provides a primer composition for detecting cold tolerance of rice at the booting stage, comprising at least one of the following primer groups: a first primer group, a third primer group and an InDels detection primer group. The first primer group, the third primer group and the InDels detection primer group are primer groups for detecting the first SNP marker, the third SNP marker and the InDels marker in the molecular marker composition in sequence. The first primer group comprises forward primer F1, forward primer F2 and reverse primer R with nucleotide sequences shown as SEQ ID NO: 1-3 in sequence. The InDels detection primer group comprises forward primer and reverse primer with nucleotide sequences shown as SEQ ID NO: 4 and 5 in sequence. The second primer group comprises forward primer F1, forward primer F2 and reverse primer R with nucleotide sequences shown as SEQ ID NO: 6-8 in sequence. The third primer group comprises forward primer F1, forward primer F2 and reverse primer R with nucleotide sequences shown as SEQ ID NO: 9-11 in sequence.
[0007] The application provides a kit for detecting cold tolerance of rice at the booting stage, comprising the primer composition.
[0008] Preferably, the kit further comprises a cold-tolerant quality control standard and a cold-sensitive quality control standard.
[0009] Preferably, the nucleotide sequence of the cold-tolerant quality control standard is shown as SEQ ID NO: 12. The nucleotide sequence of the cold-sensitive quality control standard is shown as SEQ ID NO: 13.
[0010] Preferably, the kit further comprises DNA polymerase and buffer.
[0011] The application provides application of the primer composition and the kit in at least one of the following aspects: Identifying rice varieties with cold tolerance at the booting stage, assisted breeding of rice with cold tolerance at the booting stage and genotyping of rice cold tolerance genes at the booting stage.
[0012] Preferably, the rice varieties include at least one of Zhongan No.2, Songya No.7, Songya No.18, Zao-nuo No.5, Jiayu No.25, Zhongzao No.35, Jiaxiangchangjing, Jiafaxian, Zhongan No.7, Songya No.12, Suojing No.308, Kongyu No.131, Qijing No.10, Ken-dao No.12, Songjingxiang No.2, Sanjiang No.6, Longjing No.31, Lianyu No.1013, Longqingdao No.8 and Jiudao No.51.
[0013] The application provides a method for detecting cold tolerance of rice at the booting stage, comprising the following steps: The genomic DNA of the rice sample to be detected is used as a template, and the primer composition or the kit is used for PCR amplification to obtain a PCR amplification product; If the first SNP marker is AA genotype, the cold tolerance of the rice sample to be detected at the booting stage is better than that of the rice with GG genotype; If the length of the PCR amplification product of the InDels detection primer group is 339 bp, the cold tolerance of the rice sample to be detected at the booting stage is better than that of the rice with a PCR amplification product of 680 bp; If the second SNP marker is TT genotype, the cold tolerance of the rice sample to be detected at the booting stage is better than that of the rice with CC genotype; If the third SNP marker is GG genotype, the cold tolerance of the rice sample to be detected at the booting stage is better than that of the rice with CC genotype.
[0014] Preferably, when the InDels detection primer group is used for PCR amplification, the PCR amplification reaction system is as follows: 10-100 ng of template DNA, 0.25 μM of forward primer and reverse primer respectively, 2.0 μl of 10×PCR buffer containing magnesium ions, 0.4 mM of dNTP, 1 U of Taq DNA polymerase, and deionized water is added to 20 μl. The PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; and 72℃ extension for 10 min.
[0015] Preferably, when at least one of the first primer group to the third primer group is used for PCR amplification, the PCR amplification reaction system is as follows: 30-100 ng of template DNA, 0.3 μM of forward primer F1 and forward primer F2 respectively, 0.8 μM of reverse primer R, 2×Probe Mix, and deionized water is added to 10 μl. The PCR amplification reaction program is as follows: 94℃ pre-denaturation for 15min; first step amplification reaction, 94℃ denaturation for 20s, 65℃~57℃ gradient annealing and extension for 60s, 10 cycles, and the temperature of annealing and extension decreases by 0.8℃ in each cycle; second step amplification reaction, 94℃ denaturation for 20s, 57℃ annealing and extension for 60s, 32 cycles.
