Molecular markers related to crude protein content in oats and their applications
By using molecular markers related to crude protein content in oats and structural variation markers of gene 1059_6A004832, combined with GWAS technology, the problems of long screening cycles and susceptibility to environmental interference in traditional screening methods have been solved, achieving efficient and accurate germplasm screening and identification.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-16
- Publication Date
- 2026-03-10
AI Technical Summary
Traditional methods for screening oat germplasm with high crude protein content are time-consuming and easily affected by environmental factors, making it difficult to meet the needs of modern breeding for precise, efficient, and early screening.
Molecular markers associated with crude protein content in oats were provided. Structural variation markers were located in the transcriptional region of gene 1059_6A004832. Specific primers were designed for PCR identification, and genome-wide association analysis (GWAS) was used for screening.
It enables accurate prediction of candidate oat germplasm during the seedling stage, and quickly and reliably screens germplasm with high crude protein content, reducing breeding costs and time, and improving the accuracy and stability of screening.
Smart Images

Figure CN120967050B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of molecular marker assisted breeding, and in particular to a molecular marker related to oat crude protein content and application thereof. BACKGROUND
[0002] Oat is one of the important forage crops, which has the advantages of soft and juicy stems and leaves, less crude fiber content, good palatability, and higher content of protein and other nutrients. Oat hay is a high-quality feed for livestock and poultry during the winter and spring green shortage period, and the nutritional value including the crude protein content is one of the important indicators for evaluating the quality of oat forage. Oat germplasm resources are rich in China, and the crude protein content of different germplasm resources varies greatly (8%-17%). Traditional high-crude-protein germplasm screening relies on field phenotypic identification during the complete growth period, which requires a long period and is easily disturbed by environmental factors, and it is difficult to meet the needs of modern breeding for "precision, efficiency and early screening". Therefore, it is of great economic value and practical significance to screen high-quality oat resources with high crude protein content and develop molecular markers related to crude protein content.
[0003] Genome-wide association study (GWAS) is an important tool for connecting genotype and phenotype, and has been widely used in the field of agriculture to locate genetic markers related to excellent traits and carry out molecular marker assisted breeding. Traditionally, important agronomic traits are studied mainly by using single nucleotide polymorphism (SNP) or small fragment insertion / deletion (InDel) variations for GWAS. However, with the development of high-throughput sequencing technology and assembly algorithm, structural variations (SV) are gradually considered as one of the important genetic bases driving the variation of complex agronomic traits. SV includes insertion, deletion, inversion, duplication, translocation and other genomic variations larger than 50 bp, which can directly affect gene function, regulatory elements and chromatin structure, and has a significant effect on gene expression and phenotype difference. Due to the large length span and rich information of SV, its stability and repeatability in marker assisted selection and genome selection are higher, which is helpful for the stable application of molecular markers in different environments. SUMMARY
[0004] The purpose of the present application is to provide a molecular marker related to oat crude protein content and application thereof, so as to provide a molecular marker closely linked to oat forage crude protein content, fill the research blank of molecular markers related to oat forage crude protein content, and realize accurate prediction of the crude protein content of candidate oat germplasm at the seedling stage, and accelerate the screening work of high-crude-protein-content germplasm.
[0005] In order to achieve the above purpose, the present application provides a molecular marker related to oat crude protein content, which is a structural variation marker located in gene 1059_6A004832.
[0006] Preferably, the sequence of the molecular marker is shown as SEQ ID NO. 1, and the sequence of the transcription region of the gene 1059_6A004832 is shown as SEQ ID NO. 2.
[0007] Preferably, the level of crude protein content of the oat plant containing the sequence shown as SEQ ID NO. 1 is higher than that of the oat plant lacking the sequence shown as SEQ ID NO. 1.
[0008] The application of the molecular marker related to the crude protein content of oat as described above in the breeding of oat germplasm is to breed the germplasm with high crude protein content.
[0009] The application of the molecular marker related to the crude protein content of oat as described above in the identification of the protein content of oat.
[0010] The application of the gene 1059_6A004832 as described above in the breeding of oat germplasm is to breed the germplasm with high crude protein content.
[0011] A kit for identifying the crude protein content of oat, the kit comprising primers for amplifying the above-mentioned molecular marker related to the crude protein content of oat.
[0012] Preferably, the sequences of the primers are shown as SEQ ID NO. 3 and SEQ ID NO. 4.
[0013] The application of the kit for identifying the crude protein content of oat as described above in the breeding of oat germplasm is to breed the germplasm with high crude protein content.
[0014] Therefore, the present application provides the molecular marker related to the crude protein content of oat and the application thereof, and the specific technical effects are as follows:
[0015] (1) The molecular marker provided by the present application is closely linked to the crude protein content of oat, is the key genetic locus for regulating the crude protein content of oat, and can be used as a molecular marker for identifying the crude protein content of oat, and for breeding the oat germplasm with high crude protein content;
[0016] (2) The molecular marker provided by the present application is SV, has higher stability and repeatability, can realize the rapid and reliable screening and identification of the germplasm with high crude protein content, has simple operation, the identification result is not interfered by environmental factors, has better accuracy, can effectively shorten the identification time and reduce the identification cost, and has important significance for accelerating the breeding process and reducing the workload and cost of breeding.