[0016] Compared with the prior art, the present application has the following advantages: The present application provides a molecular marker composition related to cold tolerance of rice at the booting stage, comprising at least one of the following molecular markers: the first SNP marker to the third SNP marker and the InDels marker. The present application also provides a primer composition for detecting the cold tolerance of rice at the booting stage, comprising at least one of the following primer groups: the first primer group to the third primer group and the InDels detection primer group. The molecular marker composition and the primer composition can accurately distinguish the cold-tolerant rice varieties at the booting stage from the cold-sensitive rice varieties, and screen out the superior allele genotype of the cold-tolerant rice at the booting stage. BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1 is a genotyping diagram of the first SNP marker; Figure 2 is a genotyping diagram of the InDels marker; Figure 3 is a genotyping diagram of the second SNP marker; Figure 4 is a genotyping diagram of the third SNP marker; Figure 5 is a screening result diagram of the first SNP marker primer-1; Figure 6 is a detection result diagram of the InDels detection primer-1; Figure 7 is a detection result diagram of the InDels detection primer-2. DETAILED DESCRIPTION
[0018] The present application provides a molecular marker composition related to cold tolerance of rice at the booting stage, comprising at least one of the following molecular markers: the first SNP marker to the third SNP marker and the InDels marker; The first SNP marker is a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 18, and G / A polymorphism exists at the 25th position; The InDels marker is a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 19, a deletion polymorphism of a nucleotide sequence as shown in SEQ ID NO: 14 at position 83, and a deletion polymorphism of a nucleotide sequence as shown in SEQ ID NO: 15 at position 149; The second SNP marker is a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 20, a C / T polymorphism at position 20; The third SNP marker is a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 21, a G / C polymorphism at position 43.
[0019] In the present application, the physical positions and advantageous alleles of the first SNP marker to the third SNP marker and the InDels marker are shown in Table 1. The physical positions are determined based on the MSU genome version (http: / / rice.plantbiology.msu.edu / ).
[0020] Table 1 Information table of four molecular markers
[0021] The present application provides a primer composition for detecting cold tolerance of rice at the booting stage, comprising at least one primer group: a first primer group to a third primer group and an InDels detection primer group. The first primer group to the third primer group and the InDels detection primer group are primer groups for detecting the first SNP marker to the third SNP marker and the InDels marker in sequence. The first primer group comprises forward primer F1, forward primer F2 and reverse primer R with nucleotide sequences as shown in SEQ ID NO: 1 to SEQ ID NO: 3 in sequence. The InDels detection primer group comprises forward primer and reverse primer with nucleotide sequences as shown in SEQ ID NO: 4 and SEQ ID NO: 5 in sequence. The second primer group comprises forward primer F1, forward primer F2 and reverse primer R with nucleotide sequences as shown in SEQ ID NO: 6 to SEQ ID NO: 8 in sequence. The third primer group comprises forward primer F1, forward primer F2 and reverse primer R with nucleotide sequences as shown in SEQ ID NO: 9 to SEQ ID NO: 11 in sequence.
[0022] In the present application, the first primer set and the second primer set are designed according to the sequence information of the upstream and downstream of the SNP marker, and the 3' terminal base of each forward primer F1 or each forward primer F2 corresponds to the allelic variation base of the SNP site. The third primer set is designed according to the reverse complement strand of the upstream and downstream sequence of the SNP marker, and the 3' terminal base of each forward primer F1 or each forward primer F2 corresponds to the complementary base of the allelic variation base of the SNP site. The 5' end F of each forward primer F1 in each primer set is modified with a FAM tag sequence, and the nucleotide sequence of the FAM tag sequence is shown in SEQ ID NO: 16 (gaaggtgaccaagttcatgct); the 5' end of each forward primer F2 is modified with a HEX tag sequence, and the HEX tag sequence is shown in SEQ ID NO: 17 (gaaggtcggagtcaacggatt). The forward primer F1 and the forward primer F2 are modified with different tag sequences, which facilitates reading the fluorescence signals of different colors based on the difference of the tag sequences in the subsequent process, so as to determine the genotype. The source of the primer composition in the present application is not particularly limited, and the primer source known in the art can be used. In the examples of the present application, the primer composition is entrusted to Beijing Qikexing Biotechnology Co., Ltd. for synthesis. The nucleotide sequence of the primer composition and the detection of the alleles are shown in Table 2.
[0023] Table 2 Functional molecular marker primer sequence
[0024] The present application provides a kit for detecting cold tolerance of rice booting stage, comprising the primer composition.
[0025] In the present application, the kit also preferably comprises a cold-tolerant quality control standard and a cold-sensitive quality control standard. The nucleotide sequence of the cold-tolerant quality control standard is preferably as shown in SEQ ID NO: 12 (TGTAACGTCCCCCGCCTTCCCCCAGGCCGGGCCGGGCCCACTTACATCTGATAGCTTTCATAGGTCATAGACTGCCCTCACAGACCAACACATGTCTTTTCTGCACACTTTGTCCTCACTCGTGTGCTCCCGGGAAGAATTTCCCGGTCGGTCATCCATCCCAAATTGCTCCAGGCCAAGCACGCTTAACCCTGGAGTTCTTTGGAGATTGGCTTCCGGAAAAGAAGTTGCAACTTGATATGAGTATTCTATTAATTCTATTAAGCCCTAGGCCGGGACGTTACAACGACCAAACCTAAAATTTTTTCCCAATTAAACAAGACCTCAGTACCTGAATCA);The nucleotide sequence of the cold-sensitive quality control standard is shown in SEQ ID NO: 13 (TGTAACGTCCCCCGCCTTCCCCCAGGCCGGGCCGGGCCCACTTACATCTGATAGCTTTCATAGGTCATAGACTGCCCTCACAGCCGGGCCGGGCCCACTTACATCTGATAGCTTTCATAGGTCATAGACTGCCCTCACAGACCAACACATGTCTTTTCTGCACACTTTGTCCTCACTCGTGTGCTCCCGGGAAGAATTTCCCGGACGCCCCTGTCGATCAACCCCAAGCCAGGAACGTCCTCTCTAGAAGAATTTCCCGGACGCCCCCGTCGATCAACCCCAGACCAGGAACGTCCTCTCTTGGCCACGTCTATGTGTCCAGTGCCAGCGCACGTGCCATGCTGTGTAACCACTCCCGGTCTACACCAGCCATGATACCATTTTGTAACGTCCCGTCTTCCCCCAGGCCAGGCCCACTTACATCTGATAGCTTTCATAGGTCATAGACTGCCCTCATAGACCAACACATTCCGGGAAGAATTTCCCGGTCGGTCATCCATCCCAAATTGCTCCAGGCCAAGCACGCTTAACCCTGGAGTTCTTTGGAGATTGGCTTCCGGAAAAGAAGTTGCAACTTGATATGAGTATTCTATTAATTCTATTAAGCCCTAGGCCGGGACGTTACAACGACCAAACCTAAAATTTTTTCCCAATTAAACAAGACCTCAGTACCTGAATCA).
[0026] In the present application, a DNA polymerase and a buffer are also included. In the embodiments of the present application, the kit includes 10x PCR buffer containing magnesium ions, Taq DNA polymerase and 2x Probe Mix (all purchased from Nanjing Novozyme Bio-tech Co., Ltd.).
[0027] The present application provides application of the primer composition and the kit in at least one of the following aspects: Identifying cold-tolerant rice varieties at the booting stage, cold-tolerant rice breeding at the booting stage and genotyping of cold-tolerant rice genes at the booting stage.
[0028] In the present application, the rice varieties include at least one of Zhongan No.2, Songya No.7, Songya No.18, Zao'nu No.5, Jiayu No.25, Zhzaoshu No.35, Jiaxiangchangjing, Jiafaxian, Zhongan No.7, Songya No.12, Suijing No.308, Kongyu No.131, Qijing No.10, Ken No.12, Songjingxiang No.2, Sanjiang No.6, Longjing No.31, Lianyu No.1013, Longqing No.8 and Jiuyi No.51.
[0029] In the present application, the primer composition can accurately distinguish the genotypes of four cold-tolerance genes at booting stage of rice and screen out the superior allele genotypes of the cold-tolerance at booting stage of rice. When the sample to be tested contains the superior allele genotype, the rice shows the cold-tolerance at booting stage. The genotypes and phenotypes of 20 rice varieties including Zhongan No.2, Songya No.7, Songya No.18, Zao'nu No.5, Jiayu No.25, Zhzaoshu No.35 and the like are detected in the embodiment of the present application, and the results show that when the sample to be tested contains the superior allele genotype, the rice shows the cold-tolerance at booting stage.
[0030] The present application provides a method for detecting the cold-tolerance at booting stage of rice, which comprises the following steps: The genomic DNA of the sample to be tested is used as a template, and the primer composition or the kit is used for PCR amplification to obtain a PCR amplification product; If the AA genotype is contained in the first SNP marker, the cold-tolerance at booting stage of the sample to be tested is superior to that of the rice with the GG genotype; If the length of the PCR amplification product of the InDels detection primer group is 339 bp, the cold-tolerance at booting stage of the sample to be tested is superior to that of the rice with the PCR amplification product of 680 bp; If the TT genotype is contained in the second SNP marker, the cold-tolerance at booting stage of the sample to be tested is superior to that of the rice with the CC genotype; If the GG genotype is contained in the third SNP marker, the cold-tolerance at booting stage of the sample to be tested is superior to that of the rice with the CC genotype.