[0017] The technical solutions of the present application are further described in detail below with the aid of the drawings and examples. BRIEF DESCRIPTION OF DRAWINGS
[0018] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed to be used in the description of the embodiments of the present application will be briefly introduced as follows. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.
[0019] Figure 1 is a graph of statistical results of crude protein content of oat germplasm in the embodiment 1 of the present application;
[0020] Figure 2 is a Manhattan plot of GWAS analysis in the embodiment 2 of the present application;
[0021] Figure 3 is a schematic diagram of the position of the molecular marker related to the crude protein content of oat obtained in the embodiment 2 of the present application in the gene;
[0022] Figure 4 is an agarose gel electrophoresis identification result in the embodiment 4 of the present application;
[0023] Figure 5 is a statistical result of crude protein content of Hap1 type germplasm, Hap1 / 2 and Hap2 type germplasm in the embodiment 4 of the present application. DETAILED DESCRIPTION
[0024] The technical solutions of the present application will be further described by the drawings and embodiments.
[0025] In order to make the purpose, technical solutions and advantages of the present application more clear, thorough and complete, the technical solutions of the present application will be clearly and completely described by the drawings and embodiments. The following detailed description is the description of the embodiments, which aims to provide further detailed description of the present application. Unless otherwise specified, all technical terms used in the present application have the same meaning as generally understood by those skilled in the art to which the present application belongs.
[0026] The instrument equipment and reagent materials used in the embodiments are obtained by commercial means; the method steps not described in detail in the embodiments are conventional technical means in the art.
[0027] Embodiment 1
[0028] 200 oat germplasms which can fully represent the global oat diversity were used as materials to obtain the crude protein content information and genomic DNA of the germplasm materials, specifically as follows:
[0029] S1, based on the collection of more than 1000 global oat germplasm resources, combined with the genotypes of different materials (resequencing data acquisition), phylogenetic analysis, genetic diversity analysis (geographical origin and morphological phenotype data), 200 oat germplasm selected to fully represent the global diversity of oat were prepared, 40 seeds of each germplasm were prepared, and were sown in the experimental field of Guyuan County, Zhangjiakou City, Hebei Province in mid-to-late May. The plot was sown according to the specification of 4 rows x 10 columns, and the row and column spacing was 30 cm. After the seedlings germinated for 1-2 weeks, the leaves of the seedlings were cut, frozen in liquid nitrogen and broken into powder with a grinder. The genomic DNA solution of each germplasm was extracted by the classic CTAB method. The healthy leaves of the 200 oat germplasm seedlings grown to the three-leaf stage were cut and stored in liquid nitrogen.
[0030] S2, after the normal growth of each germplasm to the milk stage in mid-August, the aboveground parts of the plants with uniform growth in the plot were cut, and three replicates were taken for each germplasm. After natural air drying, they were ground into powder. The crude protein content of the three replicates was determined by near-infrared spectrometer, and the average value was taken as the phenotype data of the crude protein content of the germplasm. The statistical results are shown in Table 1. Figure 1 and Table 1.
[0031] Table 1 Statistical table of oat germplasm crude protein content
[0032]
[0033]
[0034] The content is the crude protein content, and the unit is g / kg.
[0035] Example 2
[0036] The specific steps are as follows:
[0037] S1, the healthy leaves of the 200 oat germplasm three-leaf stage seedlings in liquid nitrogen storage in Example 1 were sent to the company for three generations of Pacbio HiFi low-depth sequencing. After obtaining the sequence information, it was aligned to the reference genome Avena sativa vs Marvellous (Marv-T2T, the most complete genome assembled at present), and large fragment structural variations with a length greater than 50 bp were identified to construct a whole genome SV variation map.
[0038] S2, using mixed linear model, the SV variation data and the crude protein content phenotype data obtained in Example 1 were analyzed by association analysis (GWAS), and the significant threshold was set as -log10(p) > 5.5. From the screened SV sites significantly associated with crude protein content, the SV sites located in the gene region (within 5k upstream and downstream of the gene) were screened, and a molecular marker located at the end of chromosome 6A (chromosome position 394191376bp) was located (results as shown in Figure 2 ), the sequence is shown as SEQ ID NO. 1, located in the second intron region of gene 1059_6A004832 (the sequence of the transcription region is shown as SEQ ID NO. 2, the lowercase letters are introns, and the bold sequences are primer sequences used for amplifying the molecular marker related to oat crude protein content). The position diagram is shown as Figure 3 Further analysis of the variation data found that among the 200 natural population germplasms, 61 were in the form of containing 265bp sequence, 19 were in the form of lacking 265bp sequence, and the other 120 were in the form of heterozygous of the first two sequences.