[0031] The PCR amplification product is obtained by using the primer composition or the kit for amplifying by PCR with the genomic DNA of the rice sample to be detected as a template. The method for extracting the genomic DNA of the rice is not particularly limited in the present application, and the extraction method known in the art can be used, such as the kit extraction method or the CTAB method. In the embodiments of the present application, the extraction method is completed by using the plant genomic kit. After the genomic DNA is extracted, the PCR amplification product is obtained by using the primer composition or the kit for amplifying by PCR with the extracted genomic DNA as a template. In the present application, when the InDels detection primer group is used for PCR amplification, the system of the PCR amplification reaction is as follows: 10-100 ng of template DNA, 0.25 μM of each of the forward primer and the reverse primer, 2.0 μl of 10x PCR buffer containing magnesium ions, 0.4 mM of dNTP, 1 U of Taq DNA polymerase, and deionized water to make up to 20 μl; the program of the PCR amplification reaction is as follows: 5 min of pre-denaturation at 94℃; 30 s of denaturation at 94℃, 30 s of annealing at 55℃, 30 s of extension at 72℃, 35 cycles; and 10 min of extension at 72℃. In the present application, when at least one of the first primer group to the third primer group is used for PCR amplification, the system of the PCR amplification reaction is as follows: 30-100 ng of template DNA, 0.3 μM of each of the forward primer F1 and the forward primer F2, 0.8 μM of the reverse primer R, 2x Probe Mix, and deionized water to make up to 10 μl; the program of the PCR amplification reaction is as follows: 15 min of pre-denaturation at 94℃; the first step amplification reaction, 20 s of denaturation at 94℃, 60 s of gradient annealing and extension from 65℃ to 57℃, 10 cycles, and the temperature of annealing and extension is reduced by 0.8℃ in each cycle; the second step amplification reaction, 20 s of denaturation at 94℃, 60 s of annealing and extension at 57℃, 32 cycles.
[0032] After the PCR amplification product is obtained, the fluorescence signal detection and the length detection of the amplification product are performed on the PCR amplification product, and the genotype of the rice to be detected is obtained. In the embodiments of the present application, when the InDels detection primer group is used for PCR amplification, the length of the amplification product is detected by using 2% agarose gel electrophoresis; and when at least one of the first primer group to the third primer group is used for PCR amplification, the fluorescence data of the PCR amplification product is read by using the gene typing system of Han Chen Guang Yi.
[0033] In the present application, the nucleotide sequence of the first primer set amplification product is: AATTATGTGCCTCCTGAACCACTT[G / A]TAAAATGGCTTGAAGCTGGTGACAAGCCCATATACGTTGGGTTTGGTAGTCTTGTAAGATCACTTTGATCTCGATTTGTATTATTAGAGGTTTTCAGTTTTTGTTCCCCTGTTCTGATCTAGGCA (SEQ ID NO: 18). The cold-tolerant allele genotype (AA) carries HEX red fluorescence, the cold-sensitive allele genotype (GG) carries FAM blue fluorescence, and the heterozygous genotype carries both FAM blue fluorescence and HEX red fluorescence, showing green fluorescence.
[0034] The nucleotide sequence of the amplification product of the InDel detection primer set is: TGTAACGTCCCCCGCCTTCCCCCAGGCCGGGCCGGGCCCACTTACATCTGATAGCTTTCATAGGTCATAGACTGCCCTCACA[GCCGGGCCGGGCCCACTTACATCTGATAGCTTTCATAGGTCATAGACTGCCCTCACA / -]GACCAACACATGTCTTTTCTGCACACTTTGTCCTCACTCGTGTGCTCCCGGGAAGAATTTCCCGG[ACGCCCCTGTCGATCAACCCCAAGCCAGGAACGTCCTCTCTAGAAGAATTTCCCGGACGCCCCCGTCGATCAACCCCAGACCAGGAACGTCCTCTCTTGGCCACGTCTATGTGTCCAGTGCCAGCGCACGTGCCATGCTGTGTAACCACTCCCGGTCTACACCAGCCATGATACCATTTTGTAACGTCCCGTCTTCCCCCAGGCCAGGCCCACTTACATCTGATAGCTTTCATAGGTCATAGACTGCCCTCATAGACCAACACATTCCGGGAAGAATTTCCCGG / -]TCGGTCATCCATCCCAAATTGCTCCAGGCCAAGCACGCTTAACCCTGGAGTTCTTTGGAGATTGGCTTCCGGAAAAGAAGTTGCAACTTGATATGAGTATTCTATTAATTCTATTAAGCCCTAGGCCGGGACGTTACAACGACCAAACCTAAAATTTTTTCCCAATTAAACAAGACCTCAGTACCTGAATCA (SEQ ID NO: 19). The length of the PCR amplification product of the cold-tolerant allele is 339 bp, the length of the PCR amplification product of the cold-sensitive allele is 680 bp, and the PCR amplification product of the heterozygous genotype is two bands, and the fragment sizes are 339 bp and 680 bp, respectively.The amplification product of the cold-tolerant allele has a sequence deletion of 341 bp (57 bp + 284 bp) compared with the cold-sensitive allele, and the deletion sequence is GCCGGGCCGGGCCCACTTACATCTGATAGCTTTCATAGGTCATAGACTGCCCTCACA (SEQ ID NO: 14) and ACGCCCCTGTCGATCAACCCCAAGCCAGGAACGTCCTCTCTAGAAGAATTTCCCGGACGCCCCCGTCGATCAACCCCAGACCAGGAACGTCCTCTCTTGGCCACGTCTATGTGTCCAGTGCCAGCGCACGTGCCATGCTGTGTAACCACTCCCGGTCTACACCAGCCATGATACCATTTTGTAACGTCCCGTCTTCCCCCAGGCCAGGCCCACTTACATCTGATAGCTTTCATAGGTCATAGACTGCCCTCATAGACCAACACATTCCGGGAAGAATTTCCCGG (SEQ ID NO: 15). The sequence of the PCR product of the cold-tolerant allele is shown in SEQ ID NO: 12; and the nucleotide sequence of the cold-sensitive quality control standard is shown in SEQ ID NO: 13.
[0035] The nucleotide sequence of the amplification product of the second primer set is: TCGTGCCTCGCCGGCAACT[C / T]CGGGCTCTGCACCAAGGGCGGCGACGTGTGCTTCGTCAGCATC (SEQ ID NO: 20). The cold-tolerant allele (TT) carries HEX red fluorescence, the cold-sensitive allele (CC) carries FAM blue fluorescence, and the heterozygous genotype carries both FAM blue fluorescence and HEX red fluorescence, showing green fluorescence.
[0036] The nucleotide sequence of the amplification product of the third primer set is: TCCAGCAAAAGGTTGAGGTTATCAAAGACAAAAGTGATTCAC[G / C]ATTGAGAACTTCTATAAGCAAAG (SEQ ID NO: 21). The cold-tolerant allele (GG) carries HEX red fluorescence, the cold-sensitive allele (CC) carries FAM blue fluorescence, and the heterozygous genotype carries both FAM blue fluorescence and HEX red fluorescence, showing green fluorescence.
[0037] The application also provides a method for breeding a cold-tolerant rice variety at the booting stage, which preferably comprises the following steps: after detecting the cold tolerance of rice at the booting stage, screening a rice material with a favorable allele as a cold-tolerant donor parent, crossing the rice material with other breeding materials, and selecting a rice variety with strong cold tolerance from the hybrid offspring by detecting a molecular marker. The method for detecting the cold tolerance of rice at the booting stage is the same as the method described above, and will not be repeated here.
[0038] In order to further illustrate the application, the schemes provided by the application are described in detail below in combination with the drawings and examples, but they should not be understood as limiting the scope of protection of the application.
[0039] Example 1 Development of an important cold-tolerant gene functional marker at the booting stage of rice 1. The first SNP marker corresponds to MSU gene number: LOC_Os04g04254. The SNP at position 1222 in the coding region of the gene: A / G variation directly leads to differences in gene function, causing the 408th amino acid to change from isoleucine to valine. The site is A in cold-tolerant materials and mainly G in cold-sensitive materials. The gene sequence of LOC_Os04g04254 is downloaded from the MSU website (http: / / rice.plantbiology.msu.edu / ), and the sequences 100 bp upstream and downstream of the SNP are intercepted to design KASP primers: forward primer F1, forward primer F2 and reverse primer R. The forward primer F1 (SEQ ID NO: 1) is a FAM tag sequence and a DNA sequence of the non-functional gene of LOC_Os04g04254 in turn, the forward primer F2 (SEQ ID NO: 2) is a HEX tag sequence and a DNA sequence of the functional gene of LOC_Os04g04254 in turn, and the reverse primer R (SEQ ID NO: 3) is a common sequence, wherein the forward primer F2 is a favorable haplotype that can enhance the cold tolerance of rice at the booting stage.