[0039] SEQ ID NO. 1:
[0040] ACTCCCTCCGTCCCGGTTTAAAGGACACAATTTGCAAACCATGCAATCCCAAAATACTTAGACACAAAAGCATTTAATCTCTGTAATTACTCCTGTGTGAAAACAATAAAATGTTTGCATGCACATGTGTGAACAAATGTGAACACTTTTCTAACTCCTTTTCTTCTTATGCATGTTCTATTCCATACTATTAAATGAACCAATTAGATGACACCTAGGGCCTAGAGAATTGCAAATTGTGTCCTTTAAACCGGGACGGAGGGAG
[0041] SEQ ID NO. 2:
[0042]
[0043] Example 3
[0044] The specific primers of the molecular marker related to the crude protein content of oat were designed based on the sequence obtained in Example 2, specifically as follows:
[0045] The specific primers were designed about 300 bp upstream and downstream of the molecular marker related to the crude protein content of oat, the sequence of the upstream primer is shown in SEQ ID NO. 3, and the sequence of the downstream primer is shown in SEQ ID NO. 4. The primer sequence information was sent to a company for synthesis of primers. After centrifugation of the received primers at 10000 rpm for 1 min, the primers were dissolved into a stock solution with a concentration of 20 mM according to the attached instructions.
[0046] SEQ ID NO. 3: CTTTCATGTTAGGTAAACTTGC
[0047] SEQ ID NO. 4: GAGATGGTGAATGTAACAAGC
[0048] Example 4
[0049] The 200 oat germplasms which can fully represent the global oat diversity were used as materials to verify the molecular marker related to the crude protein content of oat obtained in Example 2, specifically as follows:
[0050] S1, the genomic DNA solution of 120 germplasms (covering all germplasms of two single genotypes and 40 heterozygous germplasms) in the 200 oat germplasms obtained in S1 of Example 1 was used as a template, and the primers shown in SEQ ID NO. 3 and SEQ ID NO. 4 were used for PCR, and the PCR system and amplification program were performed according to the attached instructions of Taq enzyme, wherein the annealing temperature was 58℃, and the amplified PCR products were identified by agarose gel electrophoresis. The electrophoresis results of 120 natural population plants are shown in Figure 4 The electrophoresis results are obviously divided into three groups: the first group of 61 germplasms can amplify a 618 bp band (marked as Hap1 type germplasm), the second group of 19 germplasms can amplify a 353 bp band (marked as Hap2 type germplasm), and the third group of 40 germplasms can amplify two bands (marked as Hap1 / 2 type germplasm), which is a heterozygous type, and the brightness of the Hap2 type band is significantly higher than that of the Hap1 type. Hap1 is 265 bp more than Hap2, which is consistent with the results of Example 2.
[0051] According to the crude protein content information of the corresponding germplasm in Table 1 of Example 1, the crude protein content level of the Hap1 type germplasm is significantly higher than that of the Hap2 deletion type germplasm and the Hap1 / 2 heterozygous type germplasm (P < 2.2e-16, Figure 5). It is illustrated that the molecular marker obtained in Example 2 is a key site affecting the crude protein content and can be used as a molecular marker for distinguishing the crude protein content of oat.
[0052] Therefore, the molecular marker provided by the present application is closely linked to the crude protein content of oat, is a key genetic site for regulating the crude protein content of oat, and can be used as a molecular marker for identifying the crude protein content of oat, for breeding oat germplasm with high crude protein content; the molecular marker provided is SV, has higher stability and repeatability, and can realize rapid and reliable screening and identification of high crude protein content germplasm; the operation is simple, the identification result is not interfered by environmental factors, the accuracy is better, and the identification time and cost can be effectively shortened, which has important significance for accelerating the breeding process and reducing the workload and cost of breeding.
[0053] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application but not to limit it, although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that: it can still modify or equivalently replace the technical solutions of the present application, and these modifications or equivalent replacements cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present application.
Claims
1. A molecular marker associated with oat crude protein content, characterized in that: The molecular marker is a structural variation marker, located in gene 1059_6A004832; The sequence of the molecular marker is shown as SEQ ID NO. 1, and the sequence of the transcription region of gene 1059_6A004832 is shown as SEQ ID NO. 2; The oat plant containing the sequence shown as SEQ ID NO. 1 has a higher crude protein content than the oat plant lacking the sequence shown as SEQ ID NO.
1.
2. Use of a molecular marker associated with oat crude protein content according to claim 1 in the selection of oat germplasm, characterized in that: The selected oat germplasm is a high-crude-protein-content germplasm.
3. Use of the molecular marker related to oat crude protein content according to claim 1 in the identification of high and low oat crude protein content.
4. A kit for identifying the crude protein content of oats, characterized in that: The kit comprises primers for amplifying the molecular marker related to oat crude protein content according to claim 1.
5. A kit for the identification of the crude protein content of oats according to claim 4, characterized by the fact that: The sequences of the primers are shown as SEQ ID NO. 3 and SEQ ID NO.
4.
6. Use of a kit for identifying the crude protein content of oats according to claim 4 or 5 in the selection of oat germplasm, characterized in that: The selected oat germplasm is a high-crude-protein-content germplasm.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker combination for constructing oat DNA (Deoxyribonucleic Acid) fingerprint spectrum and application
CN120041595A
Plants having enhanced yield-related traits and a method for making the same
US20090241218A1