[0040] 2. The InDel marker corresponds to MSU gene number: LOC_Os01g69910. Two key insertion and deletion mutations (57 bp InDel and 284 bp InDel) exist in the promoter region of the gene, which are located at positions 1452 and 1518 upstream of the promoter, respectively, and directly lead to differences in gene function. The two InDels are mainly deleted in cold-tolerant materials, while the two InDels are retained in cold-sensitive materials. The gene sequence of LOC_Os01g69910 is downloaded from the MSU website, and PCR primers are designed for the sequences 500 bp upstream and downstream of the two InDels: the upstream primer (SEQ ID NO: 4) is the forward primer sequence of LOC_Os01g69910, and the reverse primer (SEQ ID NO: 5) is the reverse primer sequence of LOC_Os01g69910. The mutation types can be distinguished by the length difference of the PCR products, and the deletion type is the beneficial haplotype, which can enhance the cold tolerance of rice booting stage.
[0041] 3. The second SNP marker corresponds to MSU gene number: LOC_Os04g04330. The SNP at position 2063 in the coding region of the gene: T / C mutation directly leads to differences in gene function, causing the 687th amino acid to change from serine to phenylalanine. The site is T in cold-tolerant rice materials and mainly C in cold-sensitive rice materials. The gene sequence of LOC_Os04g04330 is downloaded from the MSU website, and KASP primers are designed for the sequences 100 bp upstream and downstream of the SNP: forward primer F1, forward primer F2 and reverse primer R. The forward primer F1 (SEQ ID NO: 6) is the FAM tag sequence and the DNA sequence of the non-functional gene LOC_Os04g04330 in turn, the forward primer F2 (SEQ ID NO: 7) is the HEX tag sequence and the DNA sequence of the functional gene LOC_Os04g04330 in turn, and the reverse primer R (SEQ ID NO: 8) is the common sequence. The forward primer F2 is the beneficial haplotype, which can enhance the cold tolerance of rice booting stage.
[0042] 4. The third SNP marker corresponds to MSU gene number: LOC_Os07g07690, the SNP at position 7224 in the coding region of the gene: G / C variation directly leads to differences in gene function, causing the 1346th amino acid to change from proline to arginine. The site is G in cold-tolerant varieties and mainly C in sensitive varieties. The gene sequence of LOC_Os07g07690 was downloaded from the MSU website, and the sequences 100 bp upstream and downstream of the SNP were extracted to design KASP primers: forward primer F1, forward primer F2, and reverse primer R. The forward primer F1 (SEQ ID NO: 9) is a FAM tag sequence followed by a DNA sequence of the non-functional gene LOC_Os07g07690, the forward primer F2 (SEQ ID NO: 10) is a HEX tag sequence followed by a DNA sequence of the functional gene LOC_Os07g07690, and the reverse primer R (SEQ ID NO: 11) is a common sequence. The forward primer F2 is a favorable haplotype that can enhance the cold tolerance of rice at the booting stage.
[0043] Example 2 Identification of cold tolerance alleles at the booting stage of rice germplasm resources For the molecular markers of the functional sites of the five important cold tolerance genes at the booting stage of rice in Example 1, the primer pairs in Example 1 were used to detect the markers in 20 rice materials, including 10 indica rice (including conventional rice varieties in Anhui, Zhejiang, Jiangxi, Fujian, and Hunan), and 10 japonica rice (including conventional rice varieties in Heilongjiang and Jilin), to test the marker genotyping.
[0044] The PCR reaction system for InDels marker detection is as follows: template DNA 10-100 ng, forward primer and reverse primer each 0.25 uM, 10x PCR buffer (containing Mg+) 2.0 μl, four kinds of deoxyribonucleotides dATP, dTTP, dCTP, dGTP each 0.1 mM, Taq DNA polymerase 1 U, and deionized water to 20 μl; The PCR reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min. After the PCR reaction is completed, 2% agarose gel electrophoresis is used for detection, and different alleles are identified according to the size of the PCR product.
[0045] The KASP reaction system for detecting the first SNP marker to the third SNP marker is as follows: template DNA 30-100 ng, forward primer F1 and forward primer F2 each 0.3 uM, reverse primer R 0.8 uM, 2x Probe Mix, and deionized water to 10 μl; The PCR amplification procedure of the KASP is as follows: pre-denaturation at 94℃ for 15 min; first amplification reaction, denaturation at 94℃ for 20 s, gradient annealing and extension at 65℃-57℃ for 60 s, 10 cycles, and the temperature of annealing and extension decreases by 0.8℃ in each cycle; second amplification reaction, denaturation at 94℃ for 20 s, annealing and extension at 57℃ for 60 s, 32 cycles. After the PCR reaction, the KASP reaction product is read by using the genotyping system of HanChenGuangYi.
[0046] Rice cold tolerance identification at the booting stage: 20 main cultivars are subjected to low-temperature stress with a daily minimum temperature of <18℃ during the reproductive development period to the grain filling period in a test base at an altitude of 1800 meters above sea level in Baoshan, Yunnan, and the seed setting rate is determined as shown in Table 3. The genotyping maps of the four cold tolerance gene functional site markers in the 20 materials are respectively shown in Figures 1-4 , wherein "X" represents a failed sample UDE.
[0047] Table 3: Typing and phenotypic results of test germplasm materials
[0048] The detection results show that the cultivars carrying any one of the favorable alleles of the first SNP marker to the third SNP marker and the InDels marker have a significantly higher seed setting rate under low-temperature stress conditions than the cultivars carrying the unfavorable alleles, and when the above favorable alleles exist simultaneously, the seed setting rate is improved more significantly. The results show that the favorable alleles screened by the present application are closely related to the cold tolerance of rice at the booting stage, and can significantly improve the seed setting rate under low-temperature conditions, thereby providing effective markers for molecular breeding of cold-tolerant rice new varieties.
[0049] Comparative Example 1 PCR primers are designed according to the sequences of 100 bp upstream and downstream of the first SNP marker, and the specific information is as follows.
[0050] First SNP marker primer-1 Forward primer F1: gaaggtgaccaagttcatgctTGTGCCTCCTGAACCACTTG (SEQ ID NO: 22); Forward primer F2: gaaggtcggagtcaacggattTGTGCCTCCTGAACCACTTA (SEQ ID NO: 23); Reverse primer R: AAGGCAATGGTTTGGCATATACAC (SEQ ID NO: 24).
[0051] The rice breeding intermediate materials are detected according to the method in Example 2, and the results are as follows Figure 5The results show that when the above-mentioned primer is used for genotyping of the first SNP marker, most of the samples are clustered near the diagonal line or fall into the undetermined area, and a clear allele cluster cannot be formed. The non-specific binding of the amplification fragment exists, and the stability of the primer end structure is poor, resulting in insufficient allelic competition.
[0052] PCR primers are designed according to the sequences 500bp upstream and downstream of the InDels marker, as follows.
[0053] InDels detection primer-1 Forward primer: TCTGATGTGACGACTGTAACG (SEQ ID NO: 25); Reverse primer: GGCTACCTGTGATGCGTATG (SEQ ID NO: 26); InDels detection primer-2 Forward primer: CGGGCCCACTTACATCTGATA (SEQ ID NO: 27); Reverse primer: TTGATTCAGGTACTGAGGTCTTGT (SEQ ID NO: 28).
[0054] According to the method in Example 2, the rice materials are detected, Figure 6 For the amplification results of primer InDels detection primer-1, the cold-resistant material sample can obtain a band, and the band size is inconsistent with the target band (1002bp), while the cold-sensitive material sample fails to amplify the target band (661bp), indicating that the primer has different amplification efficiencies between different varieties.
[0055] Figure 7 For the amplification results of primer InDels detection primer-2, non-target bands appear in the amplification results. The length of the PCR amplification product of the cold-resistant genotype should be 649bp, and the length of the PCR amplification product of the cold-sensitive genotype should be 308bp.
[0056] Although the above examples have made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiments without creativity, and these embodiments all belong to the protection scope of the present application.
Claims
1. A molecular marker composition associated with cold tolerance at the booting stage of rice, characterized in that, The at least one molecular marker comprises: a first SNP marker, a third SNP marker, and an InDels marker; The first SNP marker is a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 18, and a G / A polymorphism at position 25; The InDels marker is a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 19, and a deletion polymorphism of a nucleotide sequence as shown in SEQ ID NO: 14 at position 83, and a deletion polymorphism of a nucleotide sequence as shown in SEQ ID NO: 15 at position 149; The second SNP marker is a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 20, and a C / T polymorphism at position 20; The third SNP marker is a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 21, and a G / C polymorphism at position 43.
2. A primer composition for detecting cold tolerance at the booting stage of rice, characterized by comprising the primer of SEQ ID NO:
1. The at least one primer set comprises: a first primer set, a third primer set, and an InDels detection primer set; The first primer set, the third primer set, and the InDels detection primer set are primer sets for detecting the first SNP marker, the third SNP marker, and the InDels marker in the molecular marker composition of claim 1, respectively; The first primer set comprises forward primer F1, forward primer F2, and reverse primer R with nucleotide sequences as shown in SEQ ID NO: 1-3, respectively; The InDels detection primer set comprises forward primer and reverse primer with nucleotide sequences as shown in SEQ ID NO: 4 and 5, respectively; The second primer set comprises forward primer F1, forward primer F2, and reverse primer R with nucleotide sequences as shown in SEQ ID NO: 6-8, respectively; The third primer set comprises forward primer F1, forward primer F2, and reverse primer R with nucleotide sequences as shown in SEQ ID NO: 9-11, respectively.
3. A kit for detecting cold tolerance at the booting stage of rice, characterized by comprising the polynucleotide of claim 1 or 2. The primer composition of claim 2.
4. The kit of claim 3, wherein The kit further comprises a cold-tolerant quality control standard and a cold-sensitive quality control standard; The nucleotide sequence of the cold-tolerant quality control standard is as shown in SEQ ID NO: 12; The nucleotide sequence of the cold-sensitive quality control standard is as shown in SEQ ID NO:
13.
5. The kit according to claim 3 or 4, characterized in that, The kit further comprises DNA polymerase and buffer.
6. Use of the molecular marker composition of claim 1, the primer composition of claim 2, or the kit of any one of claims 3-5 in at least one of the following: Identifying cold-tolerant rice varieties at the booting stage, cold-tolerant rice breeding at the booting stage, and genotyping of cold-tolerant rice genes at the booting stage.
7. Use according to claim 6, characterized in that, The rice varieties comprise at least one of the following: Zhongan No. 2, Songya No. 7, Songya No. 18, Zao Nuo No. 5, Jiayu No. 25, Zhongzao No. 35, Jiaxiangchangjing, Jiafaxian, Zhongan No. 7, Songya No. 12, Suojing No. 308, Kongyu No. 131, Qijing No. 10, Ken No. 12, Songjingxiang No. 2, Sanjiang No. 6, Longjing No. 31, Lianyu No. 1013, Longqing No. 8, and Jiuyi No.
51.
8. A method for detecting cold tolerance at the booting stage of rice, characterized by, The kit comprises the following steps: The PCR amplification product is obtained by using the primer composition of claim 2 or the kit of any one of claims 3-5 to amplify the genomic DNA of the sample of the rice to be tested as a template; If the first SNP marker is AA genotype, the cold tolerance of the booting stage of the sample of the rice to be tested is better than that of the rice with GG genotype; If the length of the PCR amplification product of the InDels detection primer group is 339 bp, the cold tolerance of the booting stage of the sample of the rice to be tested is better than that of the rice with the PCR amplification product of 680 bp; If the second SNP marker is TT genotype, the cold tolerance of the booting stage of the sample of the rice to be tested is better than that of the rice with CC genotype; If the third SNP marker is GG genotype, the cold tolerance of the booting stage of the sample of the rice to be tested is better than that of the rice with CC genotype.
9. The method of claim 8, wherein, When the InDels detection primer group is used for PCR amplification, the system of the PCR amplification reaction is: 10-100 ng of template DNA, 0.25 μM of forward primer and reverse primer, 2.0 μl of 10×PCR buffer containing magnesium ions, 0.4 mM of dNTP, 1 U of Taq DNA polymerase, and deionized water to make up to 20 μl. The program of the PCR amplification reaction is: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; and 72℃ extension for 10 min.
10. The method of claim 8, wherein, When at least one of the first primer group to the third primer group is used for PCR amplification, the system of the PCR amplification reaction is: 30-100 ng of template DNA, 0.3 μM of forward primer F1 and forward primer F2, 0.8 μM of reverse primer R, 2×Probe Mix, and deionized water to make up to 10 μl. The program of the PCR amplification reaction is: 94℃ pre-denaturation for 15 min; first step amplification reaction, 94℃ denaturation for 20 s, 65℃-57℃ gradient annealing and extension for 60 s, 10 cycles, and the temperature of annealing and extension decreases by 0.8℃ in each cycle; second step amplification reaction, 94℃ denaturation for 20 s, 57℃ annealing and extension for 60 s, 32 cycles.